MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-322I11
Chromosome	X (Build37)
Map Location	105,583,980 - 105,585,181
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Itm2a, 4933401B06Rik, Tbx22, 2610002M06Rik, Gm732
Downstream gene	Gm378, LOC668516, Gm379, Brwd3, 5730416F02Rik, Nsbp1, Sh3bgrl, EG622976, LOC100042831, LOC213474
Link	Open Mouse BAC browser

Click to get alignment info.

name	Itm2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16431 MGI:107706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933401B06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71011 MGI:1918261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Tbx22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245572 MGI:2389465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2610002M06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67028 MGI:1914278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm732 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213450 MGI:2685578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm378 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213454 MGI:2685224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC668516 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668516
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Gm379 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236954 MGI:2685225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Brwd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382236 MGI:3029414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730416F02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70550 MGI:1917800
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Nsbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50887 MGI:1355295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh3bgrl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56726 MGI:1930849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622976 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622976 MGI:3647255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042831 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	LOC213474 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:213474
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 19 ESTs, 4 Proteins pseudo : _no_value

name	Itm2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51556453 GeneID:16431 MGI:107706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integral membrane protein 2A transcript_id : NM_008409.2

name	4933401B06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271860 GeneID:71011 MGI:1918261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 4933401B06 gene transcript_id : XM_001479708.1

name	Tbx22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21644588 GeneID:245572 MGI:2389465
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-box 22 transcript_id : NM_145224.1

name	Tbx22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375618 GeneID:245572 MGI:2389465
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-box 22 transcript_id : NM_181319.3

name	2610002M06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381786 GeneID:67028 MGI:1914278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610002M06 gene transcript_id : NM_025921.2

name	Gm732 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359829 GeneID:213450 MGI:2685578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 732, (NCBI) transcript_id : NM_001033252.2

name	Gm378 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38086586 GeneID:213454 MGI:2685224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : gene model 378, (NCBI) transcript_id : XM_142049.3

name	Gm379 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83003240 GeneID:236954 MGI:2685225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : gene model 379, (NCBI) transcript_id : XM_142052.4

name	Brwd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490357 GeneID:382236 MGI:3029414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain and WD repeat domain containing 3 transcript_id : NM_001081477.1

name	Nsbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778914 GeneID:50887 MGI:1355295
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleosome binding protein 1 transcript_id : NM_016710.2

name	Sh3bgrl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543698 GeneID:56726 MGI:1930849
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3-binding domain glutamic acid-rich protein like transcript_id : NM_019989.2

name	EG622976 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702299 GeneID:622976 MGI:3647255
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG622976 transcript_id : NM_001037917.1

name	LOC100042831 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271826 GeneID:100042831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : similar to DnaJ (Hsp40) homolog, subfamily C, member 5 beta transcript_id : XM_001478909.1

name	Itm2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51556454 CCDS:CCDS30349.1 GeneID:16431 MGI:107706
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : integral membrane protein 2A protein_id : NP_032435.2

name	4933401B06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271861 GeneID:71011 MGI:1918261
definition	codon_start : 1 product : hypothetical protein LOC71011 protein_id : XP_001479758.1

name	Tbx22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644589 CCDS:CCDS30350.1 GeneID:245572 MGI:2389465
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; T-box transcripttion factor protein 22 product : T-box 22 isoform 1 protein_id : NP_660259.1

name	Tbx22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044451 CCDS:CCDS30351.1 GeneID:245572 MGI:2389465
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; T-box transcripttion factor protein 22 product : T-box 22 isoform 2 protein_id : NP_851836.1

name	2610002M06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229022 GeneID:67028 MGI:1914278
definition	GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67028 protein_id : NP_080197.2

name	Gm732 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701758 CCDS:CCDS30352.1 GeneID:213450 MGI:2685578
definition	codon_start : 1 product : hypothetical protein LOC213450 protein_id : NP_001028424.1

name	Gm378 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086587 GeneID:213454 MGI:2685224
definition	codon_start : 1 product : similar to BMI1-like protein protein_id : XP_142049.3

name	Gm379 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20985090 GeneID:236954 MGI:2685225
definition	codon_start : 1 product : similar to syntaxin 3A protein_id : XP_142052.1

name	Brwd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125490358 GeneID:382236 MGI:3029414
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : bromo domain-containing protein disrupted in leukemia product : bromodomain and WD repeat domain containing 3 protein_id : NP_001074946.1

name	Nsbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778915 GeneID:50887 MGI:1355295
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005654 - nucleoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006356 - regulation of transcription from RNA polymerase I promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : nucleosome binding protein 45; snoRNA MBII-8 product : nucleosome binding protein 1 protein_id : NP_057919.2

