MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-334G09
Chromosome	X (Build37)
Map Location	130,825,005 - 130,969,067
singlet/doublet	doublet
Overlap gene	LOC100040849, Tmem35, Cenpi, Drp2
Upstream gene	LOC100040794, Pcdh19, LOC100040831, Tnmd, Tspan6, Srpx2, Sytl4, LOC665889, Cstf2, Nox1, Xkrx, Arl13a, 4732479N06Rik
Downstream gene	Taf7l, LOC669370, LOC674122, Timm8a1, Btk, Rpl36a, Gla, Hnrph2, LOC665936, LOC665941, Armcx1, LOC100040933, LOC100040520, Armcx6, Armcx3, Armcx2, LOC637800, LOC100040987, Nxf2, B930008K04Rik, EG621246, LOC100040635, Tceal6, EG621322, Pramel3, EG621352, EG331529, EG621380, EG666040
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100040794 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040794
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Pcdh19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:279653 MGI:2685563
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 29 ESTs, 182 Proteins

name	LOC100040831 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Tnmd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64103 MGI:1929885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tspan6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56496 MGI:1926264
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srpx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68792 MGI:1916042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Sytl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27359 MGI:1351606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665889 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Cstf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108062 MGI:1343054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nox1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237038 MGI:2450016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xkrx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331524 MGI:3584011
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arl13a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74448 MGI:1921698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 2 Proteins

name	4732479N06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215201 MGI:2442530
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040849 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040849
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Tmem35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67564 MGI:1914814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cenpi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102920 MGI:2147897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Drp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13497 MGI:107432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf7l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74469 MGI:1921719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669370 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669370
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC674122 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins pseudo : _no_value

name	Timm8a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30058 MGI:1353433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12229 MGI:88216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl36a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19982 MGI:1201789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gla (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11605 MGI:1347344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hnrph2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56258 MGI:1201779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	LOC665941 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 3 Proteins pseudo : _no_value

name	Armcx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78248 MGI:1925498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040933 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040933
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 4 Proteins

name	LOC100040520 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040520
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Armcx6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278097 MGI:2147993
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Armcx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71703 MGI:1918953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Armcx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67416 MGI:1914666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC637800 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637800
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	LOC100040987 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Nxf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83454 MGI:1933192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B930008K04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215693 MGI:2442284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621246 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621246 MGI:3645256
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100040635 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 6 ESTs, 5 Proteins

name	Tceal6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66104 MGI:1923939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621322 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621322 MGI:3643636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Pramel3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83565 MGI:1890657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621352 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621352 MGI:3647031
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	EG331529 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331529 MGI:3647038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621380 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621380 MGI:3648721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	EG666040 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666040 MGI:3648697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 4 Proteins

name	Pcdh19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272244 GeneID:279653 MGI:2685563
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 25 ESTs, 181 Proteins product : protocadherin 19, transcript variant 2 transcript_id : XM_205287.6

name	Pcdh19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272245 GeneID:279653 MGI:2685563
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs, 32 Proteins product : protocadherin 19, transcript variant 1 transcript_id : XM_001473606.1

name	Tnmd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981227 GeneID:64103 MGI:1929885
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tenomodulin transcript_id : NM_022322.2

name	Tspan6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490374 GeneID:56496 MGI:1926264
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 6 transcript_id : NM_019656.3

name	Srpx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140972079 GeneID:68792 MGI:1916042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sushi-repeat-containing protein, X-linked 2 transcript_id : NM_026838.2

name	Srpx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140971049 GeneID:68792 MGI:1916042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sushi-repeat-containing protein, X-linked 2 transcript_id : NM_001083895.1

name	Sytl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305098 GeneID:27359 MGI:1351606
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin-like 4 transcript_id : NM_013757.1

name	Cstf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385938 GeneID:108062 MGI:1343054
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cleavage stimulation factor, 3' pre-RNA subunit 2 transcript_id : NM_133196.4

name	Nox1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26251302 GeneID:237038 MGI:2450016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADPH oxidase 1 transcript_id : NM_172203.1

name	Xkrx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59858576 GeneID:331524 MGI:3584011
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X Kell blood group precursor related X linked transcript_id : NM_183319.2

name	Arl13a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408238 GeneID:74448 MGI:1921698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 2 Proteins product : ADP-ribosylation factor-like 13A, transcript variant 1 transcript_id : XM_136037.3

name	4732479N06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27369763 GeneID:215201 MGI:2442530
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732479N06 gene transcript_id : NM_172540.1

name	Tmem35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982652 GeneID:67564 MGI:1914814
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 35 transcript_id : NM_026239.2

name	Cenpi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130223 GeneID:102920 MGI:2147897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centromere protein I transcript_id : NM_145924.2

name	Drp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345112 GeneID:13497 MGI:107432
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dystrophin related protein 2 transcript_id : NM_010078.2

name	Taf7l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130557 GeneID:74469 MGI:1921719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_028958.3

