MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-324D22
Chromosome	X (Build37)
Map Location	27,802,239 - 27,933,020
singlet/doublet	doublet
Overlap gene	LOC664917, LOC100039324
Upstream gene	LOC100042175, LOC100039194, LOC100039208, EG664877, LOC664881, LOC100039240, LOC100039248, LOC100039073, EG664890, LOC664898, LOC22526, EG664906
Downstream gene	LOC100039334, LOC100039096, EG664923, LOC100039364, LOC100039377, LOC100039386, LOC100039127, EG664944, LOC100039423, LOC100039145, LOC664951, LOC100042071, LOC664958, LOC664964
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042175 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042175
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 15 ESTs, 5 Proteins

name	LOC100039194 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 5 Proteins pseudo : _no_value

name	LOC100039208 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 65 ESTs

name	EG664877 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664877 MGI:3643741
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC664881 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664881
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 63 ESTs

name	LOC100039240 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 16 ESTs, 5 Proteins

name	LOC100039248 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 64 ESTs

name	LOC100039073 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039073
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	EG664890 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664890 MGI:3648359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC664898 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664898
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs

name	LOC22526 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:22526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG664906 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664906 MGI:3647496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC664917 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664917
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs

name	LOC100039324 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 16 ESTs, 5 Proteins

name	LOC100039334 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 65 ESTs

name	LOC100039096 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG664923 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664923 MGI:3647245
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC100039364 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 58 ESTs

name	LOC100039377 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 16 ESTs, 5 Proteins

name	LOC100039386 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 65 ESTs

name	LOC100039127 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	EG664944 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664944 MGI:3647748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC100039423 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	LOC100039145 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins

name	LOC664951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 1 Protein pseudo : _no_value

name	LOC100042071 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 93 ESTs, 1 Protein

name	LOC664958 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins pseudo : _no_value

name	LOC664964 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 58 ESTs

name	LOC100042175 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271341 GeneID:100042175
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 15 ESTs, 5 Proteins product : similar to XMR, transcript variant 2 transcript_id : XM_001477530.1

name	LOC100042175 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271339 GeneID:100042175
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 5 Proteins product : similar to XMR, transcript variant 1 transcript_id : XM_001477510.1

name	LOC100039208 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271348 GeneID:100039208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 64 ESTs product : hypothetical protein LOC100039208, transcript variant 1 transcript_id : XM_001472587.1

name	LOC100039208 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271346 GeneID:100039208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 64 ESTs product : hypothetical protein LOC100039208, transcript variant 2 transcript_id : XM_001472606.1

name	LOC664881 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271351 GeneID:664881
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 63 ESTs product : hypothetical protein LOC664881 transcript_id : XM_973240.2

name	LOC100039240 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271354 GeneID:100039240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : Xlr-related, meiosis regulated-like, transcript variant 2 transcript_id : XM_001472679.1

name	LOC100039240 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271352 GeneID:100039240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : Xlr-related, meiosis regulated-like, transcript variant 1 transcript_id : XM_001472663.1

name	LOC100039248 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271356 GeneID:100039248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 64 ESTs product : hypothetical protein LOC100039248 transcript_id : XM_001472703.1

name	LOC100039073 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271343 GeneID:100039073
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : similar to pol protein transcript_id : XM_001472204.1

name	LOC664898 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271359 GeneID:664898
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs product : hypothetical protein LOC664898 transcript_id : XM_973320.2

name	LOC22526 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:50355988 GeneID:22526
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sycp3 like X-linked-like transcript_id : NM_009529.2

name	LOC664917 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271365 GeneID:664917
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs product : hypothetical LOC664917 transcript_id : XM_973402.2

name	LOC100039324 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271368 GeneID:100039324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : similar to XMR, transcript variant 2 transcript_id : XM_001472858.1

name	LOC100039324 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271366 GeneID:100039324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : similar to XMR, transcript variant 1 transcript_id : XM_001472834.1

name	LOC100039334 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271372 GeneID:100039334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 64 ESTs product : hypothetical protein LOC100039334, transcript variant 1 transcript_id : XM_001472878.1

