MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-338O07
Chromosome	X (Build37)
Map Location	29,093,190 - 29,094,383
singlet/doublet	singlet
Overlap gene	none
Upstream gene	EG664923, LOC100039364, LOC100039377, LOC100039386, LOC100039127, EG664944, LOC100039423, LOC100039145, LOC664951, LOC100042071, LOC664958, LOC664964, LOC100042087, LOC100039171, LOC100042103
Downstream gene	LOC100042109, LOC100042115, LOC100042122, LOC100042135, LOC100042144, LOC664982, LOC100039212, EG664989, LOC664996, LOC100039467, LOC100039481
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG664923 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664923 MGI:3647245
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC100039364 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 58 ESTs

name	LOC100039377 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 16 ESTs, 5 Proteins

name	LOC100039386 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 65 ESTs

name	LOC100039127 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	EG664944 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664944 MGI:3647748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC100039423 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	LOC100039145 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins

name	LOC664951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 1 Protein pseudo : _no_value

name	LOC100042071 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 93 ESTs, 1 Protein

name	LOC664958 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins pseudo : _no_value

name	LOC664964 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 58 ESTs

name	LOC100042087 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042087
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC100039171 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100042103 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 65 ESTs

name	LOC100042109 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 16 ESTs, 5 Proteins

name	LOC100042115 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042115
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 ESTs

name	LOC100042122 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC100042135 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 65 ESTs

name	LOC100042144 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 16 ESTs, 5 Proteins

name	LOC664982 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 66 ESTs

name	LOC100039212 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039212
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG664989 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664989 MGI:3646492
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC664996 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs

name	LOC100039467 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 5 Proteins

name	LOC100039481 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 69 ESTs

name	LOC100039364 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271375 GeneID:100039364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 58 ESTs product : hypothetical protein LOC100039364 transcript_id : XM_001472934.1

name	LOC100039377 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271379 GeneID:100039377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : similar to XMR, transcript variant 2 transcript_id : XM_001472983.1

name	LOC100039377 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271377 GeneID:100039377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : similar to XMR, transcript variant 1 transcript_id : XM_001472953.1

name	LOC100039386 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271383 GeneID:100039386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 64 ESTs product : hypothetical protein LOC100039386, transcript variant 1 transcript_id : XM_001473010.1

name	LOC100039386 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271381 GeneID:100039386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 64 ESTs product : hypothetical protein LOC100039386, transcript variant 2 transcript_id : XM_001473034.1

name	LOC100039127 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271362 GeneID:100039127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : similar to pol protein transcript_id : XM_001472318.1

name	LOC100039423 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271386 GeneID:100039423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100039423 transcript_id : XM_001473070.1

name	LOC100039145 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271388 GeneID:100039145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins product : similar to Xlr-related, meiosis regulated transcript_id : XM_001472346.1

name	LOC100042071 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271393 GeneID:100042071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 93 ESTs, 1 Protein product : similar to RIKEN cDNA 1810037I17 gene transcript_id : XM_001477220.1

name	LOC664964 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271395 GeneID:664964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 58 ESTs product : hypothetical LOC664964 transcript_id : XM_973681.2

name	LOC100039171 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271390 GeneID:100039171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to pol protein transcript_id : XM_001472388.1

name	LOC100042103 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271399 GeneID:100042103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 64 ESTs product : hypothetical protein LOC100042103, transcript variant 1 transcript_id : XM_001477265.1

name	LOC100042103 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271397 GeneID:100042103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 64 ESTs product : hypothetical protein LOC100042103, transcript variant 2 transcript_id : XM_001477280.1

name	LOC100042109 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271403 GeneID:100042109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : similar to Sycp3 like X-linked, transcript variant 2 transcript_id : XM_001477327.1

name	LOC100042109 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271401 GeneID:100042109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : similar to Sycp3 like X-linked, transcript variant 1 transcript_id : XM_001477305.1

name	LOC100042115 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271405 GeneID:100042115
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 ESTs product : hypothetical protein LOC100042115 transcript_id : XM_001477343.1

name	LOC100042135 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271410 GeneID:100042135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 60 ESTs product : hypothetical protein LOC100042135, transcript variant 1 transcript_id : XM_001477363.1