name	Timm8a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373281 GeneID:30058 MGI:1353433
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 8 homolog a1 (yeast) transcript_id : NM_013898.2

name	Btk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7709993 GeneID:12229 MGI:88216
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bruton agammaglobulinemia tyrosine kinase transcript_id : NM_013482.1

name	Rpl36a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802220 GeneID:19982 MGI:1201789
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L36a transcript_id : NM_019865.3

name	Gla (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778923 GeneID:11605 MGI:1347344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactosidase, alpha transcript_id : NM_013463.2

name	Hnrph2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980970 GeneID:56258 MGI:1201779
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein H2 transcript_id : NM_019868.2

name	Armcx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402516 GeneID:78248 MGI:1925498
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing, X-linked 1 transcript_id : NM_030066.2

name	LOC100040933 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272270 GeneID:100040933
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 4 Proteins product : similar to Armadillo repeat containing, X-linked 6 transcript_id : XM_001475509.1

name	LOC100040520 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272253 GeneID:100040520
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100040520 transcript_id : XM_001474152.1

name	Armcx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56090482 GeneID:278097 MGI:2147993
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing, X-linked 6 transcript_id : NM_001007578.1

name	Armcx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21311832 GeneID:71703 MGI:1918953
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing, X-linked 3 transcript_id : NM_027870.1

name	Armcx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372774 GeneID:67416 MGI:1914666
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing, X-linked 2 transcript_id : NM_026139.3

name	Nxf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13752590 GeneID:83454 MGI:1933192
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear RNA export factor 2 transcript_id : NM_031259.1

name	B930008K04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185886 GeneID:215693 MGI:2442284
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B930008K04 gene transcript_id : NM_175446.3

name	LOC100040635 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272260 GeneID:100040635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 6 ESTs, 5 Proteins product : similar to AV320801 protein transcript_id : XM_001474398.1

name	Tceal6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377046 GeneID:66104 MGI:1923939
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription elongation factor A (SII)-like 6 transcript_id : NM_025355.3

name	EG621322 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83003999 GeneID:621322 MGI:3643636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG621322 transcript_id : XM_885719.1

name	Pramel3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878222 GeneID:83565 MGI:1890657
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : preferentially expressed antigen in melanoma-like 3 transcript_id : NM_031390.1

name	EG621352 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408263 GeneID:621352 MGI:3647031
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG621352 transcript_id : XM_885753.2

name	EG331529 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354224 GeneID:331529 MGI:3647038
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG331529 transcript_id : NM_183320.2

name	EG621380 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83004003 GeneID:621380 MGI:3648721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG621380 transcript_id : XM_885786.1

name	EG666040 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408265 GeneID:666040 MGI:3648697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 4 Proteins product : predicted gene, EG666040 transcript_id : XM_981153.1

name	Pcdh19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38087300 GeneID:279653 MGI:2685563
definition	codon_start : 1 product : similar to protocadherin 19 isoform 2 protein_id : XP_205287.3

name	Pcdh19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272246 GeneID:279653 MGI:2685563
definition	codon_start : 1 product : similar to protocadherin 19 isoform 1 protein_id : XP_001473656.1

name	Tnmd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11968164 CCDS:CCDS30386.1 GeneID:64103 MGI:1929885
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : myodulin; tendin product : tenomodulin protein_id : NP_071717.1

name	Tspan6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560378 CCDS:CCDS30387.1 GeneID:56496 MGI:1926264
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : tetraspan TM4SF; transmembrane 4 superfamily member 6 product : tetraspanin 6 protein_id : NP_062630.2

name	Srpx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:140971050 GeneID:68792 MGI:1916042
definition	codon_start : 1 product : sushi-repeat containing protein protein_id : NP_001077364.1

name	Srpx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703702 GeneID:68792 MGI:1916042
definition	codon_start : 1 product : sushi-repeat containing protein protein_id : NP_081114.1

name	Sytl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305099 CCDS:CCDS30388.1 GeneID:27359 MGI:1351606
definition	GO_component : GO:0019897 - extrinsic to plasma membrane [Evidence IDA]; GO:0030141 - secretory granule [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0042043 - neurexin binding [Evidence IDA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence NAS] GO_process : GO:0006887 - exocytosis [Evidence IDA] codon_start : 1 note : granuphilin; granuphilin-a; granuphilin-b product : synaptotagmin-like 4 protein_id : NP_038785.1

name	Cstf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875338 CCDS:CCDS30389.1 GeneID:108062 MGI:1343054
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 note : cleavage stimulation factor, 3' pre-RNA subunit 2, 64 kDa product : cleavage stimulation factor, 3' pre-RNA subunit 2 protein_id : NP_573459.1

