MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-320C08
Chromosome	X (Build37)
Map Location	101,575,241 - 101,684,763
singlet/doublet	doublet
Overlap gene	EG621542, Uprt
Upstream gene	Chic1, Tsx, Tsix, Xist, Rps12-ps1, LOC668406, LOC676246, ENSMUSG00000043661, LOC668412, LOC668415, B230206F22Rik, Cnbp2, LOC100042640, Slc16a2, EG621381, EG668426, LOC668430, Rnf12, C77370, Vcp-ps
Downstream gene	Zdhhc15, Magee2, LOC622098, LOC676331, 5530601H04Rik, 2610029G23Rik, Magee1, LOC622159, LOC668454, E530001F21Rik, LOC622202, LOC100043213, LOC668458
Link	Open Mouse BAC browser

Click to get alignment info.

name	Chic1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12212 MGI:1344694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22127 MGI:108118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsix (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22097 MGI:1336196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xist (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213742 MGI:98974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rps12-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30964 MGI:1353638
definition	gene_synonym : pS12X note : ribosomal protein S12, pseudogene 1 pseudo : _no_value

name	LOC668406 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 218 ESTs, 2 Proteins pseudo : _no_value

name	LOC676246 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	ENSMUSG00000043661 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621818 MGI:3641899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668412 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC668415 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	B230206F22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78878 MGI:1926128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Cnbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75064 MGI:1922314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042640 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Slc16a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20502 MGI:1203732
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621381 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621381 MGI:3648722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 268 ESTs, 11 Proteins

name	EG668426 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668426 MGI:3646866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	LOC668430 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668430
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Rnf12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19820 MGI:1342291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C77370 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245555 MGI:2148050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vcp-ps (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:236937
definition	note : valosin containing protein pseudogene pseudo : _no_value

name	EG621542 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621542 MGI:3648913
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins

name	Uprt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331487 MGI:2685620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108672 MGI:1915336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magee2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272790 MGI:2148316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622098 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 46 ESTs, 8 Proteins pseudo : _no_value

name	LOC676331 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	5530601H04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71445 MGI:1918695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	2610029G23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67683 MGI:1914933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magee1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107528 MGI:2148149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622159 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins pseudo : _no_value

name	LOC668454 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	E530001F21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:279610 MGI:3036288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	LOC622202 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622202
definition	note : ribosomal protein L30 pseudogene pseudo : _no_value

name	LOC100043213 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC668458 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668458
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 12 Proteins pseudo : _no_value

name	Chic1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55742748 GeneID:12212 MGI:1344694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich hydrophobic domain 1 transcript_id : NM_009767.1

name	Tsx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678450 GeneID:22127 MGI:108118
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis specific X-linked gene transcript_id : NM_009440.1

name	ENSMUSG00000043661 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865930 GeneID:621818 MGI:3641899
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, ENSMUSG00000043661 transcript_id : NM_001045541.1

name	B230206F22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271848 GeneID:78878 MGI:1926128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA B230206F22 gene transcript_id : XM_001479486.1

name	Cnbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385400 GeneID:75064 MGI:1922314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cellular nucleic acid binding protein 2 transcript_id : NM_029158.2

name	Slc16a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112421074 GeneID:20502 MGI:1203732
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 16 (monocarboxylic acid transporters), member 2 transcript_id : NM_009197.2

name	EG621381 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271850 GeneID:621381 MGI:3648722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 264 ESTs, 11 Proteins product : predicted gene, EG621381 transcript_id : XM_887206.3

name	Rnf12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47078288 GeneID:19820 MGI:1342291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 12 transcript_id : NM_011276.3

name	C77370 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116325978 GeneID:245555 MGI:2148050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C77370 transcript_id : NM_001077354.1

name	EG621542 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83003142 GeneID:621542 MGI:3648913
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : predicted gene, EG621542 transcript_id : XM_887355.1

name	Uprt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487134 GeneID:331487 MGI:2685620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) transcript_id : NM_001081189.1