name	LOC100042135 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271408 GeneID:100042135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : hypothetical protein LOC100042135, transcript variant 2 transcript_id : XM_001477384.1

name	LOC100042144 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271414 GeneID:100042144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : similar to XMR, transcript variant 2 transcript_id : XM_001477423.1

name	LOC100042144 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271412 GeneID:100042144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : similar to XMR, transcript variant 1 transcript_id : XM_001477404.1

name	LOC664982 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271416 GeneID:664982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 66 ESTs product : hypothetical LOC664982 transcript_id : XM_973856.2

name	LOC100039212 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271417 GeneID:100039212
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to pol protein transcript_id : XM_001472463.1

name	LOC664996 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271422 GeneID:664996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs product : hypothetical protein LOC664996 transcript_id : XM_973930.2

name	LOC100039467 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271425 GeneID:100039467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 14 ESTs, 5 Proteins product : similar to XMR, transcript variant 2 transcript_id : XM_001473144.1

name	LOC100039467 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271423 GeneID:100039467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs, 5 Proteins product : similar to XMR, transcript variant 1 transcript_id : XM_001473126.1

name	LOC100039481 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271429 GeneID:100039481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 64 ESTs product : hypothetical protein LOC100039481, transcript variant 1 transcript_id : XM_001473156.1

name	LOC100039481 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271427 GeneID:100039481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : hypothetical protein LOC100039481, transcript variant 2 transcript_id : XM_001473178.1

name	LOC100039364 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271376 GeneID:100039364
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472984.1

name	LOC100039377 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271378 GeneID:100039377
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001473003.1

name	LOC100039377 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271380 GeneID:100039377
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001473033.1

name	LOC100039386 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271382 GeneID:100039386
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001473084.1

name	LOC100039386 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271384 GeneID:100039386
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001473060.1

name	LOC100039127 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271363 GeneID:100039127
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472368.1

name	LOC100039423 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271387 GeneID:100039423
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473120.1

name	LOC100039145 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271389 GeneID:100039145
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472396.1

name	LOC100042071 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271394 GeneID:100042071
definition	codon_start : 1 product : similar to RIKEN cDNA 1810037I17 gene protein_id : XP_001477270.1

name	LOC664964 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407253 GeneID:664964
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978775.1

name	LOC100039171 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271391 GeneID:100039171
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472438.1

name	LOC100042103 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271398 GeneID:100042103
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001477330.1

name	LOC100042103 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271400 GeneID:100042103
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001477315.1

name	LOC100042109 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271402 GeneID:100042109
definition	codon_start : 1 product : similar to Sycp3 like X-linked isoform 1 protein_id : XP_001477355.1

name	LOC100042109 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271404 GeneID:100042109
definition	codon_start : 1 product : similar to Sycp3 like X-linked isoform 2 protein_id : XP_001477377.1

name	LOC100042115 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271406 GeneID:100042115
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477393.1

name	LOC100042135 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271409 GeneID:100042135
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001477434.1

name	LOC100042135 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271411 GeneID:100042135
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001477413.1

name	LOC100042144 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271413 GeneID:100042144
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001477454.1

name	LOC100042144 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271415 GeneID:100042144
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001477473.1

name	LOC664982 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407259 GeneID:664982
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978950.1

name	LOC100039212 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271418 GeneID:100039212
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472513.1

name	LOC664996 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407262 GeneID:664996
definition	codon_start : 1 product : hypothetical protein protein_id : XP_979024.1

name	LOC100039467 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271424 GeneID:100039467
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001473176.1

name	LOC100039467 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271426 GeneID:100039467
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001473194.1

name	LOC100039481 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271428 GeneID:100039481
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001473228.1

name	LOC100039481 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271430 GeneID:100039481
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001473206.1

name	LOC664958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664958
definition	number : 9 pseudo : _no_value

name	LOC664958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664958
definition	number : 8 pseudo : _no_value

name	LOC664958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664958
definition	number : 7 pseudo : _no_value

name	LOC664958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664958
definition	number : 6 pseudo : _no_value

name	LOC664958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664958
definition	number : 5 pseudo : _no_value

name	LOC664958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664958
definition	number : 4 pseudo : _no_value

name	LOC664958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664958
definition	number : 3 pseudo : _no_value

