MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-345O04
Chromosome	X (Build37)
Map Location	136,753,637 - 136,754,301
singlet/doublet	singlet
Overlap gene	LOC100041446
Upstream gene	Mum1l1, LOC675062, Trap1a, C330013F16Rik, EG666359, D330045A20Rik, Rnf128, LOC622432, Tbc1d8b, Ripply1, Cldn2, Morc4, Rbm41, Gm719, E230019M04Rik, LOC622213
Downstream gene	EG245643, LOC666424, Prps1, Tsc22d3, Mid2, LOC619612, Tex13, LOC632685, Vsig1, Psmd10, Atg4a, LOC100038961, Col4a6
Link	Open Mouse BAC browser

Click to get alignment info.

name	Mum1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245631 MGI:2445062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC675062 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675062
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Trap1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22037 MGI:98818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330013F16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78526 MGI:1925776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG666359 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666359 MGI:3646568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	D330045A20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102871 MGI:2147848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf128 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66889 MGI:1914139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622432 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 17 Proteins pseudo : _no_value

name	Tbc1d8b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245638 MGI:1918101
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ripply1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622473 MGI:3614797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12738 MGI:1276110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Morc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75746 MGI:1922996
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237073 MGI:2444923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm719 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:279706 MGI:2685565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein

name	E230019M04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331537 MGI:3607720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622213 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 18 Proteins pseudo : _no_value

name	LOC100041446 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG245643 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245643 MGI:3646547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666424 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Prps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19139 MGI:97775
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsc22d3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14605 MGI:1196284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mid2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23947 MGI:1344333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC619612 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619612
definition	note : eukaryotic translation initiation factor 2C, 2 pseudogene pseudo : _no_value

name	Tex13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83555 MGI:1890544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC632685 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 192 ESTs, 2 Proteins pseudo : _no_value

name	Vsig1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78789 MGI:1926039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmd10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53380 MGI:1858898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atg4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666468 MGI:2147903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 6 Proteins

name	LOC100038961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 36 ESTs, 4 Proteins

name	Col4a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94216 MGI:2152695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mum1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342136 GeneID:245631 MGI:2445062
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma associated antigen (mutated) 1-like 1 transcript_id : NM_175541.2

name	Trap1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755870 GeneID:22037 MGI:98818
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor rejection antigen P1A transcript_id : NM_011635.1

name	C330013F16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272285 GeneID:78526 MGI:1925776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA C330013F16 gene transcript_id : XM_001475717.1

name	D330045A20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351317 GeneID:102871 MGI:2147848
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D330045A20 gene transcript_id : NM_175326.3

name	Rnf128 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378619 GeneID:66889 MGI:1914139
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 128 transcript_id : NM_023270.4

name	Tbc1d8b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125630635 GeneID:245638 MGI:1918101
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 8B transcript_id : NM_001081499.1

name	Ripply1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83776578 GeneID:622473 MGI:3614797
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ripply1 transcript_id : NM_001037915.1

name	Cldn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47270694 GeneID:12738 MGI:1276110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 2 transcript_id : NM_016675.3

name	Morc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383330 GeneID:75746 MGI:1922996
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microrchidia 4 transcript_id : NM_029413.2

name	Rbm41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956383 GeneID:237073 MGI:2444923
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 41 transcript_id : NM_153586.1

name	Gm719 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408282 GeneID:279706 MGI:2685565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein product : gene model 719, (NCBI) transcript_id : XM_205358.4

name	E230019M04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368472 GeneID:331537 MGI:3607720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E230019M04 gene transcript_id : NM_177921.3

name	LOC100041446 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272288 GeneID:100041446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041446 transcript_id : XM_001476409.1

name	EG245643 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802623 GeneID:245643 MGI:3646547
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG245643 transcript_id : NM_177750.3

name	Prps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368021 GeneID:19139 MGI:97775
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoribosyl pyrophosphate synthetase 1 transcript_id : NM_021463.3

name	Tsc22d3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116517337 GeneID:14605 MGI:1196284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TSC22 domain family 3 transcript_id : NM_001077364.1

name	Tsc22d3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116517341 GeneID:14605 MGI:1196284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TSC22 domain family 3 transcript_id : NM_010286.3

name	Mid2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134023660 GeneID:23947 MGI:1344333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : midline 2 transcript_id : NM_011845.2

name	Tex13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475713 GeneID:83555 MGI:1890544
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis expressed gene 13 transcript_id : NM_031381.2

