MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-322H03
Chromosome	X (Build37)	X (Build37)
Map Location	29,955,807 - 29,956,738	28,984,765 - 28,985,915
singlet/doublet	singlet	singlet
Overlap gene	none
Upstream gene	LOC100042087, LOC100039171, LOC100042103, LOC100042109, LOC100042115, LOC100042122, LOC100042135, LOC100042144, LOC664982, LOC100039212, EG664989, LOC664996, LOC100039467
Downstream gene	LOC100039481, LOC100039224, LOC100039500, LOC100040448, LOC100040458, LOC100040467, EG546176, LOC100040482, LOC629997, 1700017G21Rik, LOC665014, EG546205
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042087 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042087
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC100039171 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100042103 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 65 ESTs

name	LOC100042109 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 16 ESTs, 5 Proteins

name	LOC100042115 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042115
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 ESTs

name	LOC100042122 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC100042135 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 65 ESTs

name	LOC100042144 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 16 ESTs, 5 Proteins

name	LOC664982 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 66 ESTs

name	LOC100039212 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039212
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG664989 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664989 MGI:3646492
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC664996 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs

name	LOC100039467 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 5 Proteins

name	LOC100039481 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 69 ESTs

name	LOC100039224 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100039500 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins pseudo : _no_value

name	LOC100040448 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC100040458 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040458
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC100040467 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 26 Proteins

name	EG546176 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546176 MGI:3645924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins

name	LOC100040482 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC629997 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	1700017G21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71847 MGI:1919097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665014 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665014
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	EG546205 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546205 MGI:3647272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 24 Proteins

name	LOC100039171 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271390 GeneID:100039171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to pol protein transcript_id : XM_001472388.1

name	LOC100042103 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271399 GeneID:100042103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 64 ESTs product : hypothetical protein LOC100042103, transcript variant 1 transcript_id : XM_001477265.1

name	LOC100042103 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271397 GeneID:100042103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 64 ESTs product : hypothetical protein LOC100042103, transcript variant 2 transcript_id : XM_001477280.1

name	LOC100042109 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271403 GeneID:100042109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : similar to Sycp3 like X-linked, transcript variant 2 transcript_id : XM_001477327.1

name	LOC100042109 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271401 GeneID:100042109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : similar to Sycp3 like X-linked, transcript variant 1 transcript_id : XM_001477305.1

name	LOC100042115 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271405 GeneID:100042115
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 ESTs product : hypothetical protein LOC100042115 transcript_id : XM_001477343.1

name	LOC100042135 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271410 GeneID:100042135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 60 ESTs product : hypothetical protein LOC100042135, transcript variant 1 transcript_id : XM_001477363.1

name	LOC100042135 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271408 GeneID:100042135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : hypothetical protein LOC100042135, transcript variant 2 transcript_id : XM_001477384.1

name	LOC100042144 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271414 GeneID:100042144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : similar to XMR, transcript variant 2 transcript_id : XM_001477423.1

name	LOC100042144 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271412 GeneID:100042144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : similar to XMR, transcript variant 1 transcript_id : XM_001477404.1

name	LOC664982 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271416 GeneID:664982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 66 ESTs product : hypothetical LOC664982 transcript_id : XM_973856.2

name	LOC100039212 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271417 GeneID:100039212
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to pol protein transcript_id : XM_001472463.1

name	LOC664996 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271422 GeneID:664996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs product : hypothetical protein LOC664996 transcript_id : XM_973930.2

name	LOC100039467 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271425 GeneID:100039467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 14 ESTs, 5 Proteins product : similar to XMR, transcript variant 2 transcript_id : XM_001473144.1

name	LOC100039467 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271423 GeneID:100039467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs, 5 Proteins product : similar to XMR, transcript variant 1 transcript_id : XM_001473126.1

name	LOC100039481 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271429 GeneID:100039481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 64 ESTs product : hypothetical protein LOC100039481, transcript variant 1 transcript_id : XM_001473156.1

name	LOC100039481 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271427 GeneID:100039481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : hypothetical protein LOC100039481, transcript variant 2 transcript_id : XM_001473178.1

name	LOC100039224 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271419 GeneID:100039224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to pol protein transcript_id : XM_001472484.1