name	LOC664958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664958
definition	number : 2 pseudo : _no_value

name	LOC664958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664958
definition	number : 1 pseudo : _no_value

name	EG664923 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271374 GeneID:664923 MGI:3647245
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : predicted gene, EG664923 pseudo : _no_value transcript_id : XR_035656.1

name	EG664944 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271385 GeneID:664944 MGI:3647748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : predicted gene, EG664944 pseudo : _no_value transcript_id : XR_035657.1

name	LOC664951 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271392 GeneID:664951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 1 Protein product : hypothetical LOC664951 pseudo : _no_value transcript_id : XR_033120.1

name	LOC100042087 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271396 GeneID:100042087
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : similar to XMR pseudo : _no_value transcript_id : XR_033154.1

name	LOC100042122 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271407 GeneID:100042122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : similar to XMR pseudo : _no_value transcript_id : XR_033191.1

name	EG664989 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271421 GeneID:664989 MGI:3646492
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : predicted gene, EG664989 pseudo : _no_value transcript_id : XR_035658.1

clone name	MSMg01-195O18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-055B17
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-179K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036N12
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-338O07.b	B6Ng01-338O07.g
ACC	GA123047	GA123048
length	1,203	964
definition	B6Ng01-338O07.b	B6Ng01-338O07.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcctcagtacctggttgccagtggcagcttagaactggtatatacc accttgtttgatgtcaggaagtagcaaggccatcaaaatatttaagaggg catgaataactatgtacagaatcttcttctctgatggcaggatggatctt tgatgtaaaaattgttgcagctgaaagcatacttctcataaataacagca gaaaaatttggataactgatatcagtagagattctataggcagttggaga cgcttatatttatgttgccccataagttagcagagattattgtgatcact gctgcttgaggcctgaaatgtcatgaatataaaaatggtatcttttgtca ttatgtgtcctcagtgtaacagaatatgaaactgaacatgacatggagga acagtatgacctaaattttcaccttatgttcagatggtctcatagatcct ggacattaacaatctcatcagaagcatcatggactgtgggtttaatcaag gccactgatggcagcataatggatatcatcatattttctgtaggcacttt gagtgagtgacattaatatagttctcagtggtagcagagatcactaatga caaggtggccaatgacagcaagtaacaaaggccataccatggaatctatt gccatttatatgtcaatggcattagcatagattaaaagggaagaaaaatt atgatcataaacctcttatcaggtggcaatatttatcttgacagcgcaat tccaggggcagtaacaaccatgtacattacatggttgatagcaggcagga agatcaacagaatttcttatggaagatagaatctcagacatcaatctgat ctactgtgtcacctcagaacacttacctcaatatgacctctaccattaac atgaaccttgtaagtcagaacgttctcaaacgacaggagagatcatgggc catcaccaggtttttcatcagcaatagaaaattaaatggactccatcatt attgctggtcacaagcatgcagcactcacatcaggtatttttcaggtttc agttaggattacaaggcatcaaaatagtcttccagttacagcggaacagc accttacctcattatgaacttaggcagcatattaccatggaacttacaac aggaattctttatggttgatttatcatagacactcaatgtagcctttcca tga	gaattctttgtttagctctgagccccatttttaatggtgttatttgctgg atacttcaatgcatcttagaagctgggaacaaaagagcgatggaagtagt tacagagacaaaatgtggactggagactgaagaaattaccatccagagac tgatttacctggggatccatctgtgatggtttgtatattcttggaccagg gagtggcaccatttggaggtgtggccttgttggaataggtgtgacctggt tggagtaggtgtgtcactatggttttgggcataagatcctcaccttagtt tcctggaagtcagtcttccactagtagcctttggatgaagatgtagaact ctcagctcctcctgcaccatgcctgcctgaatgctgccatgctcccacct ttatggtaatgaattgaacctctgaatctataagccagccccaattaaat gttggttttttataagacttgccttggtcatggtttatgttcacagccat aaaaccctaactaatataccatctcgtatacaatcaccaaacccagacac tgttgtggatgccaacaactgcttactgacaggagcctgatatagctctc tcctgacaggctctgccagaaaactaacaaatacataagtggatcctcac agccatgcacatagggtccccattaaagaacttagagaaaggacctaagg agctgaagagtttgatgacccataagaggaacaacaaaatgaactagcca gtactcccagagctcccaggcactaaaccaccaaccaaagagcacatatg gtgggattcgtggttccagctgcatatacagaacaggatggcctagttag acatcaatgtgcagagaggccctttgtcctatgaatgttctatgactcaa tgtgggggaatgccagggccaggaagctggagtggctgggttgataagga agggagggaggaaa