name	LOC100039334 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271370 GeneID:100039334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 64 ESTs product : hypothetical protein LOC100039334, transcript variant 2 transcript_id : XM_001472894.1

name	LOC100039096 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271360 GeneID:100039096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to pol protein transcript_id : XM_001472254.1

name	LOC100039364 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271375 GeneID:100039364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 58 ESTs product : hypothetical protein LOC100039364 transcript_id : XM_001472934.1

name	LOC100039377 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271379 GeneID:100039377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : similar to XMR, transcript variant 2 transcript_id : XM_001472983.1

name	LOC100039377 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271377 GeneID:100039377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : similar to XMR, transcript variant 1 transcript_id : XM_001472953.1

name	LOC100039386 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271383 GeneID:100039386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 64 ESTs product : hypothetical protein LOC100039386, transcript variant 1 transcript_id : XM_001473010.1

name	LOC100039386 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271381 GeneID:100039386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 64 ESTs product : hypothetical protein LOC100039386, transcript variant 2 transcript_id : XM_001473034.1

name	LOC100039127 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271362 GeneID:100039127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : similar to pol protein transcript_id : XM_001472318.1

name	LOC100039423 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271386 GeneID:100039423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100039423 transcript_id : XM_001473070.1

name	LOC100039145 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271388 GeneID:100039145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins product : similar to Xlr-related, meiosis regulated transcript_id : XM_001472346.1

name	LOC100042071 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271393 GeneID:100042071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 93 ESTs, 1 Protein product : similar to RIKEN cDNA 1810037I17 gene transcript_id : XM_001477220.1

name	LOC664964 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271395 GeneID:664964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 58 ESTs product : hypothetical LOC664964 transcript_id : XM_973681.2

name	LOC100042175 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271340 GeneID:100042175
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001477560.1

name	LOC100042175 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271342 GeneID:100042175
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001477580.1

name	LOC100039208 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271347 GeneID:100039208
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001472656.1

name	LOC100039208 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271349 GeneID:100039208
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001472637.1

name	LOC664881 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407238 GeneID:664881
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978334.1

name	LOC100039240 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271353 GeneID:100039240
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001472713.1

name	LOC100039240 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271355 GeneID:100039240
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001472729.1

name	LOC100039248 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271357 GeneID:100039248
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472753.1

name	LOC100039073 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271344 GeneID:100039073
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472254.1

name	LOC664898 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407241 GeneID:664898
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978414.1

name	LOC22526 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:6678607 CCDS:CCDS30055.1 GeneID:22526
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : Xlr-related, meiosis regulated protein_id : NP_033555.1

name	LOC664917 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407245 GeneID:664917
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978496.1

name	LOC100039324 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271367 GeneID:100039324
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001472884.1

name	LOC100039324 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271369 GeneID:100039324
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001472908.1

name	LOC100039334 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271371 GeneID:100039334
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001472944.1

name	LOC100039334 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271373 GeneID:100039334
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001472928.1

name	LOC100039096 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271361 GeneID:100039096
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472304.1

name	LOC100039364 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271376 GeneID:100039364
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472984.1

name	LOC100039377 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271378 GeneID:100039377
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001473003.1

name	LOC100039377 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271380 GeneID:100039377
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001473033.1

name	LOC100039386 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271382 GeneID:100039386
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001473084.1

name	LOC100039386 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271384 GeneID:100039386
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001473060.1

name	LOC100039127 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271363 GeneID:100039127
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472368.1

name	LOC100039423 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271387 GeneID:100039423
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473120.1

name	LOC100039145 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271389 GeneID:100039145
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472396.1

name	LOC100042071 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271394 GeneID:100042071
definition	codon_start : 1 product : similar to RIKEN cDNA 1810037I17 gene protein_id : XP_001477270.1

name	LOC664964 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407253 GeneID:664964
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978775.1

name	LOC664958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664958
definition	number : 9 pseudo : _no_value

name	LOC664958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664958
definition	number : 8 pseudo : _no_value

name	LOC664958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664958
definition	number : 7 pseudo : _no_value

name	LOC664958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664958
definition	number : 6 pseudo : _no_value

