MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-327F02
Chromosome	X (Build37)
Map Location	100,283,713 - 100,451,078
singlet/doublet	doublet
Overlap gene	EG621205, Nap1l2, LOC668217, 4930519F16Rik
Upstream gene	LOC331476, Pin4, LOC670921, Ercc6l, LOC668318, Rps4x, LOC100043080, Cited1, Hdac8, Phka1, LOC668331, LOC100042516, EG668339, Dmrtc1b, EG668343, LOC100043105, EG668349, EG382233, Dmrtc1c, EG668360, LOC668357, 1700031F05Rik, EG668369, Dmrtc1a, 1700011M02Rik, 1700018G05Rik, EG331480, EG668382, LOC668387, EG245545, LOC100042610
Downstream gene	LOC100042615, Cdx4, LOC671052, Chic1, Tsx, Tsix, Xist, Rps12-ps1, LOC668406, LOC676246, ENSMUSG00000043661, LOC668412, LOC668415, B230206F22Rik, Cnbp2, LOC100042640, Slc16a2, EG621381, EG668426, LOC668430, Rnf12, C77370
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC331476 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:331476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins

name	Pin4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69713 MGI:1916963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC670921 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	Ercc6l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236930 MGI:2654144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668318 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 4 Proteins pseudo : _no_value

name	Rps4x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20102 MGI:98158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043080 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins pseudo : _no_value

name	Cited1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12705 MGI:108023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdac8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70315 MGI:1917565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phka1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18679 MGI:97576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC668331 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins pseudo : _no_value

name	LOC100042516 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042516
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG668339 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668339 MGI:3645559
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs

name	Dmrtc1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632708 MGI:3639121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668343 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668343 MGI:3648181
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 309 ESTs, 6 Proteins pseudo : _no_value

name	LOC100043105 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	EG668349 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668349 MGI:3648179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	EG382233 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382233 MGI:3648097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Dmrtc1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71083 MGI:1918333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins

name	EG668360 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668360 MGI:3648387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC668357 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins

name	1700031F05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73300 MGI:1920550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	EG668369 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668369 MGI:3648394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Dmrtc1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70887 MGI:1918137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	1700011M02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75443 MGI:1922693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	1700018G05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69388 MGI:1916638
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	EG331480 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331480 MGI:3649150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein

name	EG668382 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668382 MGI:3644774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 16 Proteins pseudo : _no_value

name	LOC668387 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 5 Proteins pseudo : _no_value

name	EG245545 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245545 MGI:3645788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 17 Proteins

name	LOC100042610 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042610
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG621205 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621205 MGI:3644890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 108 ESTs, 5 Proteins

name	Nap1l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17954 MGI:106654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668217 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins pseudo : _no_value

name	4930519F16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75106 MGI:1922356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042615 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042615
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Cdx4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12592 MGI:88362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671052 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671052
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Chic1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12212 MGI:1344694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22127 MGI:108118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsix (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22097 MGI:1336196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xist (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213742 MGI:98974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rps12-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30964 MGI:1353638
definition	gene_synonym : pS12X note : ribosomal protein S12, pseudogene 1 pseudo : _no_value

name	LOC668406 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 218 ESTs, 2 Proteins pseudo : _no_value

name	LOC676246 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	ENSMUSG00000043661 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621818 MGI:3641899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668412 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC668415 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	B230206F22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78878 MGI:1926128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Cnbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75064 MGI:1922314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042640 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Slc16a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20502 MGI:1203732
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621381 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621381 MGI:3648722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 268 ESTs, 11 Proteins

name	EG668426 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668426 MGI:3646866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	LOC668430 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668430
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Rnf12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19820 MGI:1342291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C77370 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245555 MGI:2148050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC331476 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271809 GeneID:331476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : similar to SUMO-1-specific protease transcript_id : XM_001478302.1

name	Pin4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113931155 GeneID:69713 MGI:1916963
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) transcript_id : NM_027181.1

name	Ercc6l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27414500 GeneID:236930 MGI:2654144
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : excision repair cross-complementing rodent repair deficiency complementation group 6 - like transcript_id : NM_146235.2

name	Rps4x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677804 GeneID:20102 MGI:98158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S4, X-linked transcript_id : NM_009094.1

name	Cited1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476051 GeneID:12705 MGI:108023
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 transcript_id : NM_007709.3

name	Hdac8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801693 GeneID:70315 MGI:1917565
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone deacetylase 8 transcript_id : NM_027382.2

name	Phka1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142355008 GeneID:18679 MGI:97576
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphorylase kinase alpha 1 transcript_id : NM_173021.2

name	Phka1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679300 GeneID:18679 MGI:97576
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphorylase kinase alpha 1 transcript_id : NM_008832.1

name	LOC100042516 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271813 GeneID:100042516
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042516 transcript_id : XM_001478363.1

name	EG668339 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407698 GeneID:668339 MGI:3645559
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs product : predicted gene, EG668339 transcript_id : XM_001001002.1

name	Dmrtc1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84993762 GeneID:632708 MGI:3639121
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DMRT-like family C1b transcript_id : NM_001039116.1