quality values	Open. Hide. 58 31 18 26 58 58 62 54 41 39 54 62 62 62 62 54 62 62 37 62 49 62 47 32 62 62 62 51 51 43 32 43 59 62 59 45 62 59 62 62 62 62 62 59 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 59 59 59 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 54 52 58 54 58 58 58 54 58 58 58 58 54 54 58 58 58 54 58 58 58 49 54 54 58 58 58 58 58 58 58 54 54 58 58 58 58 58 54 58 58 54 52 58 53 58 58 58 58 50 46 48 58 52 58 54 54 58 54 58 58 51 40 58 58 58 51 58 58 49 47 49 58 51 58 42 50 40 51 58 54 58 58 53 51 51 52 40 58 58 47 51 33 54 50 54 49 58 58 50 53 58 58 58 49 49 58 58 54 47 58 58 41 39 46 46 58 50 50 53 53 51 46 47 49 50 54 51 58 38 52 42 53 47 49 53 58 34 49 52 53 39 31 58 50 58 41 38 25 58 52 58 58 52 58 58 49 38 30 40 53 50 39 54 49 39 53 38 51 52 58 50 51 53 53 53 38 58 40 50 40 35 22 46 45 51 49 37 35 35 53 39 39 49 52 52 35 44 51 51 51 42 39 41 47 50 52 35 39 37 35 45 45 53 32 37 54 54 44 40 49 32 40 45 28 37 40 33 54 40 32 42 51 45 32 52 31 52 52 33 40 31 34 51 35 32 44 42 31 26 39 27 41 39 40 53 24 35 35 52 34 46 29 32 32 39 35 36 45 35 31 46 34 31 53 53 42 27 32 34 31 43 41 29 33 24 28 18 52 34 53 29 22 32 42 35 32 22 42 18 13 33 31 33 21 30 35 33 32 32 25 31 31 32 30 34 51 24 43 27 33 26 31 32 32 33 31 17 42 33 27 25 31 33 45 25 31 37 31 36 31 29 30 31 31 33 36 22 32 30 42 31 31 26 29 30 31 42 31 27 30 24 30 31 29 25 19 28 30 31 42 30 30 33 29 34 35 31 7 31 27 22 21 19 32 30 31 33 25 48 24 31 11 38 24 32 25 25 29 15 39 23 20 21 30 27 30 14 46 20 24 26 14 38 32 33 36 29 20 24 26 31 48 48 48 37 25 17 29 32 33 22 32 19 18 32 33 13 44 44 44 35 8 16 30 44 22 31 24 25 23 24 22 21 38 24 22 27 11 25 11 25 28 23 20 24 32 19 29 14 31 10 19 7 7 7 32 27 22 33 23 19 23 27 27 18 32 24 9 23 22 32 16 18 14 28 7 4 6 37 43 33 15 17 16 20 17 19 47 19 16 10 19 16 16 13 15 8 28 9 11 10 7 8 8 27 23 13 13 20 7 17 40 38 10 11 19 9 10 7 4 4 6 28 18 13 10 11 13 6 6 13 7 5 8 28 20 20 17 18 14 10 8 9 18 23 20 28 24 24 16 5 3 4 6 7 7 11 11 15 11 17 12 9 20 16 20 20 15 19 7 17 14 12 5 11 14 11 8 22 16 9 16 7 14 16 4 1 6 9 13 16 6 4 4 11 20 10 15 9 21 10 16 10 19 17 4 5 6 18 6 16 11 7 8 21 4 6 5 4 6 10 6 4 15 6 3 1 4 6 9 7 5 5 6 14 25 17 4 7 4 1 2 4	Open. Hide. 62 59 44 44 62 62 62 43 43 50 28 45 43 23 23 36 56 62 62 62 59 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 59 62 62 59 62 62 62 62 59 59 59 54 54 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 54 59 59 62 62 62 59 59 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 49 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 49 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 58 58 58 58 58 58 58 58 58 58 54 58 58 58 54 54 58 58 58 58 58 58 58 58 58 58 47 58 58 58 54 58 45 54 58 58 58 58 58 54 58 58 58 54 58 58 58 58 54 58 54 58 58 58 42 54 54 58 50 58 58 52 58 58 58 58 58 58 58 52 49 58 58 58 58 51 42 58 58 39 58 58 58 58 46 52 53 53 49 50 49 58 52 58 53 58 51 58 54 58 51 49 50 41 58 47 58 53 53 58 58 51 53 50 58 31 49 50 40 53 53 58 52 50 58 58 51 50 51 52 53 41 58 49 58 58 54 47 34 48 51 53 51 52 52 52 53 51 41 39 51 52 51 41 53 52 51 52 38 58 54 40 50 49 49 44 41 41 41 50 58 51 39 51 50 40 51 50 50 33 58 32 53 54 40 40 54 35 27 44 51 37 53 39 54 53 32 52 54 40 54 44 26 54 31 40 54 54 52 52 30 53 41 21 26 35 26 44 30 51 37 54 21 46 36 34 39 25 29 52 25 54 54 29 40 53 45 54 40 45 42 31 49 42 32 45 42 32 32 53 34 52 40 31 31 51 19 34 47 32 51 32 27 31 53 30 31 32 41 28 51 45 31 34 30 32 31 17 33 30 32 31 51 46 24 36 25 30 30 30 31 45 31 40 30 42 31 42 51 31 19 11 38 31 30 24 45 42 31 36 37 29 26 31 42 37 32 32 30 38 34 31 33 43 24 31 41 29 26 31 18 46 18 20 33 29 14 27 31 31 9 35 29 30 27 25 21 25 33 32 32 25 26 31 23 30 32 34 28 41 21 31 22 17 22 46 31 32 47 31 32 24 25 30 31 30 29 31 27 30 21 32 17 32 31 25 31 31 27 29 21 37 31 25 11 25 32 26 36 33 41 41 15 18 21 21 31 16 26 12 24 41 14 25 18 14 11 23 30 33 19 31 32 12 17 14 8 29 19 22 15 32 21 39 24 9 23 32 29 21 7 24 15 8 19 11 4 19 4 7 9 39 13 22 8 13 19 10 7