name	LOC100040448 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271435 GeneID:100040448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001474927.1

name	LOC100040458 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271437 GeneID:100040458
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001474942.1

name	LOC100040467 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271439 GeneID:100040467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein transcript_id : XM_001474959.1

name	EG546176 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407266 GeneID:546176 MGI:3645924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins product : predicted gene, EG546176 transcript_id : XM_620811.3

name	LOC100040482 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271441 GeneID:100040482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001474981.1

name	1700017G21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803050 GeneID:71847 MGI:1919097
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700017G21 gene transcript_id : NM_027955.2

name	EG546205 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271443 GeneID:546205 MGI:3647272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 24 Proteins product : predicted gene, EG546205 transcript_id : XM_620848.4

name	LOC100039171 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271391 GeneID:100039171
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472438.1

name	LOC100042103 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271398 GeneID:100042103
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001477330.1

name	LOC100042103 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271400 GeneID:100042103
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001477315.1

name	LOC100042109 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271402 GeneID:100042109
definition	codon_start : 1 product : similar to Sycp3 like X-linked isoform 1 protein_id : XP_001477355.1

name	LOC100042109 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271404 GeneID:100042109
definition	codon_start : 1 product : similar to Sycp3 like X-linked isoform 2 protein_id : XP_001477377.1

name	LOC100042115 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271406 GeneID:100042115
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477393.1

name	LOC100042135 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271409 GeneID:100042135
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001477434.1

name	LOC100042135 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271411 GeneID:100042135
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001477413.1

name	LOC100042144 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271413 GeneID:100042144
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001477454.1

name	LOC100042144 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271415 GeneID:100042144
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001477473.1

name	LOC664982 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407259 GeneID:664982
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978950.1

name	LOC100039212 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271418 GeneID:100039212
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472513.1

name	LOC664996 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407262 GeneID:664996
definition	codon_start : 1 product : hypothetical protein protein_id : XP_979024.1

name	LOC100039467 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271424 GeneID:100039467
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001473176.1

name	LOC100039467 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271426 GeneID:100039467
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001473194.1

name	LOC100039481 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271428 GeneID:100039481
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001473228.1

name	LOC100039481 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271430 GeneID:100039481
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001473206.1

name	LOC100039224 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271420 GeneID:100039224
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472534.1

name	LOC100040448 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271436 GeneID:100040448
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474977.1

name	LOC100040458 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271438 GeneID:100040458
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474992.1

name	LOC100040467 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271440 GeneID:100040467
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001475009.1

name	EG546176 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63830935 GeneID:546176 MGI:3645924
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_620811.1

name	LOC100040482 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271442 GeneID:100040482
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475031.1

name	1700017G21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313693 GeneID:71847 MGI:1919097
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC71847 protein_id : NP_082231.1

name	EG546205 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63831219 GeneID:546205 MGI:3647272
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_620848.1

name	LOC629997 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629997
definition	number : 1 pseudo : _no_value

name	LOC665014 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665014
definition	number : 3 pseudo : _no_value

name	LOC665014 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665014
definition	number : 2 pseudo : _no_value

name	LOC665014 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665014
definition	number : 1 pseudo : _no_value

name	LOC100042087 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271396 GeneID:100042087
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : similar to XMR pseudo : _no_value transcript_id : XR_033154.1

name	LOC100042122 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271407 GeneID:100042122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : similar to XMR pseudo : _no_value transcript_id : XR_033191.1

name	EG664989 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271421 GeneID:664989 MGI:3646492
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : predicted gene, EG664989 pseudo : _no_value transcript_id : XR_035658.1

name	LOC100039500 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271431 GeneID:100039500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins product : similar to Xlr-related, meiosis regulated pseudo : _no_value transcript_id : XR_031082.1