name	LOC664958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664958
definition	number : 5 pseudo : _no_value

name	LOC664958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664958
definition	number : 4 pseudo : _no_value

name	LOC664958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664958
definition	number : 3 pseudo : _no_value

name	LOC664958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664958
definition	number : 2 pseudo : _no_value

name	LOC664958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664958
definition	number : 1 pseudo : _no_value

name	LOC100039194 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271345 GeneID:100039194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 5 Proteins product : similar to XMR pseudo : _no_value transcript_id : XR_030764.1

name	EG664877 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271350 GeneID:664877 MGI:3643741
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : predicted gene, EG664877 pseudo : _no_value transcript_id : XR_035651.1

name	EG664890 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271358 GeneID:664890 MGI:3648359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : predicted gene, EG664890 pseudo : _no_value transcript_id : XR_035653.1

name	EG664906 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271364 GeneID:664906 MGI:3647496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : predicted gene, EG664906 pseudo : _no_value transcript_id : XR_035654.1

name	EG664923 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271374 GeneID:664923 MGI:3647245
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : predicted gene, EG664923 pseudo : _no_value transcript_id : XR_035656.1

name	EG664944 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271385 GeneID:664944 MGI:3647748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : predicted gene, EG664944 pseudo : _no_value transcript_id : XR_035657.1

name	LOC664951 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271392 GeneID:664951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 1 Protein product : hypothetical LOC664951 pseudo : _no_value transcript_id : XR_033120.1