name	Sh3bgrl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910548 GeneID:56726 MGI:1930849
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : SH3-binding domain glutamic acid-rich protein like protein_id : NP_064373.1

name	EG622976 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702300 CCDS:CCDS30354.1 GeneID:622976 MGI:3647255
definition	codon_start : 1 product : hypothetical protein LOC622976 protein_id : NP_001033006.1

name	LOC100042831 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271827 GeneID:100042831
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478959.1

name	LOC668516 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668516
definition	number : 1 pseudo : _no_value

name	LOC668516 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668516
definition	number : 2 pseudo : _no_value

name	LOC668516 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668516
definition	number : 3 pseudo : _no_value

name	LOC668516 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668516
definition	number : 4 pseudo : _no_value

name	5730416F02Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271862 GeneID:70550 MGI:1917800
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730416F02 gene transcript_id : XR_001637.2

name	LOC213474 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271828 GeneID:213474
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 19 ESTs, 4 Proteins product : similar to eukaryotic translation initiation factor 4B pseudo : _no_value transcript_id : XR_033986.1

clone name	MSMg01-411E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140K11
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-322I11.b	B6Ng01-322I11.g
ACC	GA111348	GA111349
length	1,167	1,169
definition	B6Ng01-322I11.b	B6Ng01-322I11.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcacctgacgaataccgaatggcagagaagcacctgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctgagat tccacctcacaccagtcagaatggctaagatcaaacattcaggtgacagc agatgctggcgtggatgtggagaaagaggaacactcctccattgttggtg ggattgcagggttgtacaaccactctggaaatcagtctggcggttcctca gaaaattggacatagtacccccggaggatccagcaatacctctcctgggc atatatccagaagatgccccaactggtaagaaggacacatgctccactat gttcatagcagccttatttataatagccagaagttggaaagaacccagat gcccctcaacacaggaatggatacagaaaatgtggtacatctacacaatg gagtactactcagctattaaaaagaatgaatttatgaaattcctagccaa atggatggacctggagggcatcatcctgagtgaggtaacacattcacaaa ggaactcacacaatatgtactcactggtaagtagatattagccccaaacc taggatacccaagatataagatacaatttgctaaacacatgaaactcaag aagaatgaagactgaagtgtagacactatgcccctccttagaattgggaa caaaacacccatggaaagagttacagagacaaagtttggagctgagatga aaggatggaccatgtagagactgccatatccagggatccaccccatattc agcatccaaacgctgataccattgcatacactagcaagattttaccgaaa ggacccagatgtagctgtctcttgtgagactatgccggggcctagcaaac acagaagtggatgctcacagtcagctaatggatggatcacagggcttcca atggaggagctagagaaagtacccaaggagctaaagggatctgcacctat agtggaacacattatgaactaaccagtacccggagctcttgactctagct gcatattgttatcaaagatgctagtccgcatcaactggaaaggagagttc atgacatcgcaacttttaatgcccaagttcacggatggtccaggccaaaa gggtaattggttgtcgt	gaattcatcagggttgggtctaggtgatattgtggtgtatccaccagaga aaacttctcagacctgggtataagccagtagaaagttttcattagctggc cggcgactatactgggtctttgacatcccagagtagcactgagcctttct cagggtgaatcagcacaaaaacatgccctgatttgaaatacttcagttca caagaacagttattgagaagcagaactacagaagtcaaaaagcaaagtta gtatgattagagacttttcagaactatagacattgatggattaggtctct gttttggttttggcaggtagtgctatctacttgctaagttttatagcttg aataatactcccaccatggagtcagttgtactaaggtctggggacctgtt aagttctgagaccctgtttcaggagggaggaacacaatttgtcgtctggg ctttctggagaaagcaaggtctgacaagatggagaatgaggcaggtcagc tgtttaggtcctgggctcacctcatctagtgctcagttaattgatctact tcatcaactcttaagcacatctggactactcctggcttactgtttcccac ataaacaggcacacagattagtgcccctttggaaccattgacaatctccc acatctacactccgggatgctctagggagccagaaacagctctgataagg aaaagccaggaaacctctgtgaagaaagtggtcccatgactgacaagatt tctttgtaagccatttgaagtactcaagtgtcctggccggcagggcctgg acttacaacaccacctctgcagtcacattgaagtcagccatcagcagact gaaggaactgaaagaccttgccatctgagacttgcctagcctgcaattaa tgggctatttaagttataaaaaaaaaaggagaaagaagaagaagaaagaa agaaagaagaagaagaagaagacgaaagaaagagaagaaagaaagaaagg agaacaaaaacaaaaacaaaaaaaattcctaggactcacacaaaagtctc actgctagaagctacccaaagctgaaaggtctgcaacctatagttgcaca acaatattgaacctatcattccgagctcatgtctctcagctgcattgtag caagagagatggccctagt