clone name	MSMg01-055B17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-280I18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-547A24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-541P15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-334A04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-316D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-261I16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-511H17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-514B17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-371B04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-383M18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-414F21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-415O13
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-015K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138B11
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-322H03.b	B6Ng01-322H03.g
ACC	GA111284	GA111285
length	1,122	1,154
definition	B6Ng01-322H03.b	B6Ng01-322H03.g
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(29,955,807 - 29,956,738)	(28,984,765 - 28,985,915)
sequence	gaattctttgtttagctctgtaccccatttttaatagggtcattttttct ctggcatctaactttttgagttctttgtatatactggattttaggtttct atttgatgtaggattgttaaaattttttttcccattctgttggtttccat tttttcttattgacagtgtcctttgccttacagaagctttgcaattttat gaggtcccatttgttaactcttgttgttcaggaaattttcccctgtgccc atgtgcccaagtctcttccccacttacttttctattagtttcaatgtatc tggttttatgaggaggttcttgatccatttggaattgagctttgtacgag aaggcaagaatggatcaatttgcatttttctacaagctaacttctacttg aaacagcaccatctgttgaaaattctgtcttttttctactggattatttt tagctcccttgtcaaagaacacgtgaacatatgtgtgttgactcatttct agttcttcaatcccattccactggtctacatgcctgtctctgtaccaata ccatgcagtttttttttttttttttttttaattacaattgctctgtaata caacttgaggtcagggaatgtggttccaccagaagttcttttattgttga gaatagttttcactatcctaggttttttgttattcccaatgaattttcaa attgttgtttcttttgagataacccccattctagttcttcaggacccgcg tgacgaccaagctgtacatctattacctttaagctgagaggcctagatcc agcctgtgtattttgttagttacttagaagcagaatagttaatatagttt gttgttcaggagctttggctttattcttgcattatttgtttatctctctc atggaactatacacttagcatgttgcacactacacattcaactcccaagt gaattccatcaatgtccaaactcacaagtatcatggagtagtccactgat ctatgtctttctggtgggtgcttttacatggaaagatgacaattccattt tgtatctctatccatccatggtctatccttcaggtaagcaatgcatgagt ggaattggatactcaggcttta	gaattccaaggtctgtactgacacaagaggtcatattgaggtaagtatta agaattggcactggagatccaaagtgtcaaagggaattctgttgatgttc cttatccatgcatatagtcaccaaagtcaaacatataatttattttgatg cctatgattatacgtgtaacaagaagccttgctgatgtcagtggtgcatt ctctggacaacaactgtgcagaagtccattattcctattggtgagggaga tcctggtgatgactatgatctgtgttgctacttgagaatctgaaaaattc caaggtccctactaattaatgctgaaggcatactgaggtaagtgttctta gctggcaatggagatcagattgatgtcacatcctatctttaacaggaaat tcaattgatgttcctgatgcatgcatgtacttcctcctgttgatcatgta gtatataaaatcgccactgcccctagaattagtagtgatgtctactacca atcctgccactggagaagaagtttatgcccataaatttgttttcaccaaa tttatgctgatgtcacatgtatatacctgtcaatagacaccatggtatat attgcccatagtccatacttcttttggcaacattgttgtcagtgatccct gctgccactgggacccatgttaagatcagtaaaccaaagtgtctgaagaa acgtggataaggtttatcatcctttttcaccagtatctttcttttttttt tcatttttttattaagtattttcctcaattacatttccaatgctatccca aaagttctccataccctccccccactcccctactcacccattcccagttt ttggccctggcgttcccctgtactagggaatataaagtttgcatatccaa tggactttctttccagtgatgggccgactaggccatcttttgatacatat gcagctagagtcagagctacagggaactacttagttcataatgtgttgca tctacagagttgcagatctctatagcaccttgaatactttcctctagctt cttcgattggggccctatggatccattcgatagctgactgtcagcattcc actcttgtgttttctaagccgcagtctagtcttcacaagagaacagcttt atca