name	Nox1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26251303 CCDS:CCDS30390.1 GeneID:237038 MGI:2450016
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0050660 - FAD binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016175 - superoxide-generating NADPH oxidase activity [Evidence IDA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0042554 - superoxide release [Evidence IDA] codon_start : 1 note : NADH/NADPH mitogenic oxidase subunit p65-mox; NADPH oxidase 1 alpha; GP91 phox homolog product : NADPH oxidase 1 protein_id : NP_757340.1

name	Xkrx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59858577 CCDS:CCDS30391.1 GeneID:331524 MGI:3584011
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : XK-related protein 2 product : X Kell blood group precursor related X linked protein_id : NP_899142.2

name	Arl13a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20985424 GeneID:74448 MGI:1921698
definition	codon_start : 1 product : ADP-ribosylation factor-like 13 isoform 1 protein_id : XP_136037.1

name	4732479N06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369764 GeneID:215201 MGI:2442530
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC215201 protein_id : NP_766128.1

name	Tmem35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385744 CCDS:CCDS30392.1 GeneID:67564 MGI:1914814
definition	codon_start : 1 product : transmembrane protein 35 protein_id : NP_080515.1

name	Cenpi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122337 CCDS:CCDS30393.1 GeneID:102920 MGI:2147897
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : FSH primary response 1 product : follicle-stimulating hormone primary response protein 1 protein_id : NP_666036.1

name	Drp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45383916 CCDS:CCDS30394.1 GeneID:13497 MGI:107432
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : dystrophin related protein 2 protein_id : NP_034208.1

name	Taf7l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17921978 GeneID:74469 MGI:1921719
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 note : TATA box binding protein (TBP)-associated factor, RNA polymerase II, Q; TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50 kDa product : TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_083234.1

name	Timm8a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305577 GeneID:30058 MGI:1353433
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0042719 - mitochondrial intermembrane space protein transporter complex [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0045039 - protein import into mitochondrial inner membrane [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0006626 - protein targeting to mitochondrion [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : translocase of inner mitochondrial membrane 8 homolog a protein_id : NP_038926.1

name	Btk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7709994 CCDS:CCDS30396.1 GeneID:12229 MGI:88216
definition	GO_component : GO:0031410 - cytoplasmic vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007249 - I-kappaB kinase/NF-kappaB cascade [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : Bruton's tyrosine kinase; X-linked immune deficiency product : Bruton agammaglobulinemia tyrosine kinase protein_id : NP_038510.1

name	Rpl36a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845295 GeneID:19982 MGI:1201789
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : ribosomal protein L44 product : ribosomal protein L36a protein_id : NP_063918.1

name	Gla (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778924 GeneID:11605 MGI:1347344
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004557 - alpha-galactosidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0004553 - hydrolase activity, hydrolyzing O-glycosyl compounds [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : alpha-galactosidase product : alpha-galactosidase A protein_id : NP_038491.2

name	Hnrph2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845253 CCDS:CCDS30397.1 GeneID:56258 MGI:1201779
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : heterogeneous nuclear ribonucleoprotein H' product : heterogeneous nuclear ribonucleoprotein H2 protein_id : NP_063921.1

name	Armcx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313420 CCDS:CCDS30398.1 GeneID:78248 MGI:1925498
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : armadillo repeat containing, X-linked 1 protein_id : NP_084342.1

name	LOC100040933 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272271 GeneID:100040933
definition	codon_start : 1 product : similar to Armadillo repeat containing, X-linked 6 protein_id : XP_001475559.1

name	LOC100040520 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272254 GeneID:100040520
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474202.1

name	Armcx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56090483 CCDS:CCDS30399.1 GeneID:278097 MGI:2147993
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : armadillo repeat containing, X-linked 6 protein_id : NP_001007579.1

name	Armcx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311833 CCDS:CCDS30400.1 GeneID:71703 MGI:1918953
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : armadillo repeat containing, X-linked 3 protein_id : NP_082146.1

name	Armcx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981055 CCDS:CCDS30401.1 GeneID:67416 MGI:1914666
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : armadillo repeat containing, X-linked 2 protein_id : NP_080415.2

name	Nxf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13752591 GeneID:83454 MGI:1933192
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence IDA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003729 - mRNA binding [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0016973 - poly(A)+ mRNA export from nucleus [Evidence IPI]; GO:0006405 - RNA export from nucleus [Evidence IDA] [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : nuclear RNA export factor 2 protein_id : NP_112549.1

name	B930008K04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185887 GeneID:215693 MGI:2442284
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger, matrin type 1 protein_id : NP_780655.2

name	LOC100040635 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272261 GeneID:100040635
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474448.1

name	Tceal6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981279 CCDS:CCDS30402.1 GeneID:66104 MGI:1923939
definition	codon_start : 1 note : novel protein similar to transcription elongation factor A (SII)-like 5 Tceal5 product : transcription elongation factor A (SII)-like 6 protein_id : NP_079631.2

name	EG621322 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004000 GeneID:621322 MGI:3643636
definition	codon_start : 1 product : hypothetical protein protein_id : XP_890812.1