name	Zdhhc15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388664 GeneID:108672 MGI:1915336
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 15 transcript_id : NM_175358.3

name	Magee2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62990116 GeneID:272790 MGI:2148316
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family E, 2 transcript_id : NM_053206.1

name	5530601H04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271853 GeneID:71445 MGI:1918695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : RIKEN cDNA 5530601H04 gene transcript_id : XM_001479596.1

name	2610029G23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803459 GeneID:67683 MGI:1914933
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610029G23 gene transcript_id : NM_026312.3

name	Magee1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111378376 GeneID:107528 MGI:2148149
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family E, 1 transcript_id : NM_053201.3

name	LOC100043213 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271856 GeneID:100043213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100043213 transcript_id : XM_001479629.1

name	Chic1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55742749 GeneID:12212 MGI:1344694
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : cystein-rich hydrophobic domain 1; brain X-linked product : cysteine-rich hydrophobic domain 1 protein_id : NP_033897.1

name	Tsx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678451 GeneID:22127 MGI:108118
definition	codon_start : 1 product : testis specific X-linked protein_id : NP_033466.1

name	ENSMUSG00000043661 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865931 GeneID:621818 MGI:3641899
definition	codon_start : 1 note : BMI1-like; polycomb group ring finger 6-like product : hypothetical protein LOC621818 protein_id : NP_001039006.1

name	B230206F22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271849 GeneID:78878 MGI:1926128
definition	codon_start : 1 product : thrombocytosis, familial X-linked protein_id : XP_001479536.1

name	Cnbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55925630 CCDS:CCDS30329.1 GeneID:75064 MGI:1922314
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : cellular nucleic acid binding-like protein product : cellular nucleic acid binding protein 2 protein_id : NP_083434.1

name	Slc16a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112421075 CCDS:CCDS30330.1 GeneID:20502 MGI:1203732
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : X-linked PEST-containing transporter; monocarboxylate transporter 8 product : solute carrier family 16, member 2 protein_id : NP_033223.2

name	EG621381 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271851 GeneID:621381 MGI:3648722
definition	codon_start : 1 product : similar to 16.7 kDa-like protein protein_id : XP_892299.2

name	Rnf12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47078289 CCDS:CCDS30331.1 GeneID:19820 MGI:1342291
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IC] codon_start : 1 note : Hoxa1 regulated product : ring finger protein 12 protein_id : NP_035406.3

name	C77370 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116325979 GeneID:245555 MGI:2148050
definition	GO_function : GO:0008408 - 3'-5' exonuclease activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 product : hypothetical protein LOC245555 protein_id : NP_001070822.1

name	EG621542 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83003143 GeneID:621542 MGI:3648913
definition	codon_start : 1 product : similar to 39S ribosomal protein L30, mitochondrial precursor (L30mt) (MRP-L30) protein_id : XP_892448.1

name	Uprt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487135 GeneID:331487 MGI:2685620
definition	codon_start : 1 product : uracil phosphoribosyltransferase (FUR1) homolog protein_id : NP_001074658.1

name	Zdhhc15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425060 CCDS:CCDS30332.1 GeneID:108672 MGI:1915336
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016409 - palmitoyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045184 - establishment of protein localization [Evidence IDA]; GO:0018345 - protein palmitoylation [Evidence IDA]; GO:0016188 - synaptic vesicle maturation [Evidence IMP] [Evidence IGI] codon_start : 1 product : zinc finger, DHHC domain containing 15 protein_id : NP_780567.1

name	Magee2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62990117 CCDS:CCDS30333.1 GeneID:272790 MGI:2148316
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : melanoma antigen, family E, 2 protein_id : NP_444436.1

name	5530601H04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271854 GeneID:71445 MGI:1918695
definition	codon_start : 1 product : hypothetical protein LOC71445 protein_id : XP_001479646.1