quality values	Open. Hide. 46 33 18 32 62 62 62 62 62 47 62 62 32 32 47 62 62 62 62 62 62 62 62 62 62 44 59 62 62 62 62 59 56 46 62 59 38 49 54 59 59 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 33 59 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 59 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 54 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 58 49 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 42 52 52 42 54 52 52 34 54 54 52 49 47 41 47 50 58 41 58 51 46 52 53 48 47 47 47 47 51 47 37 39 30 49 50 40 58 44 45 58 37 51 32 58 45 39 45 41 49 31 49 51 50 27 58 54 42 48 50 43 42 50 58 50 32 39 50 51 40 42 50 52 34 58 38 29 52 49 51 58 54 51 40 29 49 47 39 50 40 49 50 52 39 58 50 51 54 51 58 54 41 32 37 36 28 50 50 58 40 39 54 52 53 58 43 31 58 41 50 39 23 49 53 32 49 32 19 28 39 44 54 54 49 37 51 53 51 49 53 31 28 29 39 49 49 46 38 42 44 35 49 54 34 37 41 39 54 51 38 51 44 35 32 29 42 34 25 46 51 39 42 45 34 41 39 35 30 45 40 37 30 51 34 53 45 52 35 32 27 27 47 40 41 30 52 31 31 34 32 31 52 28 29 53 28 34 32 31 47 18 41 18 52 20 33 31 40 22 32 34 35 39 24 32 31 32 27 51 25 43 30 35 36 51 51 30 31 31 16 30 28 32 31 31 31 30 32 30 20 48 42 21 30 37 20 44 35 23 37 19 46 19 31 31 32 28 25 36 30 27 46 31 43 33 22 30 17 42 31 30 23 31 31 17 42 37 48 37 37 35 30 37 48 31 24 10 25 27 30 18 31 21 13 11 29 14 19 41 41 31 21 46 24 31 31 30 29 32 38 38 33 38 29 28 38 44 16 33 31 17 10 16 25 27 12 18 17 26 26 21 31 30 33 37 11 7 13 22 23 31 19 35 30 22 27 21 22 19 31 31 37 19 23 21 29 23 38 25 13 7 16 15 32 21 15 23 31 24 27 27 28 21 15 14 12 30 22 19 24 11 48 23 33 32 32 22 32 17 37 15 31 21 32 15 34 7 29 6 7 11 22 32 15 21 38 10 11 13 20 27 27 20 12 5 21 9 22 13 28 20 34 28 24 19 28 15 8 21 29 7 5 15 8 21 47 30 15 3 6 20 27 9 13 9 15 13 20 28 12 7 19 16 8 27 10 5 5 14 8 16 29 32 10 12 4 11 9 10 5 10 5 8 18 7 5 22 16 10 9 15 6 19 17 12 16 10 24 7 7 6 5 12 11 4 5 4 7 23 16 16 15 7 5 1 12 10 20 7 14 8 5 7 13 8 2 3 11 14 11 4 3 3 5 16 6 11 10 8 4 4 4 17 21 6	Open. Hide. 62 47 51 47 62 62 44 20 62 62 62 38 56 31 38 32 32 28 56 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 59 62 59 62 54 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 37 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 58 58 58 58 46 54 58 58 58 58 58 58 58 54 52 58 58 49 46 49 49 58 58 49 58 58 52 58 58 54 58 54 58 58 58 48 58 58 54 58 54 58 58 58 58 54 58 58 58 58 52 58 54 58 58 58 58 58 58 54 58 58 58 58 58 58 54 58 58 54 54 54 58 58 58 58 54 53 58 58 58 58 58 58 58 58 51 49 58 49 58 52 58 54 51 49 44 58 51 58 47 42 58 52 58 53 53 58 58 58 51 58 54 50 53 53 58 54 58 46 47 58 51 50 58 58 58 58 58 58 58 58 58 50 50 58 50 46 54 54 58 58 58 58 50 48 38 52 54 58 43 46 50 58 58 50 58 58 51 51 51 51 35 47 51 58 58 58 39 33 41 41 50 53 58 58 47 39 54 50 53 39 42 47 41 53 52 58 43 34 39 31 58 51 33 49 54 45 53 52 40 44 51 32 54 54 40 41 33 53 54 54 38 35 31 32 16 28 12 54 32 41 39 45 42 38 42 39 52 54 54 54 30 37 32 37 37 19 37 40 42 37 39 40 54 35 45 45 54 54 54 54 54 54 54 54 42 33 27 40 54 54 54 54 54 37 38 26 37 37 52 32 31 32 32 52 51 30 32 53 42 32 33 32 31 32 31 32 18 31 51 41 27 29 30 34 21 36 29 31 32 31 21 49 38 29 51 51 45 35 42 42 31 30 31 32 22 30 35 29 51 43 31 31 51 46 46 46 32 31 30 35 25 41 37 37 28 30 26 30 31 31 42 46 31 28 42 37 32 46 46 31 33 38 48 42 46 24 26 27 18 46 31 30 28 22 27 26 23 33 29 42 40 25 32 31 22 28 37 30 20 13 46 21 41 31 24 23 25 34 48 31 25 31 48 36 31 33 32 31 26 31 31 28 26 22 15 29 20 10 16 38 48 29 30 23 48 38 22 42 29 33 27 37 27 19 16 36 9 25 28 19 38 23 31 23 14 19 19 19 29 32 24 27 48 48 38 20 32 27 33 32 16 24 30 32 32 29 31 31 32 24 21 26 32 27 24 22 31 11 10 7 17 32 9 7 16 22 48 19 25 21 24 28 22 28 22 30 23 9 20 17 33 24 12 12 20 15 13 28 13 16 16 27 27 20 28 19 7 7 27 20 9 8 5 15 10 11 16 9 13 28 16 13 27 28 24 14 10 19 21 23 9 4 13 9 10 9 18 17 24 20 11 21 29 28 12 8 6 6 10 21 9 9 8 6 27 5 7 13 4 14 16 8 16 3 13 14 3 11 4 3 2 2 4 4 10 17 13 17 20 18 9 5 1 2 12 7 4 19 10 8 13 9 10 21 7 11 14 4 18 20 13 6 25 8 5 6 11 3 4 7 21 5 9 5 28 28 9 7 5 5 5 10 3 4 8 21 21 7 3 10 4 8 6 4 8 7 4 9 4 7 13 23 10 15 4 7 5 4 3 5 4 4 6 4 4 3 3 5