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_29093190_29094383
seq2: B6Ng01-338O07.b_43_1245

seq1  GAATTCCTCAGTACCTGGTTGCCAGTGGCAGCTTAGAACTGGTATATACC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTCAGTACCTGGTTGCCAGTGGCAGCTTAGAACTGGTATATACC  50

seq1  ACCTTGTTTGATGTCAGGAAGTAGCAAGGCCATCAAAATATTTAAGAGGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTTGTTTGATGTCAGGAAGTAGCAAGGCCATCAAAATATTTAAGAGGG  100

seq1  CATGAATAACTATGTACAGAATCTTCTTCTCTGATGGCAGGATGGATCTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGAATAACTATGTACAGAATCTTCTTCTCTGATGGCAGGATGGATCTT  150

seq1  TGATGTAAAAATTGTTGCAGCTGAAAGCATACTTCTCATAAATAACAGCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATGTAAAAATTGTTGCAGCTGAAAGCATACTTCTCATAAATAACAGCA  200

seq1  GAAAAATTTGGATAACTGATATCAGTAGAGATTCTATAGGCAGTTGGAGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAAATTTGGATAACTGATATCAGTAGAGATTCTATAGGCAGTTGGAGA  250

seq1  CGCTTATATTTATGTTGCCCCATAAGTTAGCAGAGATTATTGTGATCACT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCTTATATTTATGTTGCCCCATAAGTTAGCAGAGATTATTGTGATCACT  300

seq1  GCTGCTTGAGGCCTGAAATGTCATGAATATAAAAATGGTATCTTTTGTCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGCTTGAGGCCTGAAATGTCATGAATATAAAAATGGTATCTTTTGTCA  350

seq1  TTATGTGTCCTCAGTGTAACAGAATATGAAACTGAACATGACATGGAGGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATGTGTCCTCAGTGTAACAGAATATGAAACTGAACATGACATGGAGGA  400