name	Vsig1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142346492 GeneID:78789 MGI:1926039
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : V-set and immunoglobulin domain containing 1 transcript_id : NM_030181.2

name	Psmd10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254368 GeneID:53380 MGI:1858898
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteosome (prosome, macropain) 26S subunit, non-ATPase, 10 transcript_id : NM_016883.3

name	Atg4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74136554 GeneID:666468 MGI:2147903
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 6 Proteins product : autophagy-related 4A (yeast) transcript_id : NM_174875.3

name	LOC100038961 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272403 GeneID:100038961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 36 ESTs, 4 Proteins product : similar to autophagin-2 transcript_id : XM_001471981.1

name	Col4a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716478 GeneID:94216 MGI:2152695
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type IV, alpha 6 transcript_id : NM_053185.1

name	Mum1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789431 CCDS:CCDS30432.1 GeneID:245631 MGI:2445062
definition	codon_start : 1 product : melanoma associated antigen (mutated) 1-like 1 protein_id : NP_780750.1

name	Trap1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755871 CCDS:CCDS30433.1 GeneID:22037 MGI:98818
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : tumor rejection antigen P1A protein_id : NP_035765.1

name	C330013F16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272286 GeneID:78526 MGI:1925776
definition	codon_start : 1 product : hypothetical protein LOC78526 protein_id : XP_001475767.1

name	D330045A20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425010 CCDS:CCDS30434.1 GeneID:102871 MGI:2147848
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 note : likely orthologue of H. sapiens Chromosome X open reading frame 57 (CXorf57) product : hypothetical protein LOC102871 protein_id : NP_780535.1

name	Rnf128 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560218 CCDS:CCDS30435.1 GeneID:66889 MGI:1914139
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005770 - late endosome [Evidence IDA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA] [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0042036 - negative regulation of cytokine biosynthesis [Evidence IDA] codon_start : 1 exception : mismatches in translation product : ring finger protein 128 protein_id : NP_075759.2

name	Tbc1d8b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125630636 GeneID:245638 MGI:1918101
definition	codon_start : 1 product : TBC1 domain family, member 8B protein_id : NP_001074968.1

name	Ripply1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776579 CCDS:CCDS30436.1 GeneID:622473 MGI:3614797
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : Down syndrome critical region homolog 6-like product : Ripply1 protein protein_id : NP_001033004.1

name	Cldn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710004 CCDS:CCDS30437.1 GeneID:12738 MGI:1276110
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence IDA] codon_start : 1 product : claudin 2 protein_id : NP_057884.1

name	Morc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794186 GeneID:75746 MGI:1922996
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : zinc finger, CW-type with coiled-coil domain 2 product : microrchidia 4 protein_id : NP_083689.1

name	Rbm41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956384 GeneID:237073 MGI:2444923
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : RNA binding motif protein 41 protein_id : NP_705814.1

name	Gm719 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086760 GeneID:279706 MGI:2685565
definition	codon_start : 1 product : hypothetical protein LOC279706 protein_id : XP_205358.2

name	E230019M04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244566 CCDS:CCDS30438.1 GeneID:331537 MGI:3607720
definition	codon_start : 1 product : hypothetical protein LOC331537 protein_id : NP_808589.1

name	LOC100041446 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272289 GeneID:100041446
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476459.1

name	EG245643 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244238 GeneID:245643 MGI:3646547
definition	codon_start : 1 product : hypothetical protein LOC245643 protein_id : NP_808418.1

name	Prps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946854 CCDS:CCDS30439.1 GeneID:19139 MGI:97775
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004749 - ribose phosphate diphosphokinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : phosphoribosyl pyrophosphate synthetase 1 protein_id : NP_067438.1

name	Tsc22d3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116517338 GeneID:14605 MGI:1196284
definition	GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; glucocorticoid-induced leucine zipper; delta sleep inducing peptide, immunoreactor; TSC22-related inducible leucine zipper 3 product : glucocorticoid-induced leucine zipper isoform 1 protein_id : NP_001070832.1

name	Tsc22d3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116517342 CCDS:CCDS30440.1 GeneID:14605 MGI:1196284
definition	GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; glucocorticoid-induced leucine zipper; delta sleep inducing peptide, immunoreactor; TSC22-related inducible leucine zipper 3 product : glucocorticoid-induced leucine zipper isoform 2 protein_id : NP_034416.3

name	Mid2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754694 GeneID:23947 MGI:1344333
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : midline 2 protein_id : NP_035975.1