name	LOC100043105 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271839 GeneID:100043105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : similar to novel member of the doublesex and mab-3 related transcription factor (Dmrt) family transcript_id : XM_001479377.1

name	EG668349 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407703 GeneID:668349 MGI:3648179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG668349 transcript_id : XM_001001046.1

name	EG382233 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407705 GeneID:382233 MGI:3648097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG382233, transcript variant 1 transcript_id : XM_356344.5

name	Dmrtc1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407710 GeneID:71083 MGI:1918333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins product : DMRT-like family C1c transcript_id : XM_001001109.1

name	EG668360 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271815 GeneID:668360 MGI:3648387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG668360 transcript_id : XM_001001097.2

name	LOC668357 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407706 GeneID:668357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins product : similar to Dmrtc1c protein transcript_id : XM_135517.4

name	1700031F05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407712 GeneID:73300 MGI:1920550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 1700031F05 gene, transcript variant 1 transcript_id : XM_356346.4

name	EG668369 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407713 GeneID:668369 MGI:3648394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG668369 transcript_id : XM_001001135.1

name	Dmrtc1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801315 GeneID:70887 MGI:1918137
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DMRT-like family C1a transcript_id : NM_027591.2

name	Dmrtc1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490370 GeneID:70887 MGI:1918137
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DMRT-like family C1a transcript_id : NM_001038616.1

name	Dmrtc1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490366 GeneID:70887 MGI:1918137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DMRT-like family C1a transcript_id : NM_029378.1

name	1700011M02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271817 GeneID:75443 MGI:1922693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 1700011M02 gene transcript_id : XM_001001147.2

name	1700018G05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407717 GeneID:69388 MGI:1916638
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : RIKEN cDNA 1700018G05 gene transcript_id : XM_920174.2

name	EG245545 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271820 GeneID:245545 MGI:3645788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 17 Proteins product : predicted gene, EG245545 transcript_id : XM_141989.6

name	EG621205 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407675 GeneID:621205 MGI:3644890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 108 ESTs, 4 Proteins product : predicted gene, EG621205, transcript variant 4 transcript_id : XM_897204.2

name	EG621205 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271844 GeneID:621205 MGI:3644890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 106 ESTs, 2 Proteins product : predicted gene, EG621205 transcript_id : XM_001479423.1

name	Nap1l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679009 GeneID:17954 MGI:106654
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleosome assembly protein 1-like 2 transcript_id : NM_008671.1

name	4930519F16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626033 GeneID:75106 MGI:1922356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930519F16 gene transcript_id : NM_029170.1

name	Cdx4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802151 GeneID:12592 MGI:88362
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caudal type homeo box 4 transcript_id : NM_007674.2

name	Chic1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55742748 GeneID:12212 MGI:1344694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich hydrophobic domain 1 transcript_id : NM_009767.1

name	Tsx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678450 GeneID:22127 MGI:108118
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis specific X-linked gene transcript_id : NM_009440.1

name	ENSMUSG00000043661 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865930 GeneID:621818 MGI:3641899
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, ENSMUSG00000043661 transcript_id : NM_001045541.1

name	B230206F22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271848 GeneID:78878 MGI:1926128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA B230206F22 gene transcript_id : XM_001479486.1

name	Cnbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385400 GeneID:75064 MGI:1922314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cellular nucleic acid binding protein 2 transcript_id : NM_029158.2

name	Slc16a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112421074 GeneID:20502 MGI:1203732
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 16 (monocarboxylic acid transporters), member 2 transcript_id : NM_009197.2

name	EG621381 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271850 GeneID:621381 MGI:3648722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 264 ESTs, 11 Proteins product : predicted gene, EG621381 transcript_id : XM_887206.3

name	Rnf12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47078288 GeneID:19820 MGI:1342291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 12 transcript_id : NM_011276.3

name	C77370 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116325978 GeneID:245555 MGI:2148050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C77370 transcript_id : NM_001077354.1

name	LOC331476 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271810 GeneID:331476
definition	codon_start : 1 product : similar to SUMO-1-specific protease protein_id : XP_001478352.1

name	Pin4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113931156 GeneID:69713 MGI:1916963
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) protein_id : NP_081457.1

name	Ercc6l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27414501 CCDS:CCDS30321.1 GeneID:236930 MGI:2654144
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA] codon_start : 1 note : SNF2/RAD54 family protein; excision repair cross-complementing rodent repair deficiency complementation group 6-like product : excision repair cross-complementing rodent repair deficiency complementation group 6 - like protein_id : NP_666347.2

name	Rps4x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677805 GeneID:20102 MGI:98158
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence ISS] GO_function : GO:0019843 - rRNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence ISS]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : ribosomal protein S4 X-linked product : ribosomal protein S4, X-linked protein_id : NP_033120.1

name	Cited1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671760 CCDS:CCDS30322.1 GeneID:12705 MGI:108023
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003700 - transcription factor activity [Evidence NAS]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0001892 - embryonic placenta development [Evidence IMP]; GO:0030318 - melanocyte differentiation [Evidence IMP]; GO:0043473 - pigmentation [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0001570 - vasculogenesis [Evidence IMP] codon_start : 1 product : Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 protein_id : NP_031735.1