clone name	MSMg01-195O18
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-270N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107A21
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-324D22.b	B6Ng01-324D22.g
ACC	GA112610	GA112611
length	1,005	1,205
definition	B6Ng01-324D22.b	B6Ng01-324D22.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(27,802,239 - 27,802,771)	(27,931,830 - 27,933,020)
sequence	gaattccaaatgtttgcgcactcatgacaagcttggcagctgtacagcag gtactttattgttaatgacgtagtcataagccaggtatctcggccctgag aacaaaaaattattaatctgagtcaagctctcagataggaaaatggaaac accattaccatatagatggactttgctatgatttttactactctgtccac tgcatgtatgtatgaacgataaaggcggcatcttaccactacaagacagg atattaaaaacaaagagaatttattgaactttctagaagctatttgactt ttcctatgaactgtggtcctccactgccaggttgctgacctggctcccca acaaacacccctaacatctatttatattatattctgatgacataacccaa cctggtgccgcctgagactccattgtaaagaaaaaatatacagctcacat ccacaggttgatggaggacatcagaggcaaagatcattctcacacaaaca actggcaagattgttggtaattgatcttcaccaggcatctggggtccatg caactttctgagttactcagattaaagtacatttcacttaaactggacat cctggttcaagattatgccaggtttgtattcaaattaatctaaaacaggg agcccttacctaggaagggttcgaaatatgaaataaacacctcagcaact ttagggaaactgacttcagcaagcttcagcctgccaggggatggaaaact ttacttgctaggtttgcaggtacctttttgttgaggccggccaacagctc acatgtatgggttcagcaatgcctctacaagaattatgccaattgtcaca acaaaatttgtgactcttaggctatattgggagctagaggtcatcctcct catctttattgtctctatggcctgatgaatcagaccaaaagccataatat gtactggaatgcttttagaatgaaaattagtagctgccatctgcacactc ttggg	gaattcagcagtttctccagaagcagtacagatcatagtcatcaccatta tctccatcagaaatattaaaaatagactctatcttgttactggtgacagc atccagctggtatgaccatgactgaaacctcttatctagtgacagaatga aaatggacataaaaatgtttataaatggcagaacacttatcatgaatgtg gcagaattatacataattgacatcagtaattattctaatgcagtacaaga ctgtcatattaatgtggtcccataatgcagcagggatcactgacatgatt gctgctaaaggcctaaagtatcatggccatacattgtctgttgccagtat atatgtgacctcaacaaaacatatatcagaacatttaactcaacatgacc tgagggaacagtactgactgtgaagttcactgtaaattctgatggtttct gggatccttgacattaacaatatcttcagaagcaacatgaaatgtgggtt tcaatatggctactgatggcagcatggataattgtgattgtcataatttc tggagacactttggagagtcaggttataatgagaaagattaatgtagaag gaatagggaagaaggtaagataaactaaggatatctgcaaaagtcataat aaatctcactactaacttcataaaaacctatacctcacataagctataag tgaatgagcatgtacagtttaattagaactttacagtttcaatttactta ttaaaccaatgtatgcaattgtttatgtatcttttatttcaaattatata acatttttctatttatatatatttttgctcaaataataaaattaggttca tattactgctaaatattacccaaatatgcatgatgggtttttatgtgggg gatttattgatactgtatacatatagctaaaaatataacaataggttctc cctatgtcctatcacaccctgagctatttgctttttggtcaattttggca ttaatggagcacggttcctctctggtgtagtggagcctttgaaatctaat agaagctcattttctattggacttaaaggtcaacttatttcttattctag gtcaagggggggttccggatccactcctggttttatcaatctcaattcct ccattcgtgtaaggagtaaatgtctccttcatatgtaaatccgtgtgttc tttct
quality values	Open. Hide. 49 31 27 34 62 62 31 12 62 62 62 62 62 62 62 54 49 47 62 56 47 62 47 44 62 62 59 62 59 59 45 43 28 28 28 28 28 28 28 32 38 54 59 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 59 51 59 48 48 34 49 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 51 62 62 62 62 62 54 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 54 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 52 58 58 47 58 58 54 58 54 58 54 54 48 58 58 58 58 54 52 58 58 58 58 54 54 54 58 54 48 58 58 58 58 58 58 45 54 54 58 58 58 58 58 58 58 58 54 54 58 58 58 47 58 54 58 58 54 51 53 58 58 53 58 58 58 53 52 51 58 53 46 58 58 58 51 42 58 58 58 48 47 58 58 48 49 52 49 58 54 44 50 43 38 46 58 54 52 48 58 51 