quality values	Open. Hide. 58 31 32 41 62 62 62 41 30 54 62 62 62 47 56 62 62 62 62 56 54 62 62 62 62 62 62 62 62 62 62 59 36 59 34 28 56 43 29 38 46 59 59 62 62 62 62 62 59 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 47 62 62 46 54 46 62 62 62 62 47 38 46 62 62 54 54 62 62 62 62 62 58 58 58 52 58 58 58 47 58 52 58 58 58 54 58 58 58 58 54 54 54 42 58 54 54 58 58 58 47 58 58 54 54 58 58 54 58 58 58 58 58 58 58 58 58 58 52 58 58 58 58 54 54 58 52 58 54 58 58 52 52 54 54 58 54 58 58 58 54 35 49 54 48 58 58 54 41 58 42 36 51 49 51 53 40 58 49 46 49 40 47 52 58 53 58 34 52 50 52 52 46 58 58 58 51 34 34 58 51 50 50 51 50 54 58 58 58 58 52 53 53 49 51 49 58 58 40 58 50 41 53 52 58 32 51 39 58 51 58 58 46 51 58 37 53 53 58 50 50 54 41 52 51 58 48 14 17 41 49 46 54 50 44 36 39 58 28 23 58 51 58 37 58 40 40 35 58 58 40 50 41 50 44 50 50 50 43 58 49 58 41 52 54 29 51 32 24 40 50 51 51 32 41 40 39 54 51 40 45 54 51 54 35 51 32 47 52 45 54 22 39 39 42 50 54 46 34 50 35 28 51 42 41 37 41 37 41 51 42 53 34 53 32 30 27 36 47 46 44 29 53 42 42 36 41 37 33 54 49 17 32 24 28 25 46 54 54 47 31 52 40 45 32 45 40 31 34 30 34 41 35 31 47 47 45 34 45 34 32 31 23 31 27 21 29 53 40 32 31 29 45 29 31 26 42 37 31 31 45 32 33 31 33 20 51 51 42 18 14 29 31 45 47 21 18 43 30 21 33 32 21 26 37 31 43 31 31 23 34 38 32 30 31 34 33 31 33 43 28 31 42 18 31 19 31 24 33 27 23 33 27 46 46 33 18 27 38 38 24 30 31 39 35 27 16 31 31 33 44 41 24 32 32 27 27 25 38 26 31 32 19 30 24 31 28 32 27 27 32 31 21 21 27 24 25 9 12 30 22 18 26 22 24 27 13 24 43 26 25 25 30 15 34 13 17 24 27 21 28 22 8 26 14 29 32 22 23 23 11 24 43 22 12 21 27 33 39 28 12 19 18 14 29 18 32 22 17 39 10 24 43 15 20 21 31 21 27 14 29 10 7 18 14 18 13 30 7 11 21 15 10 4 12 14 20 33 20 16 20 16 19 25 27 27 15 23 13 18 11 9 8 10 31 28 21 8 5 21 10 27 26 16 10 27 27 20 20 24 13 16 24 13 17 27 27 27 16 21 16 9 7 12 7 11 7 8 5 11 29 20 7 15 4 3 3 3 8 5 10 9 3 3 3 3 10 6 4 4 7 14 8 5 3 8 14 6 5 3 2 3 3 1 1 3 3 3 3 6 5 7 4 5 5 4 12 8 14 16 26 16 21 6 5 21 5 15 6 16 5 10 10 10 7 4 4 5 2 1 3 5 9 12 5 7 19 4 8 13 14 8 13 17 17 7 16 13 5 1 3 5 7 3 6 17 6 5 9 1 3 4 8	Open. Hide. 62 47 50 59 62 59 44 62 59 59 59 59 43 32 34 33 43 33 48 59 62 59 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 56 54 59 59 62 62 62 59 62 62 59 54 59 46 28 42 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 59 62 62 59 62 62 62 62 62 54 49 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 59 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 56 48 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 54 62 62 62 43 37 37 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 50 58 58 58 58 54 58 58 58 54 54 58 58 58 58 58 54 54 58 58 52 54 54 58 58 44 58 58 58 52 58 58 49 58 54 58 58 54 58 58 58 54 58 58 58 58 58 54 54 54 54 58 58 58 58 58 45 54 58 54 58 58 54 58 58 58 58 58 58 58 50 54 58 58 53 58 58 52 58 50 52 52 51 58 50 58 45 58 49 58 58 47 50 51 52 58 58 54 46 47 54 49 52 51 58 42 43 44 47 58 54 53 49 54 58 52 35 48 34 51 58 54 51 46 39 58 49 58 58 52 58 51 40 51 50 58 51 51 39 51 30 58 58 52 51 51 58 58 29 39 54 52 58 50 52 42 35 58 51 49 35 50 58 37 50 51 49 40 50 36 39 38 41 39 51 43 40 24 32 47 32 53 32 58 58 50 39 33 50 35 49 50 51 44 36 34 50 53 52 51 51 50 40 52 45 36 51 54 33 37 37 54 32 34 25 54 33 29 42 53 37 26 42 51 31 24 37 51 37 17 14 54 29 37 49 49 28 39 37 35 32 34 53 38 28 33 54 49 40 45 44 33 42 40 39 42 32 21 44 40 32 40 29 23 53 32 46 29 32 45 32 53 25 26 32 51 32 31 40 31 35 26 28 19 23 21 18 35 20 30 32 31 33 31 20 41 31 43 36 31 37 35 29 31 29 33 24 31 21 31 51 31 32 38 24 30 28 25 36 41 25 23 43 34 31 22 31 29 16 30 17 30 32 31 42 20 42 22 18 23 31 30 31 48 30 28 31 18 32 31 31 32 26 17 21 36 29 30 31 43 8 31 30 43 29 31 30 33 31 31 24 24 31 35 38 19 17 20 33 39 11 21 28 39 47 31 30 36 23 31 48 31 19 25 21 31 31 10 44 33 48 46 48 44 44 48 48 48 33 20 33 11 38 33 41 15 29 15 18 25 15 7 17 5 5 6 10 38 11 22 18 31 7 11 14 22 10 20 24 14 16 6 5 9 4 5 9 4 9 12 6 6 9 4 4 4 6 27 10 25 15 31 10 13 4 4 9 20 12 12 24 10 24 18 24 9 12 14 24 9 18 25 26 9 12 4 11 18 27 29 30 11 13 18 40 30 34 24 16 21 47 27 30 28 34 27 15 21 15 6 11 10 10 15 7 15 21 27 17 6 3 4 10 7 40 30 21 24 14 11 14 6 3 5 21 7 11 3 3 1 4 4 4 14 22 8 4 25 8 17 30 23 12 21 8 11 10 23 6 24 19 4 9 20 21 21 7 8 7 13 4 5 6 11 23 4 5 3 1 2 4 7 8 13 5 6 12 5 10 10 6 8 14 5 10 8 16 10 6 2 1 1 3 5 1 2 4 1 3 4 5 5 7 15 6 9 9 10 7 6 6 8 16 8 12 6 6 7 10 23 10 4 14 16 6 1 5 3 11 4 9 9 7 7 7 30 15 10 5 4 1