name	2610029G23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385810 CCDS:CCDS30334.1 GeneID:67683 MGI:1914933
definition	codon_start : 1 note : novel protein containing Domain of Unknown Function (DUF757) product : hypothetical protein LOC67683 protein_id : NP_080588.1

name	Magee1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111378377 GeneID:107528 MGI:2148149
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0030425 - dendrite [Evidence IDA]; GO:0016010 - dystrophin-associated glycoprotein complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0048471 - perinuclear region [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEP] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : melanoma antigen, family E, 1 protein_id : NP_444431.3

name	LOC100043213 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271857 GeneID:100043213
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479679.1

name	LOC676246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676246
definition	number : 1 pseudo : _no_value

name	LOC676246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676246
definition	number : 2 pseudo : _no_value

name	LOC668412 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668412
definition	number : 1 pseudo : _no_value

name	LOC668415 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668415
definition	number : 1 pseudo : _no_value

name	LOC668415 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668415
definition	number : 2 pseudo : _no_value

name	LOC100042640 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042640
definition	number : 1 pseudo : _no_value

name	LOC100042640 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042640
definition	number : 2 pseudo : _no_value

name	EG668426 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668426
definition	number : 1 pseudo : _no_value

name	LOC668430 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668430
definition	number : 1 pseudo : _no_value

name	LOC676331 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676331
definition	number : 1 pseudo : _no_value

name	LOC668454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668454
definition	number : 2 pseudo : _no_value

name	LOC668454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668454
definition	number : 1 pseudo : _no_value

name	Rps12-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	gene_synonym : pS12X note : S19 pseudogene pseudo : _no_value

name	Tsix (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872141 GeneID:22097 MGI:1336196
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X (inactive)-specific transcript, antisense transcript_id : NR_002844.1

name	Xist (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:37704376 GeneID:213742 MGI:98974
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inactive X specific transcripts transcript_id : NR_001570.1

name	Xist (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:37704378 GeneID:213742 MGI:98974
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inactive X specific transcripts transcript_id : NR_001463.2

name	LOC668406 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271847 GeneID:668406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 218 ESTs, 2 Proteins product : similar to ribosomal protein S12 pseudo : _no_value transcript_id : XR_034219.1

name	LOC622098 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271852 GeneID:622098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 46 ESTs, 8 Proteins product : similar to Ribosomal protein L12 pseudo : _no_value transcript_id : XR_034284.1

name	LOC622159 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271855 GeneID:622159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : similar to spermine synthase pseudo : _no_value transcript_id : XR_034293.1

name	E530001F21Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:95006997 GeneID:279610 MGI:3036288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E530001F21 gene pseudo : _no_value transcript_id : NR_002167.2

name	LOC668458 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271858 GeneID:668458
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 12 Proteins product : similar to small GTP binding protein pseudo : _no_value transcript_id : XR_034298.1