51 24 58 49 50 29 58 37 31 54 53 54 58 58 40 52 54 49 58 58 58 51 52 51 58 58 50 51 58 49 51 53 42 35 41 37 49 44 44 54 50 52 49 58 58 38 58 42 40 51 58 51 50 49 58 38 19 39 46 50 50 50 52 51 49 42 45 37 53 51 52 49 42 34 40 50 49 49 54 32 37 53 53 53 54 54 41 32 36 49 49 37 41 51 50 49 49 47 29 38 54 32 54 53 45 40 37 15 54 27 30 28 49 22 27 22 49 54 46 37 53 42 53 28 51 19 35 34 53 21 35 13 54 40 41 32 34 53 36 40 40 30 35 47 32 34 34 42 52 34 31 12 29 23 28 32 22 34 52 53 31 46 32 33 45 28 30 19 31 32 48 31 31 45 30 32 31 25 8 6 40 41 30 45 28 34 17 29 13 15 20 18 41 51 33 30 47 33 43 31 30 32 19 30 30 42 21 31 7 41 29 31 30 31 32 34 37 43 46 31 31 22 30 28 23 31 42 24 46 31 32 20 30 31 35 27 31 31 23 24 25 31 37 31 48 25 32 27 27 39 19 31 31 31 30 29 36 31 33 12 20 25 37 36 34 31 24 25 21 31 15 6 18 6 26 19 44 43 26 19 20 25 17 31 27 25 31 33 26 38 31 25 30 31 33 19 12 25 17 32 32 31 48 48 34 32 21 30 30 31 38 38 48 48 32 15 25 28 14 11 19 24 33 33 32 14 24 23 23 32 31 25 27 16 21 13 21 34 21 15 32 32 39 43	Open. Hide. 46 35 62 47 62 47 41 51 56 42 31 32 34 34 46 34 34 35 44 35 35 56 59 62 62 62 59 62 62 59 62 62 62 46 62 62 59 62 62 54 62 62 54 62 62 59 59 62 62 54 62 62 62 62 59 59 62 62 59 50 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 59 54 62 62 62 62 62 62 49 42 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 43 62 62 62 49 47 49 49 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 51 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 48 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 49 58 58 58 58 58 58 58 49 54 58 42 58 54 54 58 58 54 58 54 54 58 54 54 58 46 58 58 52 58 58 58 52 54 35 54 52 48 54 58 58 58 54 58 58 47 58 52 54 47 58 54 58 58 58 58 52 58 31 30 54 35 58 58 42 58 34 54 58 58 54 53 51 53 42 49 51 40 38 42 58 58 58 52 52 58 58 58 46 49 52 51 52 58 58 49 49 58 51 51 58 58 48 51 49 50 51 58 50 49 43 49 51 58 53 46 49 58 49 58 58 37 48 54 48 50 37 49 49 41 46 52 53 46 49 50 49 46 50 58 47 52 53 53 58 46 51 51 54 53 33 47 58 35 50 41 39 58 50 28 40 37 52 53 58 22 24 39 50 44 50 42 33 24 27 54 38 36 39 50 28 53 58 58 28 38 34 39 29 58 40 29 44 35 50 41 49 37 47 54 32 49 49 27 40 41 54 42 40 49 53 45 31 31 40 45 54 35 54 40 47 42 53 42 32 49 49 40 54 54 47 45 26 54 44 37 32 54 49 24 52 33 28 39 40 33 46 38 33 25 54 54 54 31 33 11 34 37 54 25 35 30 36 40 40 40 38 31 47 47 49 19 32 52 32 29 21 52 53 32 23 52 40 39 52 52 42 26 36 52 32 33 20 24 34 34 31 34 32 32 31 31 32 42 31 33 30 51 21 31 30 24 30 18 22 51 45 20 51 40 30 34 31 39 34 28 28 31 41 30 28 47 21 31 51 51 47 24 26 24 33 31 31 48 46 48 31 31 23 48 30 16 27 30 31 30 21 11 22 31 42 22 25 25 22 34 28 30 24 31 29 31 41 29 18 46 46 41 27 18 32 17 13 5 7 12 9 26 17 8 46 11 25 13 14 28 46 32 19 27 29 31 24 21 31 26 33 31 22 18 26 31 24 44 25 10 21 37 18 13 20 16 12 32 16 21 22 38 44 48 44 31 25 26 31 26 22 13 32 48 47 33 16 23 17 22 24 29 17 26 17 31 9 15 18 24 22 15 17 23 4 5 33 21 32 21 12 8 4 5 9 6 19 12 21 31 13 21 9 7 9 13 26 11 33 10 17 7 32 11 32 12 12 11 8 8 19 11 19 31 16 21 8 13 4 3 5 5 6 12 6 3 5 14 10 19 24 8 6 5 6 27 19 8 9 8 14 11 9 9 13 21 31 15 22 20 11 13 17 8 16 23 10 5 5 7 6 6 10 7 11 11 28 21 5 5 12 9 10 24 4 8 11 9 16 16 9 12 5 5 12 10 17 4 10 15 5 17 17 12 7 5 18 6 4 16 8 8 6 4 5 11 14 4 9 3 2 4 5 2 2 5 1 2 4 4 6 7 18 4 4 5 9 14 28 16 4 6 5 11 4 4 3 3 2 13 7 4 10 2 2 3 3 2 4 9 8 8 7 5 9 5 7 7 13 7 6 9 20 7 9