name	Hdac8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037203 GeneID:70315 MGI:1917565
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0000118 - histone deacetylase complex [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] [Evidence IEA] GO_function : GO:0004407 - histone deacetylase activity [Evidence IEA] [Evidence TAS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence TAS] GO_process : GO:0016568 - chromatin modification [Evidence TAS] [Evidence IEA]; GO:0016575 - histone deacetylation [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : histone deacetylase 8 protein_id : NP_081658.1

name	Phka1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27819665 CCDS:CCDS30324.1 GeneID:18679 MGI:97576
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004689 - phosphorylase kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005977 - glycogen metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : phosphorylase kinase alpha 1 isoform 2 protein_id : NP_766609.1

name	Phka1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679301 CCDS:CCDS30323.1 GeneID:18679 MGI:97576
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004689 - phosphorylase kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005977 - glycogen metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : phosphorylase kinase alpha 1 isoform 1 protein_id : NP_032858.1

name	LOC100042516 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271814 GeneID:100042516
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478413.1

name	EG668339 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407699 GeneID:668339 MGI:3645559
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001002.1

name	Dmrtc1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84993763 CCDS:CCDS30325.1 GeneID:632708 MGI:3639121
definition	codon_start : 1 exception : mismatches in translation note : doublesex and mab-3 related transcription factor 8.2 product : DMRT-like family C1b protein_id : NP_001034205.1

name	LOC100043105 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271840 GeneID:100043105
definition	codon_start : 1 product : similar to novel member of the doublesex and mab-3 related transcription factor (Dmrt) family protein_id : XP_001479427.1

name	EG668349 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407704 GeneID:668349 MGI:3648179
definition	codon_start : 1 product : similar to doublesex and mab-3 related transcription factor 8.2 protein_id : XP_001001046.1

name	EG382233 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63747891 GeneID:382233 MGI:3648097
definition	codon_start : 1 product : similar to novel member of the doublesex and mab-3 related transcription factor (Dmrt) family isoform 1 protein_id : XP_356344.2

name	Dmrtc1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271841 GeneID:71083 MGI:1918333
definition	codon_start : 1 product : DMRT-like family C1c protein_id : XP_001001109.2

name	EG668360 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271816 GeneID:668360 MGI:3648387
definition	codon_start : 1 product : similar to doublesex and mab-3 related transcription factor 8.2 protein_id : XP_001001097.2

name	LOC668357 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271842 GeneID:668357
definition	codon_start : 1 product : similar to Dmrtc1c protein protein_id : XP_135517.4

name	1700031F05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086482 GeneID:73300 MGI:1920550
definition	codon_start : 1 product : hypothetical protein LOC73300 isoform 1 protein_id : XP_356346.1

name	EG668369 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407714 GeneID:668369 MGI:3648394
definition	codon_start : 1 product : similar to doublesex and mab-3 related transcription factor 8.2 protein_id : XP_001001135.1

name	Dmrtc1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490371 GeneID:70887 MGI:1918137
definition	GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform c is encoded by transcript variant 3; doublesex and mab-3 related transcription factor 8.1; likely ortologue to human doublesex-and mab-3-related transcription factor C1 (Dmrtc1) product : doublesex and mab-3 related transcription factor 8.1 isoform c protein_id : NP_001033705.1

name	Dmrtc1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21735457 CCDS:CCDS30327.1 GeneID:70887 MGI:1918137
definition	GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; doublesex and mab-3 related transcription factor 8.1; likely ortologue to human doublesex-and mab-3-related transcription factor C1 (Dmrtc1) product : doublesex and mab-3 related transcription factor 8.1 isoform a protein_id : NP_081867.1

name	Dmrtc1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490367 GeneID:70887 MGI:1918137
definition	GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; doublesex and mab-3 related transcription factor 8.1; likely ortologue to human doublesex-and mab-3-related transcription factor C1 (Dmrtc1) product : doublesex and mab-3 related transcription factor 8.1 isoform b protein_id : NP_083654.1

name	1700011M02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407716 GeneID:75443 MGI:1922693
definition	codon_start : 1 product : hypothetical protein LOC75443 protein_id : XP_001001147.1

name	1700018G05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407718 GeneID:69388 MGI:1916638
definition	codon_start : 1 product : hypothetical protein LOC69388 protein_id : XP_925267.2

name	EG245545 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271821 GeneID:245545 MGI:3645788
definition	codon_start : 1 product : similar to LOC645974 protein protein_id : XP_141989.4

name	EG621205 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407676 GeneID:621205 MGI:3644890
definition	codon_start : 1 product : similar to constitutive photomorphogenic protein isoform 4 protein_id : XP_902297.2

name	EG621205 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271845 GeneID:621205 MGI:3644890
definition	codon_start : 1 product : similar to constitutive photomorphogenic protein protein_id : XP_001479473.1

name	Nap1l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679010 GeneID:17954 MGI:106654
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 exception : mismatches in translation product : nucleosome assembly protein 1-like 2 protein_id : NP_032697.1

name	4930519F16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626034 GeneID:75106 MGI:1922356
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : alternative splicing B; alternative splicing D; alternative splicing A; novel gene likely coding for a serine proteases, trypsin family/Chymotrypsin serine protease family (S1) containing protein; putative serine protease product : hypothetical protein LOC75106 protein_id : NP_083446.1