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_29955807_29956738
seq2: B6Ng01-322H03.b_369_1168

seq1  ATCCATTTGGAATTGAGCTTTGTACGAGAAGGCAAGAATGGATCAATTTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCATTTGGAATTGAGCTTTGTACGAGAAGGCAAGAATGGATCAATTTG  50

seq1  CATTTTTCTACAAGCTAACTTCTACTTGAAACAGCACCATCTGTTGAAAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTTTCTACAAGCTAACTTCTACTTGAAACAGCACCATCTGTTGAAAA  100

seq1  TTCTGTCTTTTTTCTACTGGATTATTTTTAGCTCCCTTGTCAAAGAACAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGTCTTTTTTCTACTGGATTATTTTTAGCTCCCTTGTCAAAGAACAC  150

seq1  GTGAACATATGTGTGTTGACTCATTTCTAGTTCTTCAATCCCATTCCACT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAACATATGTGTGTTGACTCATTTCTAGTTCTTCAATCCCATTCCACT  200

seq1  GGTCTACATGCCTGTCCCTGTACCAATACCATGCAG-TTTTTTTTTTTTT  249
      |||||||||||||||| ||||||||||||||||||| |||||||||||||
seq2  GGTCTACATGCCTGTCTCTGTACCAATACCATGCAGTTTTTTTTTTTTTT  250

seq1  TTTTTTTAATTACAATTGCTCTGTAATACAACTTGAGGTCAGGGAATGTG  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTAATTACAATTGCTCTGTAATACAACTTGAGGTCAGGGAATGTG  300

seq1  GTTCCACCAGAAGTTCTTTTATTGTTGAGAATAGTTTTCACTATCCTAGG  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCCACCAGAAGTTCTTTTATTGTTGAGAATAGTTTTCACTATCCTAGG  350

seq1  TTTTTTGTTATTCCCAATGAATTTTCAAATTGTTGTTTCTTTTGAGATAA  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTGTTATTCCCAATGAATTTTCAAATTGTTGTTTCTTTTGAGATAA  400

seq1  CCCCCATTCTAGTTCTTCAGGACCCGCGTGACGACCAAGCTGTACATCTA  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCCATTCTAGTTCTTCAGGACCCGCGTGACGACCAAGCTGTACATCTA  450