name	Pramel3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878223 CCDS:CCDS30403.1 GeneID:83565 MGI:1890657
definition	codon_start : 1 product : preferentially expressed antigen in melanoma-like 3 protein_id : NP_113567.1

name	EG621352 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408264 GeneID:621352 MGI:3647031
definition	codon_start : 1 product : hypothetical protein protein_id : XP_890846.2

name	EG331529 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304008 GeneID:331529 MGI:3647038
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC331529 protein_id : NP_899143.1

name	EG621380 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004004 GeneID:621380 MGI:3648721
definition	codon_start : 1 product : hypothetical protein protein_id : XP_890879.1

name	LOC100040794 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040794
definition	number : 1 pseudo : _no_value

name	LOC100040794 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040794
definition	number : 2 pseudo : _no_value

name	LOC100040794 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040794
definition	number : 3 pseudo : _no_value

name	LOC100040794 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040794
definition	number : 4 pseudo : _no_value

name	LOC100040794 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040794
definition	number : 5 pseudo : _no_value

name	LOC100040831 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040831
definition	number : 2 pseudo : _no_value

name	LOC100040831 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040831
definition	number : 1 pseudo : _no_value

name	LOC665889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665889
definition	number : 1 pseudo : _no_value

name	LOC100040849 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040849
definition	number : 1 pseudo : _no_value

name	LOC669370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669370
definition	number : 1 pseudo : _no_value

name	LOC100040987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040987
definition	number : 2 pseudo : _no_value

name	LOC100040987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040987
definition	number : 1 pseudo : _no_value

name	EG621246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621246
definition	number : 3 pseudo : _no_value

name	EG621246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621246
definition	number : 2 pseudo : _no_value

name	EG621246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621246
definition	number : 1 pseudo : _no_value

name	LOC674122 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272247 GeneID:674122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins product : hypothetical LOC674122 pseudo : _no_value transcript_id : XR_031509.1

name	LOC665936 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272269 GeneID:665936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : hypothetical LOC665936 pseudo : _no_value transcript_id : XR_032258.1

name	LOC665941 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272252 GeneID:665941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 3 Proteins product : similar to 60S ribosomal protein L34 pseudo : _no_value transcript_id : XR_031574.1

name	LOC637800 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272274 GeneID:637800
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : similar to hCG2016250 pseudo : _no_value transcript_id : XR_032324.1