name	Cdx4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680914 CCDS:CCDS30328.1 GeneID:12592 MGI:88362
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0001568 - blood vessel development [Evidence IGI]; GO:0007275 - development [Evidence IEA]; GO:0001890 - placenta development [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : cdx 4 gene encoding DNA binding domain product : caudal type homeo box 4 protein_id : NP_031700.1

name	Chic1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55742749 GeneID:12212 MGI:1344694
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : cystein-rich hydrophobic domain 1; brain X-linked product : cysteine-rich hydrophobic domain 1 protein_id : NP_033897.1

name	Tsx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678451 GeneID:22127 MGI:108118
definition	codon_start : 1 product : testis specific X-linked protein_id : NP_033466.1

name	ENSMUSG00000043661 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865931 GeneID:621818 MGI:3641899
definition	codon_start : 1 note : BMI1-like; polycomb group ring finger 6-like product : hypothetical protein LOC621818 protein_id : NP_001039006.1

name	B230206F22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271849 GeneID:78878 MGI:1926128
definition	codon_start : 1 product : thrombocytosis, familial X-linked protein_id : XP_001479536.1

name	Cnbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55925630 CCDS:CCDS30329.1 GeneID:75064 MGI:1922314
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : cellular nucleic acid binding-like protein product : cellular nucleic acid binding protein 2 protein_id : NP_083434.1

name	Slc16a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112421075 CCDS:CCDS30330.1 GeneID:20502 MGI:1203732
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : X-linked PEST-containing transporter; monocarboxylate transporter 8 product : solute carrier family 16, member 2 protein_id : NP_033223.2

name	EG621381 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271851 GeneID:621381 MGI:3648722
definition	codon_start : 1 product : similar to 16.7 kDa-like protein protein_id : XP_892299.2

name	Rnf12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47078289 CCDS:CCDS30331.1 GeneID:19820 MGI:1342291
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IC] codon_start : 1 note : Hoxa1 regulated product : ring finger protein 12 protein_id : NP_035406.3

name	C77370 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116325979 GeneID:245555 MGI:2148050
definition	GO_function : GO:0008408 - 3'-5' exonuclease activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 product : hypothetical protein LOC245555 protein_id : NP_001070822.1

name	LOC100042610 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042610
definition	number : 1 pseudo : _no_value

name	LOC100042610 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042610
definition	number : 2 pseudo : _no_value

name	LOC100042610 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042610
definition	number : 3 pseudo : _no_value

name	LOC100042610 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042610
definition	number : 4 pseudo : _no_value

name	LOC100042610 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042610
definition	number : 5 pseudo : _no_value

name	LOC100042615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042615
definition	number : 1 pseudo : _no_value

name	LOC100042615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042615
definition	number : 2 pseudo : _no_value

name	LOC100042615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042615
definition	number : 3 pseudo : _no_value

name	LOC100042615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042615
definition	number : 4 pseudo : _no_value

name	LOC100042615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042615
definition	number : 5 pseudo : _no_value

name	LOC100042615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042615
definition	number : 6 pseudo : _no_value

name	LOC671052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671052
definition	number : 1 pseudo : _no_value

name	LOC671052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671052
definition	number : 2 pseudo : _no_value

name	LOC671052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671052
definition	number : 3 pseudo : _no_value

name	LOC676246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676246
definition	number : 1 pseudo : _no_value

name	LOC676246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676246
definition	number : 2 pseudo : _no_value

name	LOC668412 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668412
definition	number : 1 pseudo : _no_value

name	LOC668415 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668415
definition	number : 1 pseudo : _no_value

name	LOC668415 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668415
definition	number : 2 pseudo : _no_value

name	LOC100042640 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042640
definition	number : 1 pseudo : _no_value

name	LOC100042640 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042640
definition	number : 2 pseudo : _no_value

name	EG668426 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668426
definition	number : 1 pseudo : _no_value

name	LOC668430 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668430
definition	number : 1 pseudo : _no_value

name	Rps12-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	gene_synonym : pS12X note : S19 pseudogene pseudo : _no_value

name	LOC670921 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271837 GeneID:670921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Hmgb1 protein pseudo : _no_value transcript_id : XR_034127.1

name	LOC668318 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271811 GeneID:668318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 4 Proteins product : similar to PNG protein pseudo : _no_value transcript_id : XR_033639.1

name	LOC100043080 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271838 GeneID:100043080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins product : similar to 60S ribosomal protein L34 pseudo : _no_value transcript_id : XR_034133.1

name	LOC668331 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271812 GeneID:668331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : similar to transcriptional adaptor 3-like pseudo : _no_value transcript_id : XR_033649.1

name	EG668343 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94407700 GeneID:668343 MGI:3648181
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 309 ESTs, 6 Proteins product : predicted gene, EG668343 pseudo : _no_value transcript_id : XR_002167.1

name	EG331480 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94407719 GeneID:331480 MGI:3649150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein product : predicted gene, EG331480 transcript_id : XR_002365.1

name	EG668382 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271819 GeneID:668382 MGI:3644774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 16 Proteins product : predicted gene, EG668382 pseudo : _no_value transcript_id : XR_033707.1