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_105583980_105585181
seq2: B6Ng01-322I11.g_67_1235

seq1  GAATTCATCAGGGTTGGGTCTAGGTGATATTGTGGTGTATCCACCAGAGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATCAGGGTTGGGTCTAGGTGATATTGTGGTGTATCCACCAGAGA  50

seq1  AAACTTCTCAGACCTGGGTATAAGCCAGTAGAAAGTTTTCATTAGCTGGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTTCTCAGACCTGGGTATAAGCCAGTAGAAAGTTTTCATTAGCTGGC  100

seq1  CGGCGACTATACTGGGTCTTTGACATCCCAGAGTAGCACTGAGCCTTTCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGCGACTATACTGGGTCTTTGACATCCCAGAGTAGCACTGAGCCTTTCT  150

seq1  CAGGGTGAATCAGCACAAAAACATGCCCTGATTTGAAATACTTCAGTTCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGTGAATCAGCACAAAAACATGCCCTGATTTGAAATACTTCAGTTCA  200

seq1  CAAGAACAGTTATTGAGAAGCAGAACTACAGAAGTCAAAAAGCAAAGTTA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGAACAGTTATTGAGAAGCAGAACTACAGAAGTCAAAAAGCAAAGTTA  250

seq1  GTATGATTAGAGACTTTTCAGAACTATAGACATTGATGGATTAGGTCTCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATGATTAGAGACTTTTCAGAACTATAGACATTGATGGATTAGGTCTCT  300

seq1  GTTTTGGTTTTGGCAGGTAGTGCTATCTACTTGCTAAGTTTTATAGCTTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTGGTTTTGGCAGGTAGTGCTATCTACTTGCTAAGTTTTATAGCTTG  350