clone name	MSMg01-306M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317K12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-503E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436O13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-133F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260N08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-148F23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-125J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334N08
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-141C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169I19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-334G09.b	B6Ng01-334G09.g
ACC	GA119911	GA119912
length	1,099	1,145
definition	B6Ng01-334G09.b	B6Ng01-334G09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(130,967,968 - 130,969,067)	(130,825,005 - 130,826,154)
sequence	gaattctccattgacaagtgcacatcagagatggcaagctggtgggccag atcattcactaacttcaccccatctttcacaggagagaattcttctttga atagctagaacaccggaacccaagtgccacagcagacagagtagggaaga ggacacgttactcagtcaccggaactctcccctttccatgtacagggtta gtctcaacaacacttcttagctacttagccatttgtgcaataaactaagc catgtgcggccactggttttatccttttcttctattcatttcagaaaagc atagaaagaggaaacagtaagaccgaaaagactataaacaaactagcccc caatccaacccataactaaaagatgctcagctgaggcccagaccagcaac taagtctcggcagaaagaacactggcactgtgaaaggacatcaggtctca gtcagggtaggatccttaccttgatggcttggatatgctctgggagggaa tcaataaagagatctcctatgggctcccacgtggctcggactccctctgc ttgggtcaaagtactgctcaattcctccattgccccttggatctccaata gatgttccagagtatgctcaatgtggcgatgctgatctacacagcgggct gtcagcttctcccacagctcactggccactgttgcctgcttccatacaaa gcgactaaggttttgaatccgctgtctgggggaggtatctgtgaggccaa ccaggaagacaagacaagctaactcagcagaggcaactcagagaaagacc aaggcatactcctcctctttatacaatgcttgcttgtggatttggggata ttggtgtgtgtttgtatacatagattcatacttacatatacattcccatg gttgcactcctttttgcacattcagggatttaaaattccattacatttgt tatgcatttatacatactctgagaagtatgtgtgtgttcacagtgtttgt gttggaagtcaaaagaccagtgtgctcgagtgggcctactcttcaccagg tggctcctgggaatgtaattcatggtcaggtcccaaggagacacctttc	gaattccattggttgctgcagggcagacaaatgttttaaaagtgcgtttt aaacaaagttataagaaaagaaatgaggtgtagttattggaagggggaca aaaaaatcattatttgcagttgatttggttgtctattcagacaataccta gggcgaatcacttgaagtatgaatagatttaaggagagtgttcagaagag acaataagtttcctgtaagccagccacagacagtggataaagtgggtggg atgtattcatgacgatgactcaaggataaaatccctaataatattatttc tagtctcagctagatgtggtgttgtaagcttttaggtacagctaatgggg agaatgcgacaggaggatcatttgagccccaaagttccttgctatgctgg gcaatacagtgagatctcaccttaaagagtaaatgggttctctgttaaga ctttccatctctgtgataaaacgtgtggcaacgaacaatttatataggag gagggacttacattggctcgtagtttcagcccatgtccagctggttccac tgtcgtgagtgtgatggagaagctaaacattatggtaagagcatacaata aaacacgtagctcccccacccccagtgtggaaaggaagctcagacaaact ggaaggaaccacagcaacatctagactcggcaaggacatttcttctgtga cctactttctctaattgggccctacttctcaaagcttccatcacctccca aaataagcccaccagttgcaaaccaagcttctaacacaagagcttgtgag ggacttttcatgtttaaaaaacaaactaacagcaccatatgaagaaaaca agggtgctgggcataaagcttagttgttggatagaatactgacctatcat ggacaaaaccctgcatttgaccaacctcactgcataaatccttgatcatt tctgagtacagacctacctggaaaaaaagatactatctccagattgtaag tggcaggtgggaacctgtcctactgggacagctggaaaccccaatgccat tggagttgtactctactagagtaacctctggtacttagctgccatgatga ggttgactgtgacagaaatccagtggttcagacccagcattgctt
quality values	Open. Hide. 49 36 28 25 58 58 54 58 39 23 46 62 62 39 52 26 47 54 54 54 62 56 62 54 54 47 47 62 62 51 38 37 49 25 32 41 25 43 56 62 62 62 62 62 62 59 62 59 59 62 59 59 46 62 62 62 59 62 62 62 62 62 62 62 62 54 59 62 62 62 62 59 62 62 62 62 62 59 62 62 59 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 56 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 49 56 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 54 45 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 58 58 58 58 58 54 54 52 52 58 58 58 54 58 54 58 58 54 58 53 54 58 54 58 52 58 54 54 54 50 54 58 58 54 58 58 58 58 58 58 58 54 43 58 54 52 54 31 58 54 58 52 49 39 54 35 58 58 41 35 52 58 29 54 49 39 54 42 58 52 50 54 47 58 52 54 54 41 47 52 39 54 54 58 58 42 42 54 52 52 52 42 50 49 51 51 58 58 51 40 53 53 39 52 52 53 53 51 58 54 52 53 58 50 39 46 52 50 48 54 33 41 46 50 58 47 35 41 50 48 46 58 37 52 41 31 52 52 58 50 48 48 50 52 26 53 46 52 23 58 52 50 50 35 34 33 45 53 51 12 28 17 38 58 58 41 46 50 40 53 58 36 49 53 53 34 53 46 51 58 58 58 30 46 21 36 18 50 39 53 53 51 27 51 41 26 39 10 37 22 50 23 50 35 24 32 53 50 40 33 15 18 49 50 39 29 32 49 42 41 37 29 34 39 53 42 34 31 35 30 18 39 8 31 24 35 42 39 53 39 30 17 53 30 46 54 29 32 35 13 40 30 32 26 25 18 24 41 28 33 42 35 53 29 28 40 40 52 31 54 53 28 24 26 37 22 34 40 45 32 33 44 31 24 42 42 32 21 53 28 31 14 54 45 34 49 49 32 28 10 32 23 25 29 31 34 41 26 53 32 41 23 52 42 37 19 35 31 27 36 20 35 39 31 52 24 39 34 31 25 34 31 33 37 26 35 21 31 28 29 31 42 16 9 9 6 51 24 11 26 51 51 26 26 24 19 22 31 31 29 29 8 51 46 46 46 16 28 11 29 20 35 30 30 12 28 46 30 31 27 46 35 31 46 46 11 22 33 37 26 20 30 32 22 31 15 33 25 29 32 41 46 20 26 21 26 11 33 48 26 23 24 19 37 13 34 21 37 31 41 19 33 31 8 6 19 12 9 19 11 27 23 31 22 37 20 25 11 11 19 5 6 7 18 19 29 6 32 31 27 9 11 6 10 27 19 24 33 16 25 21 38 41 43 6 15 21 8 9 12 9 6 25 8 9 12 16 22 5 10 11 25 8 32 9 16 6 16 6 9 18 11 14 13 15 9 5 7 10 25 10 5 27 20 13 9 21 5 7 18 32 21 8 11 11 11 5 5 11 12 11 6 10 23 21 9 12 17 6 8 8 4 15 23 9 21 13 7 6 9 5 6 5 3 5 21 28 40 17 23	Open. Hide. 62 59 51 44 62 62 46 30 62 59 62 43 34 48 54 29 48 59 62 59 59 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 54 62 62 62 62 59 59 59 54 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 54 54 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 58 54 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 42 58 58 54 54 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 52 58 58 54 54 42 54 54 58 58 52 58 58 58 58 58 42 58 58 58 58 58 43 58 54 54 42 54 58 58 54 58 51 58 58 58 52 53 58 51 58 46 42 58 58 58 50 58 58 50 58 58 52 58 58 54 52 54 58 51 53 58 45 46 58 58 49 58 52 51 49 49 53 52 50 58 51 58 58 58 58 51 52 54 54 51 58 50 58 51 33 58 58 58 58 41 41 58 58 58 49 52 49 53 58 52 58 52 51 58 43 46 51 46 58 39 49 53 42 52 25 51 40 32 39 24 50 50 58 43 41 47 30 54 51 50 32 49 53 52 39 50 50 52 39 51 29 51 52 52 50 42 46 33 52 52 31 53 34 53 39 52 54 32 26 21 51 49 54 52 53 52 49 49 49 37 49 39 27 49 52 40 42 37 49 27 41 45 52 42 30 30 30 51 53 53 50 25 33 44 37 32 37 46 46 42 47 31 22 54 40 32 40 37 29 26 42 32 52 37 42 52 47 53 32 54 33 26 54 54 30 33 37 47 32 41 54 31 31 29 28 31 29 33 31 31 24 32 53 53 31 39 28 52 32 36 40 53 45 32 24 45 32 31 40 35 52 32 39 18 41 32 53 53 31 32 45 25 49 36 24 23 33 49 49 16 30 31 31 45 31 51 45 39 51 45 51 40 28 31 37 51 14 28 33 24 30 31 19 30 36 29 29 33 11 33 34 42 35 37 42 30 45 51 51 30 24 31 10 26 46 29 30 31 28 33 36 46 31 25 23 34 19 46 31 24 25 34 25 31 17 42 32 35 13 29 20 32 19 15 29 24 37 31 28 28 32 38 37 12 9 28 38 32 30 31 23 30 36 25 14 19 29 46 46 28 25 46 31 25 32 32 18 25 48 41 21 31 25 26 25 25 32 25 36 31 24 29 31 30 21 33 27 31 46 20 38 26 30 22 20 29 21 21 32 21 33 44 26 13 9 14 31 9 10 14 30 21 20 25 6 31 32 32 24 22 33 23 17 24 44 41 41 28 38 24 10 19 13 27 8 20 26 32 31 32 20 27 11 12 11 5 15 14 9 18 21 20 14 21 33 12 6 10 16 17 25 48 30 15 21 14 18 27 31 24 24 27 24 27 20 15 24 48 25 10 15 9 11 11 5 13 8 4 22 8 28 38 38 26 10 14 20 27 11 18 10 28 14 21 19 20 10 24 8 11 15 29 21 11 13 26 20 28 27 28 12 24 18 20 26 11 25 21 24 27 19 24 22 8 21 23 19 17 12 17 8 13 11 7 15 17 13 20 27 9 10 11 5 3 4 9 4 2 3 4 14 7 4 2 3 11 5 4 5 3 4 5 12 7 4 4 6 11 8 21 13 6 4 5 7 25 10 10 4 10 4 11 6 9 15 8 23