name	LOC668387 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271843 GeneID:668387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 5 Proteins product : similar to ribosomal protein S6 pseudo : _no_value transcript_id : XR_034189.1

name	LOC668217 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271846 GeneID:668217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins product : similar to RIKEN cDNA 1700029P11 gene pseudo : _no_value transcript_id : XR_034207.1

name	Tsix (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872141 GeneID:22097 MGI:1336196
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X (inactive)-specific transcript, antisense transcript_id : NR_002844.1

name	Xist (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:37704376 GeneID:213742 MGI:98974
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inactive X specific transcripts transcript_id : NR_001570.1

name	Xist (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:37704378 GeneID:213742 MGI:98974
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inactive X specific transcripts transcript_id : NR_001463.2

name	LOC668406 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271847 GeneID:668406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 218 ESTs, 2 Proteins product : similar to ribosomal protein S12 pseudo : _no_value transcript_id : XR_034219.1

clone name	MSMg01-545O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161C14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052A19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-123E10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052A19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-123E10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-263L07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-529C20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-197I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173M11
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-327F02.b	B6Ng01-327F02.g
ACC	GA114896	GA114897
length	871	1,085
definition	B6Ng01-327F02.b	B6Ng01-327F02.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(100,450,210 - 100,451,078)	(100,283,713 - 100,284,793)
sequence	gaattcagagaaactggagaagattctggtctacagagtgagttccagga cagccagggctatacagagagaaaacctgtctcaaacaaaccaaaacaaa caaaaaaaccccacaaacaaacaaacaaaaaagaatcactttctggtact caaatcatgtaatgggctttttactattatgtagccaacatcttttctgt cttctcacacttaatttttccatttccttctccctcattcatttgaaaat caattgaatatccatcattgtcatgctgaaaactaatttctgaggagtca gagataaatgaattagtggttccattttgtctgtaatcaagcctgatgac ctgagtttgattcctagaaagagaatgaacacctgcaagttgttctgagt cctatgcagttgcttgtgtatcataagggtccgaaaatcgctggaggaag accccagacttagatggtatgcaaaaacaaagaatgtttatactgtagaa acaaccagaatatgggggtcaaccattctctaaaatggtgacccaagacg aaggcacgtcggccttctgacagggaaccagggaactttctaggattagg taatctcaaatttcattggtatgtgctggtgtgtctgtgtgtgtgacagg tggtcagtggtttgcattcctgtgtcatgaatgtttaaccatagaatgag atagggctgccctgagtaaatgcccatcctgagataagatatttccccat tttttgtggtggttgtctccaggctgttctttgggaaggggttttatgac cttgtttttggattttttggtctattcctgggagctggtgcctatggact ttaatgattgttttttttctt	gaattctcttttatgcacgctgtttgtggttgaaccaagtgtccctttcc aaccataagaatctcttgcaaagcaatctggctgtgccataatagtcgga gttgaacaattatttcactaaaactagtccatggagcaccaaaggctgtt acaaaataaaattaagtagcatttatggctagagaagtgactgagtagtt tcttagctccacatccttgccagcgtgagctgtcacttgtgttattgatc ttagccattctgaaaggtgaaggagtctcagggcccttttgatatgcatt tccctcatggttaaatatgttgggcatttctttaagtgttgctaggccat ttgagattcttctattaagattttcctgtttagatctgtatcccatttta aaattgaattatttggtttgatgatgtctagtttcttgagttctttctat attttagatatttgccttctattggttgtcgagttactggaaatcttttt ttatcctgtaagctgatgttttgtcctattgatggtgtcctttgctttgc agaagcttttgagtttcataaggttccattgattgattgttgatcttagt acctgtgtgatttgttttctgctcaagaagctgtctgctgtgccaatgag ttcaaggctattcccccactttcttttctattagatttagtgtatctcgt tttatgttcaggagtttgattcacttgtacttgagttttgtgcaggacga tagatatatatctacttgcattctcctatatgtcaacatccggttagatc agcaccatttgttttgagatgttttcttttgtccattgtgtatttctggc ttctttgtcaaaaatcaagtgtccgtaagtgtgtaaatctacttcagagt ttttcagtttgattccattgatttaactttatacttactggtttgtatgt ctgttgtggagaacacagatttgtcttgttgccacagatgcattttctag gtcacagtctaggaggtgaaaggcaggacagcttcctcagatggctaaat actggcatgggactcaggctctgtctggagagggt