seq1  AATAATACTCCCACCATGGAGTCAGTTGTACTAAGGTCTGGGGACCTGTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAATACTCCCACCATGGAGTCAGTTGTACTAAGGTCTGGGGACCTGTT  400

seq1  AAGTTCTGAGACCCTGTTTCAGGAGGGAGGAACACAATTTGTCGTCTGGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTTCTGAGACCCTGTTTCAGGAGGGAGGAACACAATTTGTCGTCTGGG  450

seq1  CTTTCTGGAGAAAGCAAGGTCTGACAAGATGGAGAATGAGGCAGGTCAGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCTGGAGAAAGCAAGGTCTGACAAGATGGAGAATGAGGCAGGTCAGC  500

seq1  TGTTTAGGTCCTGGGCTCACCTCATCTAGTGCTCAGTTAATTGATCTACT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTAGGTCCTGGGCTCACCTCATCTAGTGCTCAGTTAATTGATCTACT  550

seq1  TCATCAACTCTTAAGCACATCTGGACTACTCCTGGCTTACTGTTTCCCAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATCAACTCTTAAGCACATCTGGACTACTCCTGGCTTACTGTTTCCCAC  600

seq1  ATAAACAGGCACACAGATTAGTGCCCCTTTGGAACCATTGACAATCTCCC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAACAGGCACACAGATTAGTGCCCCTTTGGAACCATTGACAATCTCCC  650

seq1  ACATCTACACTCCGGGATGCTCTAGGGAGCCAGAAACAGCTCTGATAAGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCTACACTCCGGGATGCTCTAGGGAGCCAGAAACAGCTCTGATAAGG  700

seq1  AAAAGCCAGGAAACCTCTGTGAAGAAAGTGGTCCCATGACTGACAAGATT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGCCAGGAAACCTCTGTGAAGAAAGTGGTCCCATGACTGACAAGATT  750

seq1  TCTTTGTAAGCCATTTGAAGTACTCAAGTGTCCTGGCCGGCAGGGCCTGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTGTAAGCCATTTGAAGTACTCAAGTGTCCTGGCCGGCAGGGCCTGG  800

seq1  ACTTACAACACCACCTCTGCAGTCACATTGAAGTCAGCCATCAGCAGACT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTACAACACCACCTCTGCAGTCACATTGAAGTCAGCCATCAGCAGACT  850

seq1  GAAGGAACTGAAAGACCTTGCCATCTGAGACTTGCCTAGCCTGCAATTAA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGAACTGAAAGACCTTGCCATCTGAGACTTGCCTAGCCTGCAATTAA  900

seq1  TGGGCTATTTAAGTTATAAAAAAAAAAGGAGAAAGAAAGAAAGAAAGAAA  950
      ||||||||||||||||||||||||||||||||||| |||||   ||||||
seq2  TGGGCTATTTAAGTTATAAAAAAAAAAGGAGAAAG-AAGAA--GAAGAAA  947

seq1  GAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAGGAAAGAAAGAAGGAAAGA  1000
      |||||||||||   |||||   |||||   | ||||||||||    ||||
seq2  GAAAGAAAGAA--GAAGAA--GAAGAA--GACGAAAGAAAGA---GAAGA  988

seq1  AAGAAAGAAAGGAAGAAAACAAAAAACAAAAAACAAAAAAAAATTCCTAG  1050
      |||||||||||| ||||    |||||||||||   |||||||||||||||
seq2  AAGAAAGAAAGG-AGAA---CAAAAACAAAAA--CAAAAAAAATTCCTAG  1032

seq1  GACCTCCAACCACAAAAGTCTCCAACTGCCTTAAGAGCTTAACCCAAAAG  1100
      || |||    ||||||||||||  |||||  ||  ||||  |||| ||||
seq2  GA-CTC---ACACAAAAGTCTC--ACTGC--TAGAAGCT--ACCC-AAAG  1071

seq1  CTGAAGGGGTCTGCAACCCTATAGGTGGAACAACAATA-TGAACTAATCA  1149
      |||||  ||||||||| |||||| || | ||||||||| |||||  ||||
seq2  CTGAA-AGGTCTGCAA-CCTATA-GTTGCACAACAATATTGAACCTATCA  1118

seq1  GTACCCCCAGAGCTCATGTCTCT-AGCTGCATATGTAGC-AGA-AGATGG  1196
       |     | |||||||||||||| |||||||| |||||| ||| ||||||
seq2  TT-----CCGAGCTCATGTCTCTCAGCTGCAT-TGTAGCAAGAGAGATGG  1162

seq1  -CCTAGT  1202
       ||||||
seq2  CCCTAGT  1169

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information