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_27802239_27802771
seq2: B6Ng01-324D22.b_45_577

seq1  GAATTCCAAATGTTTGCGCACTCATGACAAGCTTGGCAGCTGTACAGCAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAAATGTTTGCGCACTCATGACAAGCTTGGCAGCTGTACAGCAG  50

seq1  GTACTTTATTGTTAATGACGTAGTCATAAGCCAGGTATCTCGGCCCTGAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACTTTATTGTTAATGACGTAGTCATAAGCCAGGTATCTCGGCCCTGAG  100

seq1  AACAAAAAATTATTAATCTGAGTCAAGCTCTCAGATAGGAAAATGGAAAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAAAAAATTATTAATCTGAGTCAAGCTCTCAGATAGGAAAATGGAAAC  150

seq1  ACCATTACCATATAGATGGACTTTGCTATGATTTTTACTACTCTGTCCAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCATTACCATATAGATGGACTTTGCTATGATTTTTACTACTCTGTCCAC  200

seq1  TGCATGTATGTATGAACGATAAAGGCGGCATCTTACCACTACAAGACAGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCATGTATGTATGAACGATAAAGGCGGCATCTTACCACTACAAGACAGG  250

seq1  ATATTAAAAACAAAGAGAATTTATTGAACTTTCTAGAAGCTATTTGACTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTAAAAACAAAGAGAATTTATTGAACTTTCTAGAAGCTATTTGACTT  300

seq1  TTCCTATGAACTGTGGTCCTCCACTGCCAGGTTGCTGACCTGGCTCCCCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTATGAACTGTGGTCCTCCACTGCCAGGTTGCTGACCTGGCTCCCCA  350

seq1  ACAAACACCCCTAACATCTATTTATATTATATTCTGATGACATAACCCAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAACACCCCTAACATCTATTTATATTATATTCTGATGACATAACCCAA  400

seq1  CCTGGTGCCGCCTGAGACTCCATTGTAAAGAAAAAATATACAGCTCACAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGTGCCGCCTGAGACTCCATTGTAAAGAAAAAATATACAGCTCACAT  450

seq1  CCACAGGTTGATGGAGGACATCAGAGGCAAAGATCATTCTCACACAAACA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACAGGTTGATGGAGGACATCAGAGGCAAAGATCATTCTCACACAAACA  500

seq1  ACTGGCAAGATTGTTGGTAATTGATCTTCACCA  533
      |||||||||||||||||||||||||||||||||
seq2  ACTGGCAAGATTGTTGGTAATTGATCTTCACCA  533

seq1: chrX_27931830_27933020
seq2: B6Ng01-324D22.g_68_1272 (reverse)

seq1  AGAAAGAACAGA-----TAAAATATGAAGGAGACATTTACTCC-TACAGG  44
      |||||||||| |     | | |||||||||||||||||||||| |||| |
seq2  AGAAAGAACACACGGATTTACATATGAAGGAGACATTTACTCCTTACACG  50

seq1  GATATGGAAGGAATAGA-ATGGATAAAACAGGGAGTGGATCCTAAA--CA  91
       ||   | |||||| || || ||||||||  |||||||||||  ||  | 
seq2  AAT---GGAGGAATTGAGATTGATAAAACCAGGAGTGGATCCGGAACCCC  97

seq1  CCCTTGACCTTAGAATAAGAAAATTAAG-TGAC--TTTAGT-CAATAGAT  137
      ||||||||| ||||||||||||  |||| ||||  || ||| ||||||| 
seq2  CCCTTGACC-TAGAATAAGAAA--TAAGTTGACCTTTAAGTCCAATAGAA  144

seq1  ATTGGGCTTCTTATTAGATT--CAAGGCT-CACTACACAGGAGAGGAACC  184
      | || ||||| |||||||||   |||||| ||||||||  ||||||||||
seq2  AATGAGCTTC-TATTAGATTTCAAAGGCTCCACTACACCAGAGAGGAACC  193

seq1  GTGCT-CATTAATG-CAAAATTGACCAAAAAGC-AATAGCTCAGGGTGTG  231
      ||||| |||||||| |||||||||||||||||| ||||||||||||||||
seq2  GTGCTCCATTAATGCCAAAATTGACCAAAAAGCAAATAGCTCAGGGTGTG  243

seq1  ATAGGACATAGGGGAGAACCTATTGTTATTATTTTTAGCTATATGTATAC  281
      |||||||||| ||||||||||||||||| |||||||||||||||||||||
seq2  ATAGGACATA-GGGAGAACCTATTGTTA-TATTTTTAGCTATATGTATAC  291

seq1  AGTATCAATAAAT-CCCCACATAAAAA-CCATCATGCATATTTGGGTAAT  329
      ||||||||||||| ||||||||||||| ||||||||||||||||||||||
seq2  AGTATCAATAAATCCCCCACATAAAAACCCATCATGCATATTTGGGTAAT  341