quality values	Open. Hide. 49 31 33 34 62 38 22 52 62 54 47 62 42 47 62 62 62 47 47 49 62 62 41 33 62 62 62 62 62 59 62 59 62 59 59 28 33 24 32 48 59 62 62 62 62 59 59 48 54 54 54 62 62 62 62 59 59 59 54 62 62 62 62 62 62 59 59 59 54 54 59 59 62 62 62 59 56 34 31 31 36 38 43 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 59 62 62 54 49 54 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 54 59 62 59 62 62 62 62 62 62 62 59 59 62 54 56 59 59 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 54 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 59 62 56 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 56 56 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 54 46 59 51 48 56 56 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 49 59 62 59 62 62 59 56 62 51 59 62 59 62 62 62 62 62 62 62 62 62 51 59 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 59 50 56 56 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 59 59 59 59 59 59 62 62 62 62 62 51 62 59 56 56 59 62 56 48 62 59 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 51 51 59 59 62 62 62 59 59 62 62 62 59 62 59 59 59 59 59 59 62 62 59 59 62 43 62 56 59 46 50 51 39 43 51 51 59 59 49 62 62 62 59 59 59 59 62 62 56 49 59 59 59 56 49 28 59 56 59 62 56 59 62 59 59 51 51 59 59 59 59 51 59 59 51 62 59 59 62 51 62 41 34 39 28 36 39 56 59 59 41 59 59 59 59 45 56 59 46 43 41 62 59 59 56 59 59 62 59 62 62 62 62 59 44 59 62 59 62 62 62 59 59 51 51 43 34 45 50 59 62 56 59 59 47 56 44 39 50 56 47 42 32 62 51 35 54 42 42 51 26 42 31 11 32 27 43 44 47 56 56 56 47 26 42 39 62 56 56 62 62 62 56 42 37 47 62 62 56 62 62 62 62 62 51 15 24 24 13 18 24 26 37 42 42 20 20 16 9 17 11 56 62 50 62 50 56 39 56 56 56 40 32 38 56 56 56 43 47 56 50 62 47 62 41 54 42 52 43 47 38 35 27 35 42 38 38 47 52 28 46 27 36 33 62 48 46 52 52 33 23 33 14 12 14 22 14 11 10 9 13 16 19 12 28 23 40 35 35 32 37 34 52 39 22 42 30 32 35 34 39 42 32 39 52 32 15 46 35 34 37 39 23 31 40 52 30 52 42 46 52 47 38 52 54 52 52 54 10 12 15 24 40 34 26 18 42 29 52 32 32 22 14 25 45 17 34 27 42 30 9 47 29 16 15 15 32 46 41 17 28 20 15 19 21 50 46 36 36 29 32 16 15 17 21 37 51 47 26 32 39 46 28 16 21 29 37 36 51 35 37 26 19 37 21 16 26 19 10 28 19 19 10 11 9 11 12 11 21 32 17 36 17 32 49 40 19 18 11 27 12 15 13 19 18 8 27 18 8 8 6 9 10 9 30 17 16 7 13 10 28 19 14 32 12 13 9 21 28 23 15 16 33 16 12 10 6 9 14 9 11 18 13 40 16 7 6 9 6 16 10 12 5 12 28 10 19 6 17 6 11 5 5 5	Open. Hide. 62 47 51 44 62 62 62 62 62 62 46 59 50 28 33 43 34 43 56 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 59 62 62 62 62 59 62 62 62 62 59 51 62 62 59 59 59 62 62 56 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 58 40 52 58 54 54 47 52 54 58 58 58 58 58 58 58 58 58 52 58 58 50 58 58 58 58 58 58 58 52 58 58 58 54 54 54 52 58 54 58 52 54 58 44 42 58 58 58 54 47 58 58 52 46 58 58 52 58 58 54 54 58 58 54 58 52 54 52 58 58 54 58 54 58 54 58 36 22 58 58 58 47 58 58 58 53 54 51 58 54 51 52 58 37 58 58 32 58 58 58 58 51 49 51 51 58 51 49 51 58 34 26 58 50 58 58 37 58 51 52 40 52 32 58 48 54 52 51 53 45 58 58 58 49 37 54 53 58 51 49 50 58 58 49 50 46 50 54 53 50 28 54 31 49 42 52 50 58 58 42 53 53 58 49 50 54 41 58 58 50 41 41 58 37 54 39 30 33 58 58 25 58 58 52 50 52 32 36 33 32 47 54 54 44 34 40 52 45 51 47 54 34 54 54 54 51 51 45 39 39 32 9 35 33 22 39 38 25 50 32 28 32 45 53 45 53 40 37 54 45 37 52 45 49 44 35 33 54 52 53 45 41 34 31 52 53 37 40 47 34 42 25 27 30 21 52 54 42 27 33 30 47 30 24 33 35 40 39 22 38 31 32 42 36 39 49 32 42 31 53 52 8 22 53 19 47 29 15 6 49 49 33 42 39 51 51 46 45 14 14 30 31 31 30 40 14 51 13 30 30 51 25 31 30 41 45 34 20 12 19 30 51 29 31 21 28 31 46 47 46 37 24 31 18 33 31 30 33 23 26 25 25 32 32 42 29 26 43 25 42 17 14 46 31 31 32 35 33 37 31 31 31 30 13 31 9 12 48 48 48 19 32 31 32 32 48 32 34 19 11 16 19 39 20 18 32 43 30 14 43 6 31 26 32 25 48 30 22 21 21 31 10 38 14 32 27 29 31 9 36 7 22 16 36 27 30 29 28 13 31 13 29 30 10 32 12 14 10 19 17 7 6 9 10 9 31 28 48 26 32 32 10 7 14 18 8 16 15 18 5 6 8 12 7 19 10 32 31 19 25 48 36 13 15 22 26 14 12 26 31 9 16 31 21 17 15 13 14 8 7 23 13 15 31 10 20 28 20 9 12 16 12 17 13 3 3 6 4 5 11 9 13 26 16 16 6 6 18 7 28 27 8 15 15 40 14 20 7 14 8 11 27 6 13 10 27 28 17 8 10 23 19 25 6 6 6 6 5 12 23 8 5 3 6 7 8 7 6 16 25 24 7