clone name	MSMg01-294B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055F12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-093K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221F15
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-320C08.b	B6Ng01-320C08.g
ACC	GA109594	GA109595
length	1,088	1,029
definition	B6Ng01-320C08.b	B6Ng01-320C08.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(101,683,657 - 101,684,763)	(101,575,241 - 101,576,146)
sequence	gaattcaaatgtagctgggcatcatgtgttttacctgctaagaacagaaa taattcaatggactttcaaagcaagaatatgaaaataaagagtgtaatgg cccagatttaatactttgtttgttcgttaaaccaatgggtaaaagggaag tgaaacctaaaagcagctctgtcgggttcaatcaaaaggtaggcttcact tcaagctacggtttagtgtatctctcaaagtataatttctacctctataa ttttgtgatctctaaaatcaagaacagccccaaggtttgctgtagcatac agatggtttacaactgattttactcttcccattgccttcgaaaaacaacc ccctaacaacatacttaaaaccaatctaacttaatggtaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaagctttttctacctgccaggtgcaagtcagca aagtcacagcttgttagcacctcttaataagctcataaaatagagttcca tgcattgtctacttgcatctccaaacagagttcaaaataaatgtcaaaaa gtgggtagaaaaacaagagatgtcattttcacctgcttgagtccaacgta acgggtgagacattactaggatagccccaacacatagtacatcagacatt tgtgctacttaaagatggggcttcctattgtacacccagtaaaaaataca tatggggaatatactaaaacaaaaagcatgtccatgttttaaacaatttg caaattatatttcccctatggtaagcattctggtttcatataaattgaaa tgatacattctgagattcctctagtctcggagtgaggctagtcctttaag tacttctagttcccatatacatccctgaatcactctatactgcaagtctg aaggcaagccagtcattaaactgggagtcgggacatttttccagaggcag tggtctcaccttgagcacagtgtgtgatcctgtgtgctgtttgtatactg caatacgttccacccacactacacagcactctagatgggagcagagtgtt ttttaaaagctcactatcaatctatgcacagctgacta	gaattcagtaaagagacagaaatactgaagagaactcaggctgaaatgaa gatggaactggaaaactcaatgaaaacctagaaaattcagggaagcctta ccagtagaaggtatcaaatagaagaaaaaaatatcaggatatgtcttagt cagggtttctattcctggacaaaacatcatgaccaagaagcaagttgggg aggaaagagtttattcagcttacacttccatactgctgttgatcatcaga ggaagtcaggactggaactcaagcaggtcaggaagcaggaggtgatccag aggccatggagggatgttctttactggcttgcttctcctggcttgctcag cctgctctcttatagaaccaagactagcagcccagagatggtcccaccca caaggggcctttcccccttgatcactaattgagaaaatgccttacagctg gatctcatggaggcatttccccaactgaagctcctttctctgtgataact ccagctgtgtcaagttgacacaaaaccagccagtgctcaagcgaagatca tgaaaaaattaaacacataataggactatataagtactgtgggacaccct gaaataagcagtttcgaaggtgcaagtaatcattatgtgatcccactgcc tattgtggtaacacatgggagctattctatattttgttcagtcttcagtc tagataaagagttaaaatataaaggaagaaaatgacacactacaccctca gaaatgtcatgccaatacatctccaataacagcgcctaagcattattatc ccaacactggcatatgtagatctattttcatcattattcatcatttattc agtaactgctcactgtaaactttcagtacaatatattaaaatatattaga actgttatatctaatgtaatactagatttttaaaattatctttactttat tcactgccccttccccccacaccaccatccacaaatccttccacctctcc ctttccttttcccgtcttgggtgggtgag
quality values	Open. Hide. 62 41 42 41 62 37 22 56 62 54 54 62 54 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 59 43 43 27 28 44 46 32 43 28 27 48 59 50 54 54 59 49 49 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 59 62 56 62 59 62 62 62 49 49 62 59 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 49 49 62 62 62 62 62 62 49 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 51 42 51 56 56 56 56 56 56 51 51 56 56 56 56 56 56 34 33 50 22 50 38 56 56 56 56 56 56 39 62 62 62 62 43 43 56 38 56 46 38 41 56 56 56 43 56 46 39 50 43 43 50 43 47 46 43 54 52 52 48 52 43 52 52 48 52 52 62 62 62 52 43 40 25 52 42 62 54 62 62 48 52 62 47 43 48 52 52 46 52 49 52 42 52 52 52 32 28 42 34 32 42 54 42 58 52 52 42 32 47 42 54 54 54 54 52 58 58 52 52 52 52 48 54 52 54 54 54 58 52 52 42 47 54 52 54 52 47 47 54 54 52 52 52 54 52 52 42 48 33 38 31 46 49 52 47 39 58 58 58 53 42 41 47 47 50 50 50 50 51 47 40 40 48 45 39 50 49 51 45 58 49 58 51 51 53 50 58 58 32 46 40 52 52 50 50 43 47 53 49 54 39 32 49 49 58 58 53 53 37 50 50 51 51 