name	Tex13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878205 GeneID:83555 MGI:1890544
definition	codon_start : 1 product : testis expressed gene 13 protein_id : NP_113558.1

name	Vsig1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313488 CCDS:CCDS30443.1 GeneID:78789 MGI:1926039
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : glycoprotein A34 product : V-set and immunoglobulin domain containing 1 protein_id : NP_084457.1

name	Psmd10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980811 CCDS:CCDS30444.1 GeneID:53380 MGI:1858898
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] codon_start : 1 note : gankyrin; proteosome subunit p28; proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 product : proteosome (prosome, macropain) 26S subunit, non-ATPase, 10 protein_id : NP_058579.2

name	Atg4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74136555 GeneID:666468 MGI:2147903
definition	EC_number : 3.4.22.- codon_start : 1 exception : unclassified translation discrepancy note : autophagy-related cysteine endopeptidase 2; autophagy 4 homolog A; cysteine protease APG4A; autophagin 2; AUT-like 2, cysteine endopeptidase; APG4 (ATG4) autophagy-related homolog A product : autophagy-related 4A-like protein_id : NP_777364.3

name	LOC100038961 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272404 GeneID:100038961
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472031.1

name	Col4a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716479 GeneID:94216 MGI:2152695
definition	GO_component : GO:0005604 - basement membrane [Evidence IDA]; GO:0005581 - collagen [Evidence IEA]; GO:0005587 - collagen type IV [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IDA] GO_process : GO:0030198 - extracellular matrix organization and biogenesis [Evidence IDA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : procollagen, type IV, alpha 6 protein_id : NP_444415.1

name	LOC675062 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675062
definition	number : 2 pseudo : _no_value

name	LOC675062 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675062
definition	number : 1 pseudo : _no_value

name	LOC666424 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666424
definition	number : 2 pseudo : _no_value

name	LOC666424 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666424
definition	number : 1 pseudo : _no_value

name	EG666359 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94408280 GeneID:666359 MGI:3646568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : predicted gene, EG666359 pseudo : _no_value transcript_id : XR_001862.1

name	LOC622432 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272287 GeneID:622432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 17 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_032430.1

name	LOC622213 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272290 GeneID:622213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 18 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_032508.1

name	LOC632685 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272291 GeneID:632685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 192 ESTs, 2 Proteins product : similar to ribosomal protein S7 pseudo : _no_value transcript_id : XR_032787.1