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_100450210_100451078
seq2: B6Ng01-327F02.b_47_917 (reverse)

seq1  AAGAAAAAAAAAAATC-TTAAAGTCCATAAGGCACCAGCT-CCAGGAATA  48
      ||||||||||| |||| ||||||||||| ||||||||||| |||||||||
seq2  AAGAAAAAAAACAATCATTAAAGTCCAT-AGGCACCAGCTCCCAGGAATA  49

seq1  GACCATAAAATCCAAAAACAAGGTCATAAAACCCCTTACCAAAGAACAGC  98
      ||||| ||||||||||||||||||||||||||||||| ||||||||||||
seq2  GACCAAAAAATCCAAAAACAAGGTCATAAAACCCCTTCCCAAAGAACAGC  99

seq1  CTGGAGACAACCACCAC-AAAAATGGGGAAATATCTTATCTCAGGATGGG  147
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  CTGGAGACAACCACCACAAAAAATGGGGAAATATCTTATCTCAGGATGGG  149

seq1  CATTTACTCAGGGCAGCCCTATCTCATTCTATGGTTAAACATTCATGACA  197
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTACTCAGGGCAGCCCTATCTCATTCTATGGTTAAACATTCATGACA  199

seq1  CAGGAATGCAAACCACTGACCACCTGTCACACACACAGACACACCAGCAC  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAATGCAAACCACTGACCACCTGTCACACACACAGACACACCAGCAC  249

seq1  ATACCAATGAAATTTGAGATTACCTAATCCTAGAAAGTTCCCTGGTTCCC  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACCAATGAAATTTGAGATTACCTAATCCTAGAAAGTTCCCTGGTTCCC  299

seq1  TGTCAGAAGGCCGACGTGCCTTCGTCTTGGGTCACCATTTTAGAGAATGG  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCAGAAGGCCGACGTGCCTTCGTCTTGGGTCACCATTTTAGAGAATGG  349

seq1  TTGACCCCCATATTCTGGTTGTTTCTACAGTATAAACATTCTTTGTTTTT  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGACCCCCATATTCTGGTTGTTTCTACAGTATAAACATTCTTTGTTTTT  399

seq1  GCATACCATCTAAGTCTGGGGTCTTCCTCCAGCGATTTTCGGACCCTTAT  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATACCATCTAAGTCTGGGGTCTTCCTCCAGCGATTTTCGGACCCTTAT  449

seq1  GATACACAAGCAACTGCATAGGACTCAGAACAACTTGCAGGTGTTCATTC  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATACACAAGCAACTGCATAGGACTCAGAACAACTTGCAGGTGTTCATTC  499

seq1  TCTTTCTAGGAATCAAACTCAGGTCATCAGGCTTGATTACAGACAAAATG  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTCTAGGAATCAAACTCAGGTCATCAGGCTTGATTACAGACAAAATG  549

seq1  GAACCACTAATTCATTTATCTCTGACTCCTCAGAAATTAGTTTTCAGCAT  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACCACTAATTCATTTATCTCTGACTCCTCAGAAATTAGTTTTCAGCAT  599

seq1  GACAATGATGGATATTCAATTGATTTTCAAATGAATGAGGGAGAAGGAAA  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAATGATGGATATTCAATTGATTTTCAAATGAATGAGGGAGAAGGAAA  649

seq1  TGGAAAAATTAAGTGTGAGAAGACAGAAAAGATGTTGGCTACATAATAGT  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAAAAATTAAGTGTGAGAAGACAGAAAAGATGTTGGCTACATAATAGT  699

seq1  AAAAAGCCCATTACATGATTTGAGTACCAGAAAGTGATTCTTTTTTGTTT  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAGCCCATTACATGATTTGAGTACCAGAAAGTGATTCTTTTTTGTTT  749

seq1  GTTTGTTTGTGGGGTTTTTTTGTTTGTTTTGGTTTGTTTGAGACAGGTTT  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTGTTTGTGGGGTTTTTTTGTTTGTTTTGGTTTGTTTGAGACAGGTTT  799

seq1  TCTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGAAT  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGAAT  849

seq1  CTTCTCCAGTTTCTCTGAATTC  869
      ||||||||||||||||||||||
seq2  CTTCTCCAGTTTCTCTGAATTC  871

seq1: chrX_100283713_100284793
seq2: B6Ng01-327F02.g_68_1152

seq1  GAATTCTCTTTTATGCACGCTGTTTGTGGTTGAACCAAGTGTCCCTTTCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTTTTATGCACGCTGTTTGTGGTTGAACCAAGTGTCCCTTTCC  50

seq1  AACCATAAGAATCTCTTGCAAAGCAATCTGGCTGTGCCATAATAGTCGGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCATAAGAATCTCTTGCAAAGCAATCTGGCTGTGCCATAATAGTCGGA  100