53 53 46 37 50 50 52 51 48 49 50 22 58 40 50 58 50 50 52 50 51 54 49 50 33 49 50 40 51 50 40 44 40 46 43 39 42 40 50 41 42 52 52 50 58 49 50 37 41 50 37 51 58 46 34 53 41 41 51 54 54 54 35 34 45 44 26 50 39 42 51 54 54 44 39 41 37 32 45 39 44 52 42 54 50 49 42 52 52 54 54 53 39 43 32 40 52 39 38 52 27 37 53 45 54 54 30 29 54 52 30 19 52 40 54 53 40 40 34 54 40 30 39 40 40 40 32 52 33 32 53 52 40 31 34 26 47 46 19 41 33 29 33 31 29 51 34 25 45 41 21 46 31 31 29 39 35 40 30 46 34 33 37 30 41 51 30 28 30 31 26 31 31 33 30 36 32 25 24 33 15 31 29 28 25 43 38 36 31 39 26 31 34 34 34 31 31 37 21 31 30 30 18 42 32 32 34 32 32 36 31 30 48 25 27 29 33 31 31 31 22 29 20 25 31 33 31 25 32 47 30 24 26 28 23 22 33 23 31 25 47 20 26 32 30 33 29 33 29 30 31 33 35 27 23 25 25 23 42 25 28 21 34 36 31 32 29 26 19 13 17 12 17 22 31 25 38 24 19 19 33 25 30 17 16 44 25 19 32 31 47 24 19 17 32 21 22 36 22 19 14 23 34 48 47 43 29 18 33 19 11 26 11 37 17 23 27 14 12 19 4 13 16 13 10 14 32 13 11 10 26 10 18 24 20 11 9 14 23 8 18 20 22 18 22 13 16 10 19 7 6 11 19 19 18 20 12 47 20 17 18 22 3 9 28 27 26 20 11 10 6 9 28 20 18 15 18 20 20 15 28 15 5 3 4 26 28 18 16 6 15 28 15 10 5 4 5 7 11 5 3 2 6 16 28 6 6 3 3 5 13 6 5 18 3 4 18 30 28 26 11 14 29 29 18 10 13 8 4 7 6 6 13 16 18 7 8 22 5 4 14 6 20 9 5 5 9 10 12 23 8 3 6 21 23	Open. Hide. 62 47 51 47 62 47 44 56 47 56 34 43 30 34 28 20 28 28 27 56 45 59 62 62 59 62 54 54 62 54 54 62 62 62 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 59 59 59 59 54 56 54 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 51 59 62 62 62 62 62 59 59 62 62 54 54 62 62 62 62 62 62 62 62 62 59 62 59 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 59 59 59 59 56 59 59 59 62 54 56 62 54 54 59 56 50 48 40 59 62 59 59 59 59 62 62 62 62 62 62 54 54 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 54 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 46 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 56 62 62 62 62 62 62 62 59 62 62 62 62 56 49 44 49 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 54 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 54 47 54 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 48 62 62 62 62 62 54 62 62 62 48 62 58 58 54 58 48 54 54 58 54 54 54 58 58 58 58 52 52 58 54 54 58 54 38 38 44 58 54 58 58 58 58 58 58 58 39 54 58 54 58 58 58 54 58 58 58 52 58 58 58 54 58 45 39 58 52 58 54 58 58 58 54 58 52 58 58 58 54 58 58 58 54 52 52 41 58 58 58 58 58 58 58 52 51 58 47 58 51 53 58 58 48 58 34 58 51 37 49 40 58 54 50 51 58 53 54 58 48 58 50 58 49 51 58 58 52 51 42 46 58 58 50 42 41 43 54 41 58 47 50 49 50 58 40 58 51 52 50 50 46 52 51 50 58 58 58 44 26 25 58 49 50 46 48 51 50 50 51 50 47 54 58 39 49 49 49 43 43 50 50 51 40 50 53 31 52 53 53 52 49 35 49 52 38 58 50 39 58 41 53 40 53 54 39 42 54 52 49 42 54 51 49 51 54 41 32 51 54 54 32 38 54 46 50 37 49 41 54 53 42 54 49 54 54 54 51 45 40 27 19 15 20 38 53 31 52 37 41 53 42 47 19 33 33 26 39 37 53 43 53 51 35 24 44 35 31 37 34 31 34 40 32 47 53 33 28 41 32 53 40 53 31 32 32 41 32 32 31 46 40 31 31 45 32 32 30 52 52 31 31 43 35 31 41 31 31 38 37 36 39 37 31 31 51 51 45 30 31 42 37 31 26 51 31 28 31 38 33 36 36 31 27 46 32 27 15 38 33 24 31 30 23 24 32 32 42 38 43 31 28 31 31 43 25 31 46 31 31 38 48 32 31 25 26 30 31 31 18 24 37 34 31 29 32 31 31 46 47 41 34 31 30 25 31 31 39 23 31 30 36 34 38 21 23 31 31 29 29 37 33 30 27 19 38 19 44 17 14 21 32 35 32 11 22 18 44 41 44 25 25 41 44 30 10 21 26 29 9 8 31 25 14 12 9 32 12 32 13 14 18 15 24 21 20 17 48 43 33 12 10 29 31 18 31 17 14 19 24 22 8 8 6 11 10 7 8 17 10 7 6 8 20 11 19 15 11 14 6 8 24 6 21 6 4 7 12 14 28 11 10 20 9 14 11 28 32 25 20 7 15 11 4 12 8 6 9 21 28 9 5 6 28 20 13 14 27 15