seq1  ACAGTATGACCTAAATTTTCACCTTATGTTCAGATGGTCTCATAGATCCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTATGACCTAAATTTTCACCTTATGTTCAGATGGTCTCATAGATCCT  450

seq1  GGACATTAACAATCTCATCAGAAGCATCATGGACTGTGGGTTTAATCAAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACATTAACAATCTCATCAGAAGCATCATGGACTGTGGGTTTAATCAAG  500

seq1  GCCACTGATGGCAGCATAATGGATATCATCATATTTTCTGTAGGCACTTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCACTGATGGCAGCATAATGGATATCATCATATTTTCTGTAGGCACTTT  550

seq1  GAGTGAGTGACATTAATATAGTTCTCAGTGGTAGCAGAGATCACTAATGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGAGTGACATTAATATAGTTCTCAGTGGTAGCAGAGATCACTAATGA  600

seq1  CAAGGTGGCCAATGACAGCAAGTAACAAAGGCCATACCATGGAATCTATT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGGTGGCCAATGACAGCAAGTAACAAAGGCCATACCATGGAATCTATT  650

seq1  GCCATTTATATGTCAATGGCATTAGCATAGATTAAAAGGGAAGAAAAATT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCATTTATATGTCAATGGCATTAGCATAGATTAAAAGGGAAGAAAAATT  700

seq1  ATGATCATAAACCTCTTATCAGGTGGCAATATTTATCTTGACAGCGCAAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGATCATAAACCTCTTATCAGGTGGCAATATTTATCTTGACAGCGCAAT  750

seq1  TCCAGGGGCAGTAACAACCATGTACATTACATGGTTGATAGCAGGCAGGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGGGGCAGTAACAACCATGTACATTACATGGTTGATAGCAGGCAGGA  800

seq1  AGATCAACAGAATTTCTTATGGAAGATAGAATCTCAGACATCAATCTGAT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATCAACAGAATTTCTTATGGAAGATAGAATCTCAGACATCAATCTGAT  850

seq1  CTACTGTGTCACCTCAGAACACTTACCTCAATATGACCTCTACCATTAAC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTGTGTCACCTCAGAACACTTACCTCAATATGACCTCTACCATTAAC  900

seq1  ATGAACCTTGTAAGTCAGAACGTTCTCAAACGACAGGAGAGATCAT-GGC  949
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  ATGAACCTTGTAAGTCAGAACGTTCTCAAACGACAGGAGAGATCATGGGC  950

seq1  CATCACCAGGTTTTTCATCAGCAATAGAAAAATAAATGGACTCCATCATT  999
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  CATCACCAGGTTTTTCATCAGCAATAGAAAATTAAATGGACTCCATCATT  1000

seq1  ATTGCTGGTCAC-AGCATGCAGCACTCACATCAAGGTA-TTTTCAGGTTT  1047
      |||||||||||| ||||||||||||||||||| ||||| |||||||||||
seq2  ATTGCTGGTCACAAGCATGCAGCACTCACATC-AGGTATTTTTCAGGTTT  1049

seq1  CAGTTAGGATTAC-AGGCATCAAAATAGTC-TCCAGTAACAGC-GAACAG  1094
      ||||||||||||| |||||||||||||||| |||||| ||||| ||||||
seq2  CAGTTAGGATTACAAGGCATCAAAATAGTCTTCCAGTTACAGCGGAACAG  1099

seq1  CA-CTTACCTCATTATGAACTTAGGCAGCAATAATTACCATGGACTTTAC  1143
      || |||||||||||||||||||||||||||   |||||||||||  ||||
seq2  CACCTTACCTCATTATGAACTTAGGCAGCA--TATTACCATGGAACTTAC  1147

seq1  AACAG--ATTC-TTATGGTTGATTTATCATAGACA-TC-ATGTAGCTTTT  1188
      |||||  |||| ||||||||||||||||||||||| || ||||||| |||
seq2  AACAGGAATTCTTTATGGTTGATTTATCATAGACACTCAATGTAGCCTTT  1197

seq1  CAATGA  1194
      | ||||
seq2  CCATGA  1203

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information