seq1  TTACCTTTAAGCTGAGAGGCCTAGATCCAGCCTGTGTATTTTGTTAGTTA  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACCTTTAAGCTGAGAGGCCTAGATCCAGCCTGTGTATTTTGTTAGTTA  500

seq1  CTTAGAAGCAGAATAGTTAATATAGTTTGTTGTTCAGGAGCTTTGGCTTT  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGAAGCAGAATAGTTAATATAGTTTGTTGTTCAGGAGCTTTGGCTTT  550

seq1  ATTCTTGCATTATTTGTTTATCTCTCTCATGGAACTATACACTTAGCATG  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTTGCATTATTTGTTTATCTCTCTCATGGAACTATACACTTAGCATG  600

seq1  -TGCACACTACACATTCAACTCCCAAAGTGAATTCCATCAAATGTCCAAA  648
       ||||||||||||||||||||||| |||||||||||||| ||||||||||
seq2  TTGCACACTACACATTCAACTCCC-AAGTGAATTCCATC-AATGTCCAAA  648

seq1  CTCACAAGTTATCAATGAGTAGTCCACTGATTCCTATGTCTTTCTG--TG  696
      |||||||| |||||  |||||||||||||||  |||||||||||||   |
seq2  CTCACAAG-TATCATGGAGTAGTCCACTGAT--CTATGTCTTTCTGGTGG  695

seq1  GTGCTTTTTAACAATTGGAAAAGATTGACAA-TCCATTTGTAATCTCTAT  745
      ||||||||  |||  ||| ||||| |||||| |||||||   ||||||||
seq2  GTGCTTTT--ACA--TGG-AAAGA-TGACAATTCCATTTTGTATCTCTAT  739

seq1  CAAT-CATGGTCTAATCTCTCA-GTAAGCAAAATGCATGAGTGGTATTTG  793
      | || |||||||| |||  ||| ||||||  ||||||||||||| | |||
seq2  CCATCCATGGTCT-ATCCTTCAGGTAAGC--AATGCATGAGTGG-AATTG  785

seq1  GATACTCAGTCTTTATCCCCTACTATCTTTTTATTTTCTATTTTTATTTT  843
      ||||||||| |||||                                   
seq2  GATACTCAGGCTTTA-----------------------------------  800

seq1  ATACCAACCCCAATTCCCCTTCTAGCTTTTGCACCAGTCACAATGTATTA  893
                                                        
seq2  --------------------------------------------------  800

seq1  TAATGCAATCCTCCTAAGACCAATGATACTCAGGCTTTA  932
                                             
seq2  ---------------------------------------  800

seq1: chrX_28984765_28985915
seq2: B6Ng01-322H03.g_66_1219

seq1  GAATTCCAAGGTCTGTACTGACACAAGAGGTCATATTGAGGTAAGTATTA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAAGGTCTGTACTGACACAAGAGGTCATATTGAGGTAAGTATTA  50

seq1  AGAATTGGCACTGGAGATCCAAAGTGTCAAAGGGAATTCTGTTGATGTTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAATTGGCACTGGAGATCCAAAGTGTCAAAGGGAATTCTGTTGATGTTC  100

seq1  CTTATCCATGCATATAGTCACCAAAGTCAAACATATAATTTATTTTGATG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTATCCATGCATATAGTCACCAAAGTCAAACATATAATTTATTTTGATG  150

seq1  CCTATGATTATACGTGTAACAAGAAGCCTTGCTGATGTCAGTGGTGCATT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTATGATTATACGTGTAACAAGAAGCCTTGCTGATGTCAGTGGTGCATT  200

seq1  CTCTGGACAACAACTGTGCAGAAGTCCATTATTCCTATTGGTGAGGGAGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGGACAACAACTGTGCAGAAGTCCATTATTCCTATTGGTGAGGGAGA  250

seq1  TCCTGGTGATGACTATGATCTGTGTTGCTACTTGAGAATCTGAAAAATTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGGTGATGACTATGATCTGTGTTGCTACTTGAGAATCTGAAAAATTC  300

seq1  CAAGGTCCCTACTAATTAATGCTGAAGGCATACTGAGGTAAGTGTTCTTA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGGTCCCTACTAATTAATGCTGAAGGCATACTGAGGTAAGTGTTCTTA  350