clone name	MSMg01-102G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-207B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158B21
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-345O04.b	B6Ng01-345O04.g
ACC	GA127941	GA127942
length	1,047	798
definition	B6Ng01-345O04.b	B6Ng01-345O04.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctctaccaaagaattaaagccacaggcagaaaataacaggcttga ggccaggatgcatacagaggttagacgtagagtaagggaagagaaggaag tgaggtgtctccttagaaaggagacagagaatatataattatggagagac agaagaaagactggaacaggaggataaaatagggaaagggaaggaagagg agggtaggggaaaatacaaggagggataactaacactaaagatcatctga gggccatatagaaacctactatagtagaagtttcttaaaatatatgcatc taggggagaaatataaaagcagttatcaaataaggggggaggcagtgccc caattagatatctttcatcaagtgaaacctccagtaccaggaatggatta cgtctacttgagtgattggccaaagagggtcctgtgggaacccccaaaca acctaggctattgccaaggctattggttactctctacaaactgacggtaa gacggtaaggctctattgctgaagacaacacttttttttttttttttttg gtttttcgagacagggtttctctgtgtagccctggatgtcctggaactca ctctttagaccaggctggccttgaactcagaaatccgcctgcctctgcct cccaagtgctgggattaaaggcatgtgccaccactgccaggctgaagaaa acacacaagtcactgaacacagcgatgttgaaactggtgcccacctagac tagcgttcatggtattggaaggtactctgcgcactactagaggagagggt atccacaaatctagccataaaaacctgtgacctacaatggtgacctgcct gcaaaagttgccacaaagattggtggggattaactatctgattggatttc aaggcctactccatgaatggaagccattcctcacacctgcattggttggt caagaacctgagatcagataggtcatagacctggggaaagtcattactta ctggttctgctgaagtaactacagcataaagtggactccttatgaca	gaattcaatccctgggagtcatatggtagaaagataaaaccttactccca aaggtggcctctgactttcacatgcttgccacagtgcatgtacacacaga cacagtgagagatacagacagacacacacacacaaagaagatttaatttt ttaaatgaccacaatttgagtaatggatagatgctggtataaatgattag gacagataaggaatatacttggggcagaaagaaactaagatttcaacttg aacaaatgagttttgcaatggctataaaatgttcaaatggagatgtgtgc taagtaattagatatatgactggaacttagagaagtcgaggatatgtctg ctaactggagttaaatataaatcgtgctgaaagctataggaatggatgag accacttaaagggagagcataaaatgaggagtgaaaatctaaagctgaga ctttatgggatgacaaacatctagtggccagagggaggaggatgactagg caagggtcataagagatgtagggggttggagagtcagtggataggagcac caactgttcttccagaggtcctgagttcaatccccagcaaccacatggtg gctcacagccatctgtaaaggaatctgatgccttcttcttgtgtgtctgg aaacagctatagtatactatttatactcatataaatatgaatatatcata tattatgctcatataaatatagaatagctatttatactcatataaataaa ataaacctttgagagagagagagagagagagagagagagagagagaga
quality values	Open. Hide. 58 26 25 34 58 58 58 58 54 52 58 31 28 54 62 62 49 47 37 49 62 62 54 62 62 47 42 62 54 62 62 24 19 14 21 20 20 21 29 22 30 62 59 62 62 62 62 62 59 59 46 59 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 59 56 43 27 42 42 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 59 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 44 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 56 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 56 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 47 48 52 52 52 52 62 52 43 62 52 62 46 43 52 62 52 52 62 62 54 62 46 62 62 47 54 52 52 52 54 58 52 54 48 42 41 41 47 42 39 52 52 54 50 44 36 41 54 52 46 51 54 49 47 52 54 47 39 54 32 41 34 39 54 46 54 43 39 34 52 37 52 47 52 52 46 52 52 35 42 58 54 42 39 46 44 13 20 58 52 54 40 58 52 50 50 46 42 47 48 29 51 34 22 40 30 41 51 50 48 50 54 51 50 46 48 18 42 42 25 43 27 39 54 53 50 50 47 35 31 29 39 27 39 46 46 37 43 29 40 46 32 33 39 51 49 27 58 58 58 23 27 40 41 31 49 29 58 52 53 39 39 32 51 50 38 58 39 34 38 18 40 47 33 40 50 52 37 49 22 58 29 35 32 50 51 46 34 46 32 54 35 28 33 54 38 29 37 39 42 38 29 37 41 40 28 51 36 19 37 34 54 21 44 39 40 31 28 32 44 14 42 24 31 37 37 37 40 32 31 26 40 24 28 41 33 31 30 22 10 38 17 47 27 16 42 18 49 9 9 18 29 19 37 25 52 51 52 31 33 21 32 34 40 32 46 12 17 8 45 32 35 27 20 26 31 42 21 31 17 16 30 11 15 20 18 22 19 30 46 25 31 36 13 40 31 37 38 14 12 34 25 26 43 38 31 12 21 7 11 22 33 19 30 13 46 31 12 13 7 12 21 25 18 21 46 37 35 31 21 26 26 30 27 26 31 31 32 31 31 31 25 21 21 21 32 21 39 18 5 23 25 21 30 14 20 22 9 8 17 9 26 9 31 23 7 10 11 18 10 13 15 12 32 38 26 31 30 31 21 23 12 13 21 11 7 22 27 9 11 16 26 22 18 10 14 6 24 7 6 14 8 33 10 23 5 28 12 9 12 29 10 33 27 24 18 10 33 18 32 10 21 12 9 5 7 11 6 23 10 18 25 14 9 5 3 3 29 23 13 9 5 24 6 9 5 10 5 8 6 6 10 16 16 13 12 28 20 7 7 11 11 18 15 20 17 17 13 13 5 5 9 11 6 5 7 8 6 21 11 5 12 6 17 8 7 4 25 27 4 5 18 6 12 23 8 4	Open. Hide. 62 47 54 47 62 47 42 62 62 62 23 19 20 18 20 21 15 21 21 27 34 56 56 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 54 54 59 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 59 59 59 59 62 59 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 59 62 62 54 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 59 62 62 49 35 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 56 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 52 62 62 43 62 62 47 42 62 54 38 62 47 41 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 58 54 58 54 45 38 58 58 58 54 58 58 58 58 54 58 58 58 58 42 58 54 52 52 58 58 58 58 58 45 54 54 54 58 58 54 54 41 38 39 52 54 54 58 58 58 58 54 54 54 47 43 33 50 58 36 54 52 47 52 54 58 54 42 58 51 50 42 51 51 50 47 30 38 50 52 50 50 49 43 47 47 54 53 53 58 58 41 58 58 50 58 52 50 51 50 50 47 44 50 54 53 58 58 52 53 58 58 40 50 58 50 40 53 54 58 46 32 44 40 49 50 49 50 39 41 32 46 51 54 46 51 46 58 50 46 52 58 58 40 54 40 43 39 52 51 58 53 53 52 42 53 54 42 41 46 51 58 49 58 53 52 49 50 49 58 52 41 51 51 53 39 58 58 53 52 47 41 50 54 49 51 50 51 49 53 53 53 54 52 52 47 40 51 49 54 52 54 39 40 52 53 50 28 54 54 47 42 53 42 37 42 47 40 39 30 39 39 39 45 54 42 41 52 37 45 53 42 37 52 45 51 35 54 47 38 28 54 54 33 40 29 46 24 13 14 21 51 34 31 52 37 51 32 51 47 46 52 52 33 46 31 40 29 49 34 51 45 53 26 22 17 53 32 40 29 51 31 51 30 29 16 25 19 26 10 22