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_130967968_130969067
seq2: B6Ng01-334G09.b_47_1145 (reverse)

seq1  GAAAGGTGTCTACCTTGGACCCTGA-CATGAATTACATCCCAGGGAGCCA  49
      ||||||||||| ||||||  ||||| |||||||||||| ||  |||||||
seq2  GAAAGGTGTCT-CCTTGGGACCTGACCATGAATTACATTCCCAGGAGCCA  49

seq1  CCTTGTAGAAAGAGAGGGCCAACTCGAGCACACT-GTCTTTTGACTTCC-  97
      ||| ||   |||||  |||| ||||||||||||| |||||||||||||| 
seq2  CCTGGT--GAAGAGTAGGCCCACTCGAGCACACTGGTCTTTTGACTTCCA  97

seq1  ACACAAACACTGTGGAACACACACATAC-TCTCAGAGTATGTATAAATGC  146
      ||||||||||||| |||||||||||||| |||||||||||||||||||||
seq2  ACACAAACACTGT-GAACACACACATACTTCTCAGAGTATGTATAAATGC  146

seq1  ATAAACAAATGTAATGGAATTTTAAATCCCTGAATGTGCAAAAAGGAGTG  196
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  AT-AACAAATGTAATGGAATTTTAAATCCCTGAATGTGCAAAAAGGAGTG  195

seq1  CAACCATGGAAATGTATATGTAAGTATGAATCTATGTATACAAACACACA  246
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  CAACCATGGGAATGTATATGTAAGTATGAATCTATGTATACAAACACACA  245

seq1  CCAATATCCCCAAATCCACAAGCAAGCATTGTATAAAGAGGAGGAGTATG  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAATATCCCCAAATCCACAAGCAAGCATTGTATAAAGAGGAGGAGTATG  295