seq1  GCTGGCAATGGAGATCAGATTGATGTCACATCCTATCTTTAACAGGAAAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGGCAATGGAGATCAGATTGATGTCACATCCTATCTTTAACAGGAAAT  400

seq1  TCAATTGATGTTCCTGATGCATGCATGTACTTCCTCCTGTTGATCATGTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAATTGATGTTCCTGATGCATGCATGTACTTCCTCCTGTTGATCATGTA  450

seq1  GTATATAAAATCGCCACTGCCCCTAGAATTAGTAGTGATGTCTACTACCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATATAAAATCGCCACTGCCCCTAGAATTAGTAGTGATGTCTACTACCA  500

seq1  ATCCTGCCACTGGAGAAGAAGTTTATGCCCATAAATTTGTTTTCACCAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCTGCCACTGGAGAAGAAGTTTATGCCCATAAATTTGTTTTCACCAAA  550

seq1  TTTATGCTGATGTCACATGTATATACCTGTCAATAGACACCATGGTATAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATGCTGATGTCACATGTATATACCTGTCAATAGACACCATGGTATAT  600

seq1  ATTGCCCATAGTCCATACTTCTTTTGGCAACATTGTTGTCAGTGATCCCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGCCCATAGTCCATACTTCTTTTGGCAACATTGTTGTCAGTGATCCCT  650

seq1  GCTGCCACTGGGACCCATGTTAAGATCAGTAAAGCAAAGTGTCTGAAGAA  700
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  GCTGCCACTGGGACCCATGTTAAGATCAGTAAACCAAAGTGTCTGAAGAA  700

seq1  ACGTGGATAAGGTTTATCATCCTTTTTCACCAGTATCTTTCTTTTTTTTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGTGGATAAGGTTTATCATCCTTTTTCACCAGTATCTTTCTTTTTTTTT  750

seq1  TCATTTTTTTATTAAGTATTTTCCTCAATTACATTTCCAATGCTATCCCA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTTTTTTATTAAGTATTTTCCTCAATTACATTTCCAATGCTATCCCA  800

seq1  AAAGTTCTCCATACCCTCCCCCCACTCCCCTACTCACCCATTCCCAGTTT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTTCTCCATACCCTCCCCCCACTCCCCTACTCACCCATTCCCAGTTT  850

seq1  TTGGCCCTGGCGTTCCCCTGTACTAGGGAATATAAAGTTTGCATATCCAA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGCCCTGGCGTTCCCCTGTACTAGGGAATATAAAGTTTGCATATCCAA  900

seq1  TGGGACTTTCTTTCCAGTGAT-GGCCGACTAGGCCATCTTTTGATACATA  949
      | ||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  T-GGACTTTCTTTCCAGTGATGGGCCGACTAGGCCATCTTTTGATACATA  949

seq1  TGCAGCTAGAGTCAAGAGCTACAGGGAACTACTTAGTTCATAATGTTGTT  999
      ||||||||||||| ||||||||||||||||||||||||||||||| ||||
seq2  TGCAGCTAGAGTC-AGAGCTACAGGGAACTACTTAGTTCATAATG-TGTT  997

seq1  GCATCTACAGAGTTGCAGATCTCTATAGCACCTTGAATACTTT-CTCTAG  1048
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  GCATCTACAGAGTTGCAGATCTCTATAGCACCTTGAATACTTTCCTCTAG  1047

seq1  CTCCTCCATTGGGGGCCCTGT-GATCCATCCAATAGCTGACTGTCAGCA-  1096
      || || |  | |||||||| | ||||||| | ||||||||||||||||| 
seq2  CTTCTTCGATTGGGGCCCTATGGATCCATTCGATAGCTGACTGTCAGCAT  1097

seq1  TCCACTTCTGTGTTTTCTAGGCCGCAGCCTAGTC-TCACAAGAG-ACAGC  1144
      ||||||  ||||||||||| ||||||| |||||| ||||||||| |||||
seq2  TCCACTCTTGTGTTTTCTAAGCCGCAGTCTAGTCTTCACAAGAGAACAGC  1147

seq1  TATATCA  1151
      | |||||
seq2  TTTATCA  1154

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information