seq1  GTTGAACAATTATTTCACTAAAACTAGTCCATGGAGCACCAAAGGCTGTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGAACAATTATTTCACTAAAACTAGTCCATGGAGCACCAAAGGCTGTT  150

seq1  ACAAAATAAAATTAAGTAGCATTTATGGCTAGAGAAGTGACTGAGTAGTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAATAAAATTAAGTAGCATTTATGGCTAGAGAAGTGACTGAGTAGTT  200

seq1  TCTTAGCTCCACATCCTTGCCAGCGTGAGCTGTCACTTGTGTTATTGATC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTAGCTCCACATCCTTGCCAGCGTGAGCTGTCACTTGTGTTATTGATC  250

seq1  TTAGCCATTCTGAAAGGTGAAGGAGTCTCAGGGCCCTTTTGATATGCATT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGCCATTCTGAAAGGTGAAGGAGTCTCAGGGCCCTTTTGATATGCATT  300

seq1  TCCCTCATGGTTAAATATGTTGGGCATTTCTTTAAGTGTTGCTAGGCCAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCTCATGGTTAAATATGTTGGGCATTTCTTTAAGTGTTGCTAGGCCAT  350

seq1  TTGAGATTCTTCTATTAAGATTTTCCTGTTTAGATCTGTATCCCATTTTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAGATTCTTCTATTAAGATTTTCCTGTTTAGATCTGTATCCCATTTTA  400

seq1  AAATTGAATTATTTGGTTTGATGATGTCTAGTTTCTTGAGTTCTTTCTAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTGAATTATTTGGTTTGATGATGTCTAGTTTCTTGAGTTCTTTCTAT  450

seq1  ATTTTAGATATTTGCCTTCTATTGGTTGTCGAGTTACTGGAAATCTTTTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTAGATATTTGCCTTCTATTGGTTGTCGAGTTACTGGAAATCTTTTT  500

seq1  TTATCCTGTAAGCTGATGTTTTGTCCTATTGATGGTGTCCTTTGCTTTGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATCCTGTAAGCTGATGTTTTGTCCTATTGATGGTGTCCTTTGCTTTGC  550

seq1  AGAAGCTTTTGAGTTTCATAAGGTTCCATTGATTGATTGTTGATCTTAGT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGCTTTTGAGTTTCATAAGGTTCCATTGATTGATTGTTGATCTTAGT  600

seq1  ACCTGTGTGATTTGTTTTCTGCTCAAGAAGCTGTCTGCTGTGCCAATGAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTGTGTGATTTGTTTTCTGCTCAAGAAGCTGTCTGCTGTGCCAATGAG  650

seq1  TTCAAGGCTATTCCCCCACTTTCTTTTCTATTAGATTTAGTGTATCTCGT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAAGGCTATTCCCCCACTTTCTTTTCTATTAGATTTAGTGTATCTCGT  700

seq1  TTTATGTTCAGGAGTTTGATTCACTTGTACTTGAGTTTTGTGCAGGACGA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATGTTCAGGAGTTTGATTCACTTGTACTTGAGTTTTGTGCAGGACGA  750

seq1  TAGATATATATCTACTTGCATTCTCCTATATGTCAACATCCGGTTAGATC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGATATATATCTACTTGCATTCTCCTATATGTCAACATCCGGTTAGATC  800

seq1  AGCACCATTTG-TTTGAGATGTTTTCTTTTGTCCATTGTGTATTTCTGGC  849
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  AGCACCATTTGTTTTGAGATGTTTTCTTTTGTCCATTGTGTATTTCTGGC  850

seq1  TTCTTTGTCAAAAATCAAGTGTCCGTAAGTGTGTAAATCTACTTCAGAG-  898
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  TTCTTTGTCAAAAATCAAGTGTCCGTAAGTGTGTAAATCTACTTCAGAGT  900

seq1  TTTTCAGTTTGATTCCATTGA-TTAACTTTATACTTACTGG-TTGTATGT  946
      ||||||||||||||||||||| ||||||||||||||||||| ||||||||
seq2  TTTTCAGTTTGATTCCATTGATTTAACTTTATACTTACTGGTTTGTATGT  950

seq1  CTGTTGTGGAGACAACAGATTTGTC-TGT--GCACAGAATGCA-TTTCTA  992
      ||||||||||||  ||||||||||| |||   ||||| ||||| ||||||
seq2  CTGTTGTGGAGAACACAGATTTGTCTTGTTGCCACAG-ATGCATTTTCTA  999

seq1  -GTCACAAGTCTAGAGGTTGAAAAGGCAGGGACAAGGCTCCTCAGATGGG  1041
       ||||| |||||||  | || ||||||| |||| ||  ||||||||| ||
seq2  GGTCAC-AGTCTAGGAGGTG-AAAGGCA-GGAC-AGCTTCCTCAGAT-GG  1044

seq1  CTAAATTACTGGGCATGGGACTCAAGCTCTGTCT---GAGGGT  1081
      ||||| |||| ||||||||||||| |||||||||   ||||||
seq2  CTAAA-TACT-GGCATGGGACTCAGGCTCTGTCTGGAGAGGGT  1085

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information