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_101683657_101684763
seq2: B6Ng01-320C08.b_46_1133 (reverse)

seq1  TAGTCCAAGCTGTGCATTAGAATTGATAGTGAAGGCTTTTTAAAAAACCA  50
      |||||  ||||||||| ||| |||||||||||  || |||||||||||  
seq2  TAGTC--AGCTGTGCA-TAG-ATTGATAGTGA--GC-TTTTAAAAAAC--  41

seq1  ACTTCCTGGCTCCCATCCTTAGAGGTTGCTTGTGTAGTGTTGGGTGGAAC  100
      |||  || |||||||||  |||||  ||| ||||||||| ||||||||||
seq2  ACT--CT-GCTCCCATC--TAGAG--TGC-TGTGTAGTG-TGGGTGGAAC  82

seq1  GTATTTGCAGTATTACAAACAGCACACAGGATCACACACTGTGCTC-AGG  149
      ||| |||||||| ||||||||||||||||||||||||||||||||| |||
seq2  GTA-TTGCAGTA-TACAAACAGCACACAGGATCACACACTGTGCTCAAGG  130

seq1  TGAGACCACTGCCTCTGGAAAAATGTCCCGACTCCCAGTTTAATGACTGG  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGACCACTGCCTCTGGAAAAATGTCCCGACTCCCAGTTTAATGACTGG  180

seq1  CTTGCCTTCAGACTTGCAGTATAGAGTGATTCAGGGATGTATATGGGAAC  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGCCTTCAGACTTGCAGTATAGAGTGATTCAGGGATGTATATGGGAAC  230

seq1  TAGAAGTACTTAAAGGACTAGCCTCACTCCGAGACTAGAGGAATCTCAGA  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAAGTACTTAAAGGACTAGCCTCACTCCGAGACTAGAGGAATCTCAGA  280

seq1  ATGTATCATTTCAATTTATATGAAACCAGAATGCTTACCATAGGGGAAAT  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTATCATTTCAATTTATATGAAACCAGAATGCTTACCATAGGGGAAAT  330

seq1  ATAATTTGCAAATTGTTTAAAACATGGACATGCTTTTTGTTTTAGTATAT  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAATTTGCAAATTGTTTAAAACATGGACATGCTTTTTGTTTTAGTATAT  380