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_136753637_136754301
seq2: B6Ng01-345O04.g_66_730

seq1  GAATTCAATCCCTGGGAGTCATATGGTAGAAAGATAAAACCTTACTCCCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAATCCCTGGGAGTCATATGGTAGAAAGATAAAACCTTACTCCCA  50

seq1  AAGGTGGCCTCTGACTTTCACATGCTTGCCACAGTGCATGTACACACAGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGTGGCCTCTGACTTTCACATGCTTGCCACAGTGCATGTACACACAGA  100

seq1  CACAGTGAGAGATACAGACAGACACACACACACAAAGAAGATTTAATTTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGTGAGAGATACAGACAGACACACACACACAAAGAAGATTTAATTTT  150

seq1  TTAAATGACCACAATTTGAGTAATGGATAGATGCTGGTATAAATGATTAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAATGACCACAATTTGAGTAATGGATAGATGCTGGTATAAATGATTAG  200

seq1  GACAGATAAGGAATATACTTGGGGCAGAAAGAAACTAAGATTTCAACTTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGATAAGGAATATACTTGGGGCAGAAAGAAACTAAGATTTCAACTTG  250

seq1  AACAAATGAGTTTTGCAATGGCTATAAAATGTTCAAATGGAGATGTGTGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAAATGAGTTTTGCAATGGCTATAAAATGTTCAAATGGAGATGTGTGC  300

seq1  TAAGTAATTAGATATATGACTGGAACTTAGAGAAGTCGAGGATATGTCTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGTAATTAGATATATGACTGGAACTTAGAGAAGTCGAGGATATGTCTG  350

seq1  CTAACTGGAGTTAAATATAAATCGTGCTGAAAGCTATAGGAATGGATGAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAACTGGAGTTAAATATAAATCGTGCTGAAAGCTATAGGAATGGATGAG  400

seq1  ACCACTTAAAGGGAGAGCATAAAATGAGGAGTGAAAATCTAAAGCTGAGA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCACTTAAAGGGAGAGCATAAAATGAGGAGTGAAAATCTAAAGCTGAGA  450

seq1  CTTTATGGGATGACAAACATCTAGTGGCCAGAGGGAGGAGGATGACTAGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTATGGGATGACAAACATCTAGTGGCCAGAGGGAGGAGGATGACTAGG  500

seq1  CAAGGGTCATAAGAGATGTAGGGGGTTGGAGAGTCAGTGGATAGGAGCAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGGGTCATAAGAGATGTAGGGGGTTGGAGAGTCAGTGGATAGGAGCAC  550

seq1  CAACTGTTCTTCCAGAGGTCCTGAGTTCAATCCCCAGCAACCACATGGTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTGTTCTTCCAGAGGTCCTGAGTTCAATCCCCAGCAACCACATGGTG  600

seq1  GCTCACAGCCATCTGTAAAGGAATCTGATGCCTTCTTCTTGTGTGTCTGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCACAGCCATCTGTAAAGGAATCTGATGCCTTCTTCTTGTGTGTCTGG  650

seq1  AAACAGCTATAGTAT  665
      |||||||||||||||
seq2  AAACAGCTATAGTAT  665

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information