seq1  CCTTGGTCTTTCTCTGAGTTGCCTCTGCTGAGTTAGCTTGTCTTGTCTTC  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTGGTCTTTCTCTGAGTTGCCTCTGCTGAGTTAGCTTGTCTTGTCTTC  345

seq1  CTGGTTGGCCTCACAGATACCTCCCCCAGACAGCGGATTCAAAACCTTAG  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTTGGCCTCACAGATACCTCCCCCAGACAGCGGATTCAAAACCTTAG  395

seq1  TCGCTTTGTATGGAAGCAGGCAACAGTGGCCAGTGAGCTGTGGGAGAAGC  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGCTTTGTATGGAAGCAGGCAACAGTGGCCAGTGAGCTGTGGGAGAAGC  445

seq1  TGACAGCCCGCTGTGTAGATCAGCATCGCCACATTGAGCATACTCTGGAA  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACAGCCCGCTGTGTAGATCAGCATCGCCACATTGAGCATACTCTGGAA  495

seq1  CATCTATTGGAGATCCAAGGGGCAATGGAGGAATTGAGCAGTACTTTGAC  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTATTGGAGATCCAAGGGGCAATGGAGGAATTGAGCAGTACTTTGAC  545

seq1  CCAAGCAGAGGGAGTCCGAGCCACGTGGGAGCCCATAGGAGATCTCTTTA  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAGCAGAGGGAGTCCGAGCCACGTGGGAGCCCATAGGAGATCTCTTTA  595

seq1  TTGATTCCCTCCCAGAGCATATCCAAGCCATCAAGGTAAGGATCCTACCC  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGATTCCCTCCCAGAGCATATCCAAGCCATCAAGGTAAGGATCCTACCC  645

seq1  TGACTGAGACCTGATGTCCTTTCACAGTGCCAGTGTTCTTTCTGCCGAGA  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTGAGACCTGATGTCCTTTCACAGTGCCAGTGTTCTTTCTGCCGAGA  695

seq1  CTTAGTTGCTGGTCTGGGCCTCAGCTGAGCATCTTTTAGTTATGGGTTGG  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGTTGCTGGTCTGGGCCTCAGCTGAGCATCTTTTAGTTATGGGTTGG  745

seq1  ATTGGGGGCTAGTTTGTTTATAGTCTTTTCGGTCTTACTGTTTCCTCTTT  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGGGGGCTAGTTTGTTTATAGTCTTTTCGGTCTTACTGTTTCCTCTTT  795

seq1  CTATGCTTTTCTGAAATGAATAGAAGAAAAGGATAAAACCAGTGGCCGCA  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATGCTTTTCTGAAATGAATAGAAGAAAAGGATAAAACCAGTGGCCGCA  845

seq1  CATGGCTTAGTTTATTGCACAAATGGCTAAGTAGCTAAGAAGTGTTGTTG  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGCTTAGTTTATTGCACAAATGGCTAAGTAGCTAAGAAGTGTTGTTG  895

seq1  AGACTAACCCTGTACATGGAAAGGGGAGAGTTCCGGTGACTGAGTAACGT  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACTAACCCTGTACATGGAAAGGGGAGAGTTCCGGTGACTGAGTAACGT  945

seq1  GTCCTCTTCCCTACTCTGTCTGCTGTGGCACTTGGGTTCCGGTGTTCTAG  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCTCTTCCCTACTCTGTCTGCTGTGGCACTTGGGTTCCGGTGTTCTAG  995

seq1  CTATTCAAAGAAGAATTCTCTCCTGTGAAAGATGGGGTGAAGTTAGTGAA  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATTCAAAGAAGAATTCTCTCCTGTGAAAGATGGGGTGAAGTTAGTGAA  1045

seq1  TGATCTGGCCCACCAGCTTGCCATCTCTGATGTGCACTTGTCAATGGAGA  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATCTGGCCCACCAGCTTGCCATCTCTGATGTGCACTTGTCAATGGAGA  1095

seq1  ATTC  1100
      ||||
seq2  ATTC  1099

seq1: chrX_130825005_130826154
seq2: B6Ng01-334G09.g_67_1211

seq1  GAATTCCATTGGTTGCTGCAGGGCAGACAAATGTTTTAAAAGTGCGTTTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCATTGGTTGCTGCAGGGCAGACAAATGTTTTAAAAGTGCGTTTT  50

seq1  AAACAAAGTTATAAGAAAAGAAATGAGGTGTAGTTATTGGAAGGGGGACA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAAAGTTATAAGAAAAGAAATGAGGTGTAGTTATTGGAAGGGGGACA  100

seq1  AAAAAATCATTATTTGCAGTTGATTTGGTTGTCTATTCAGACAATACCTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAATCATTATTTGCAGTTGATTTGGTTGTCTATTCAGACAATACCTA  150

seq1  GGGCGAATCACTTGAAGTATGAATAGATTTAAGGAGAGTGTTCAGAAGAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCGAATCACTTGAAGTATGAATAGATTTAAGGAGAGTGTTCAGAAGAG  200