seq1  ATTTAGCAGTAATATGAACCTAATTTTATTATTTGAGC-AAAATATATAT  378
      |||||||||||||||||||||||||||||||||||||| |||||||||||
seq2  ATTTAGCAGTAATATGAACCTAATTTTATTATTTGAGCAAAAATATATAT  391

seq1  AAATAG-AAAATGTTATATAATTTGAAATAAAAGATACATAAACAATTGC  427
      |||||| |||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAGAAAAATGTTATATAATTTGAAATAAAAGATACATAAACAATTGC  441

seq1  ATACATTGGTTTAATAAGTAAATTGAAACTGTAAAGTTCTAATTAAACTG  477
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACATTGGTTTAATAAGTAAATTGAAACTGTAAAGTTCTAATTAAACTG  491

seq1  TACATGCTCATTCACTTATAGCTTATGTGAGGTATAGGTTTTTATGAAGT  527
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATGCTCATTCACTTATAGCTTATGTGAGGTATAGGTTTTTATGAAGT  541

seq1  TAGTAGTGAGATTTATTATGACTTTTGCAGATATCCTTAGTTTATCTTAC  577
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTAGTGAGATTTATTATGACTTTTGCAGATATCCTTAGTTTATCTTAC  591

seq1  CTTCTTCCCTATTCCTTCTACATTAATCTTTCTCATTATAACCTGACTCT  627
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTTCCCTATTCCTTCTACATTAATCTTTCTCATTATAACCTGACTCT  641

seq1  CCAAAGTGTCTCCAGAAATTATGACAATCACAATTATCCATGCTGCCATC  677
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAAGTGTCTCCAGAAATTATGACAATCACAATTATCCATGCTGCCATC  691

seq1  AGTAGCCATATTGAAACCCACATTTCATGTTGCTTCTGAAGATATTGTTA  727
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAGCCATATTGAAACCCACATTTCATGTTGCTTCTGAAGATATTGTTA  741

seq1  ATGTCAAGGATCCCAGAAACCATCAGAATTTACAGTGAACTTCACAGTCA  777
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTCAAGGATCCCAGAAACCATCAGAATTTACAGTGAACTTCACAGTCA  791

seq1  GTACTGTTCCCTCAGGTCATGTTGAGTTAAATGTTCTGATATATGTTTTG  827
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACTGTTCCCTCAGGTCATGTTGAGTTAAATGTTCTGATATATGTTTTG  841

seq1  TTGAGGTCACATATATACTGGCAACAGACAATGTATGGCCATGATACTTT  877
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAGGTCACATATATACTGGCAACAGACAATGTATGGCCATGATACTTT  891

seq1  AGGCCTTTAGCAGCAATCATGTCAGTGATCCCTGCTGCATTATGGGACCA  927
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCCTTTAGCAGCAATCATGTCAGTGATCCCTGCTGCATTATGGGACCA  941

seq1  CATTAATATGACAGTCTTGTACTGCATTAGAATAATTACTGATGTCAATT  977
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTAATATGACAGTCTTGTACTGCATTAGAATAATTACTGATGTCAATT  991

seq1  ATGTATAATTCTGCCACATTCATGATAAGTGTTCTGCCATTTATAAACAT  1027
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTATAATTCTGCCACATTCATGATAAGTGTTCTGCCATTTATAAACAT  1041

seq1  TTTTATGTCCATTTTCATTCTGTCACTAGATAAGAGGTTTCAGTCATGGT  1077
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTATGTCCATTTTCATTCTGTCACTAGATAAGAGGTTTCAGTCATGGT  1091

seq1  CATACCAGCTGGATGCTGTCACCAGTAACAAGATAGAGTCTATTTTTAAT  1127
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATACCAGCTGGATGCTGTCACCAGTAACAAGATAGAGTCTATTTTTAAT  1141

seq1  ATTTCTGATGGAGATAATGGTGATGACTATGATCTGTACTGCTTCTGGAG  1177
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCTGATGGAGATAATGGTGATGACTATGATCTGTACTGCTTCTGGAG  1191

seq1  AAACTGCTGAATTC  1191
      ||||||||||||||
seq2  AAACTGCTGAATTC  1205

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information