seq1  TCCCCATATGTATTTTTTACTGGGTGTACAATAGGAAGCCCCATCTTTAA  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCATATGTATTTTTTACTGGGTGTACAATAGGAAGCCCCATCTTTAA  430

seq1  GTAGCACAAATGTCTGATGTACTATGTGTTGGGGCTATCCTAGTAATGTC  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGCACAAATGTCTGATGTACTATGTGTTGGGGCTATCCTAGTAATGTC  480

seq1  TCACCCGTTACGTTGGACTCAAGCAGGTGAAAATGACATCTCTTGTTTTT  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACCCGTTACGTTGGACTCAAGCAGGTGAAAATGACATCTCTTGTTTTT  530

seq1  CTACCCACTTTTTGACATTTATTTTGAACTCTGTTTGGAGATGCAAGTAG  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACCCACTTTTTGACATTTATTTTGAACTCTGTTTGGAGATGCAAGTAG  580

seq1  ACAATGCATGGAACTCTATTTTATGAGCTTATTAAGAGGTGCTAACAAGC  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAATGCATGGAACTCTATTTTATGAGCTTATTAAGAGGTGCTAACAAGC  630

seq1  TGTGACTTTGCTGACTTGCACCTGGCAGGTAGAAAAAGCTTTTTTTTTTT  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGACTTTGCTGACTTGCACCTGGCAGGTAGAAAAAGCTTTTTTTTTTT  680

seq1  TTTTTTTTTTTTTTTTTTTTACCATTAAGTTAGATTGGTTTTAAGTATGT  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTTTTTTTTTTTTTTACCATTAAGTTAGATTGGTTTTAAGTATGT  730

seq1  TGTTAGGGGGTTGTTTTTCGAAGGCAATGGGAAGAGTAAAATCAGTTGTA  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTAGGGGGTTGTTTTTCGAAGGCAATGGGAAGAGTAAAATCAGTTGTA  780

seq1  AACCATCTGTATGCTACAGCAAACCTTGGGGCTGTTCTTGATTTTAGAGA  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCATCTGTATGCTACAGCAAACCTTGGGGCTGTTCTTGATTTTAGAGA  830

seq1  TCACAAAATTATAGAGGTAGAAATTATACTTTGAGAGATACACTAAACCG  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACAAAATTATAGAGGTAGAAATTATACTTTGAGAGATACACTAAACCG  880

seq1  TAGCTTGAAGTGAAGCCTACCTTTTGATTGAACCCGACAGAGCTGCTTTT  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCTTGAAGTGAAGCCTACCTTTTGATTGAACCCGACAGAGCTGCTTTT  930

seq1  AGGTTTCACTTCCCTTTTACCCATTGGTTTAACGAACAAACAAAGTATTA  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTTTCACTTCCCTTTTACCCATTGGTTTAACGAACAAACAAAGTATTA  980

seq1  AATCTGGGCCATTACACTCTTTATTTTCATATTCTTGCTTTGAAAGTCCA  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCTGGGCCATTACACTCTTTATTTTCATATTCTTGCTTTGAAAGTCCA  1030

seq1  TTGAATTATTTCTGTTCTTAGCAGGTAAAACACATGATGCCCAGCTACAT  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAATTATTTCTGTTCTTAGCAGGTAAAACACATGATGCCCAGCTACAT  1080

seq1  TTGAATTC  1107
      ||||||||
seq2  TTGAATTC  1088

seq1: chrX_101575241_101576146
seq2: B6Ng01-320C08.g_188_1096

seq1  GAAGAAAAAAATATCAGGATATGTCTTAGTCAGGGTTTCTATTCCTGGAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGAAAAAAATATCAGGATATGTCTTAGTCAGGGTTTCTATTCCTGGAC  50

seq1  AAAACATCATGACCAAGAAGCAAGTTGGGGAGGAAAGAGTTTATTCAGCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACATCATGACCAAGAAGCAAGTTGGGGAGGAAAGAGTTTATTCAGCT  100