seq1  ACAATAAGTTTCCTGTAAGCCAGCCACAGACAGTGGATAAAGTGGGTGGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAATAAGTTTCCTGTAAGCCAGCCACAGACAGTGGATAAAGTGGGTGGG  250

seq1  ATGTATTCATGACGATGACTCAAGGATAAAATCCCTAATAATATTATTTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTATTCATGACGATGACTCAAGGATAAAATCCCTAATAATATTATTTC  300

seq1  TAGTCTCAGCTAGATGTGGTGTTGTAAGCTTTTAGGTACAGCTAATGGGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTCTCAGCTAGATGTGGTGTTGTAAGCTTTTAGGTACAGCTAATGGGG  350

seq1  AGAATGCGACAGGAGGATCATTTGAGCCCCAAAGTTCCTTGCTATGCTGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAATGCGACAGGAGGATCATTTGAGCCCCAAAGTTCCTTGCTATGCTGG  400

seq1  GCAATACAGTGAGATCTCACCTTAAAGAGTAAATGGGTTCTCTGTTAAGA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAATACAGTGAGATCTCACCTTAAAGAGTAAATGGGTTCTCTGTTAAGA  450

seq1  CTTTCCATCTCTGTGATAAAACGTGTGGCAACGAACAATTTATATAGGAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCCATCTCTGTGATAAAACGTGTGGCAACGAACAATTTATATAGGAG  500

seq1  GAGGGACTTACATTGGCTCGTAGTTTCAGCCCATGTCCAGCTGGTTCCAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGGACTTACATTGGCTCGTAGTTTCAGCCCATGTCCAGCTGGTTCCAC  550

seq1  TGTCGTGAGTGTGATGGAGAAGCTAAACATTATGGTAAGAGCATACAATA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCGTGAGTGTGATGGAGAAGCTAAACATTATGGTAAGAGCATACAATA  600

seq1  AAACACGTAGCTCCCCCACCCCCAGTGTGGAAAGGAAGCTCAGACAAACT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACACGTAGCTCCCCCACCCCCAGTGTGGAAAGGAAGCTCAGACAAACT  650

seq1  GGAAGGAACCACAGCAACATCTAGACTCGGCAAGGACATTTCTTCTGTGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGGAACCACAGCAACATCTAGACTCGGCAAGGACATTTCTTCTGTGA  700

seq1  CCTACTTTCTCTAATTGGGCCCTACTTCTCAAAGCTTCCATCACCTCCCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTACTTTCTCTAATTGGGCCCTACTTCTCAAAGCTTCCATCACCTCCCA  750

seq1  AAATAAGCCCACCAGTTGCAAACCAAGCTTCTAACACAAGAGCTTGTGAG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAAGCCCACCAGTTGCAAACCAAGCTTCTAACACAAGAGCTTGTGAG  800

seq1  GGACTTTTCATGTTTAAAAAACAAACTAACAGCACCATATGAAGAAAACA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACTTTTCATGTTTAAAAAACAAACTAACAGCACCATATGAAGAAAACA  850

seq1  AGGGTGCTGGGCATAAAGCTTAGTTGTTGGATAGAATACTGACCTATCAT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGTGCTGGGCATAAAGCTTAGTTGTTGGATAGAATACTGACCTATCAT  900

seq1  GGACAAAACCCTGCATTTGACCAACCTCACTGCATAAATCCTTGATCATT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACAAAACCCTGCATTTGACCAACCTCACTGCATAAATCCTTGATCATT  950

seq1  TCTGAGTACAGACCTACCTGGAAAAAAAAGATAACTATCTCCAGAATGTA  1000
      ||||||||||||||||||||| |||||||||| |||||||||||| ||||
seq2  TCTGAGTACAGACCTACCTGG-AAAAAAAGAT-ACTATCTCCAGATTGTA  998

seq1  AGTGGCAGGGTGGGAACCTGTCCTACTGGGACAGCCTGGAAACCCCAATG  1050
      ||||||| |||||||||||||||||||||||||| |||||||||||||||
seq2  AGTGGCA-GGTGGGAACCTGTCCTACTGGGACAG-CTGGAAACCCCAATG  1046

seq1  CCATTGGAGTTGTAACTCTACTAGAGTAACCTCTGGTACTTAGGCTGCCA  1100
      ||||||||||||| |||||||||||||||||||||||||||| |||||||
seq2  CCATTGGAGTTGT-ACTCTACTAGAGTAACCTCTGGTACTTA-GCTGCCA  1094

seq1  TGATGAAGTTGGCCTGTGACAG-TATCCAGT-GTTCAGGACCCAGCA-TG  1147
      |||||| ||| | |||||||||  ||||||| ||||| ||||||||| ||
seq2  TGATGAGGTT-GACTGTGACAGAAATCCAGTGGTTCA-GACCCAGCATTG  1142

seq1  CTT  1150
      |||
seq2  CTT  1145

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information