seq1  TACACTTCCATACTGCTGTTGATCATCAGAGGAAGTCAGGACTGGAACTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACACTTCCATACTGCTGTTGATCATCAGAGGAAGTCAGGACTGGAACTC  150

seq1  AAGCAGGTCAGGAAGCAGGAGGTGATCCAGAGGCCATGGAGGGATGTTCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAGGTCAGGAAGCAGGAGGTGATCCAGAGGCCATGGAGGGATGTTCT  200

seq1  TTACTGGCTTGCTTCTCCTGGCTTGCTCAGCCTGCTCTCTTATAGAACCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACTGGCTTGCTTCTCCTGGCTTGCTCAGCCTGCTCTCTTATAGAACCA  250

seq1  AGACTAGCAGCCCAGAGATGGTCCCACCCACAAGGGGCCTTTCCCCCTTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACTAGCAGCCCAGAGATGGTCCCACCCACAAGGGGCCTTTCCCCCTTG  300

seq1  ATCACTAATTGAGAAAATGCCTTACAGCTGGATCTCATGGAGGCATTTCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCACTAATTGAGAAAATGCCTTACAGCTGGATCTCATGGAGGCATTTCC  350

seq1  CCAACTGAAGCTCCTTTCTCTGTGATAACTCCAGCTGTGTCAAGTTGACA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAACTGAAGCTCCTTTCTCTGTGATAACTCCAGCTGTGTCAAGTTGACA  400

seq1  CAAAACCAGCCAGTGCTCAAGCGAAGATCATGAAAAAATTAAACACATAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAACCAGCCAGTGCTCAAGCGAAGATCATGAAAAAATTAAACACATAA  450

seq1  TAGGACTATATAAGTACTGTGGGACACCCTGAAATAAGCAGTTTCGAAGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGACTATATAAGTACTGTGGGACACCCTGAAATAAGCAGTTTCGAAGG  500

seq1  TGCAAGTAATCATTATGTGATCCCACTGCCTATTGTGGTAACACATGGGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAAGTAATCATTATGTGATCCCACTGCCTATTGTGGTAACACATGGGA  550

seq1  GCTATTCTATATTTTGTTCAGTCTTCAGTCTAGATAAAGAGTTAAAATAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTATTCTATATTTTGTTCAGTCTTCAGTCTAGATAAAGAGTTAAAATAT  600

seq1  AAAGGAAGAAAATGACACACTACACCCTCAGAAATGTCATGCCAATACAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGAAGAAAATGACACACTACACCCTCAGAAATGTCATGCCAATACAT  650

seq1  CTCCAATAACAGCGCCTAAGCATTATTATCCCAACACTGGCATATGTAGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCAATAACAGCGCCTAAGCATTATTATCCCAACACTGGCATATGTAGA  700

seq1  TCTATTTTCATCATTATTCATCATTTATTCAGTAACTGCTCACTGTAAAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTATTTTCATCATTATTCATCATTTATTCAGTAACTGCTCACTGTAAAC  750

seq1  TTTCAGTACAATATATTAAAATATATTAGAACTGTTATATCTAATGTAAT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCAGTACAATATATTAAAATATATTAGAACTGTTATATCTAATGTAAT  800

seq1  ACTAGATTTTTAAAATTATTCTTTAC-TTATTCACTGCCCCTCCCCCCAC  849
      |||||||||||||||||| ||||||| ||||||||||||||| |||||  
seq2  ACTAGATTTTTAAAATTA-TCTTTACTTTATTCACTGCCCCTTCCCCCCA  849

seq1  CACCCCCTCCCAC-AATCCTTCCCCCTCTCCC-TTCCTTTTCCCCTC-TG  896
      |||| ||  |||| ||||||||| |||||||| ||||||||||| || ||
seq2  CACCACCATCCACAAATCCTTCCACCTCTCCCTTTCCTTTTCCCGTCTTG  899

seq1  GGTGGGTGAG  906
      ||||||||||
seq2  GGTGGGTGAG  909

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information