MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-075F15
Chromosome	X (Build37)
Map Location	51,100,074 - 51,100,407
singlet/doublet	singlet
Overlap gene	Xlr
Upstream gene	LOC100041925, LOC665929, 6330534C20Rik, LOC624936, LOC546298, LOC100040569, Phf6, Hprt1, C430049B03Rik, Plac1, 4632404H22Rik, 4930432H15Rik, LOC385527, Mospd1, LOC100040609, Etd, Cxx1c, LOC100040644, Cxx1a, Cxx1b, AW822252, 4930502E18Rik, 1700013H16Rik, EG547172, Zfp36l3
Downstream gene	LOC100040719, LOC100040730, LOC100040260, LOC100040271, LOC100040765, LOC194788, LOC100040789, LOC666072, LOC100040317, LOC625476, LOC625508, LOC666096, LOC100040867, LOC100040894, LOC666122
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100041925 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 235 ESTs, 9 Proteins pseudo : _no_value

name	LOC665929 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	6330534C20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434778 MGI:3588225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 Proteins pseudo : _no_value

name	LOC546298 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546298
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 mRNAs, 2934 ESTs, 9 Proteins

name	LOC100040569 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Phf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70998 MGI:1918248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hprt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15452 MGI:96217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C430049B03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72575 MGI:1924903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Plac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56096 MGI:1926287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4632404H22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78755 MGI:1926005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930432H15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73866 MGI:1921116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC385527 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Mospd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70380 MGI:1917630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040609 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040609
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 45 Proteins pseudo : _no_value

name	Etd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69501 MGI:1916751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cxx1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72865 MGI:1920115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040644 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040644
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Cxx1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66158 MGI:1913408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cxx1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:553127 MGI:3576504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AW822252 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331578 MGI:2148030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	4930502E18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75013 MGI:1922263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700013H16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75514 MGI:1922764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	EG547172 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547172 MGI:3646091
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Zfp36l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333473 MGI:3525151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xlr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22441 MGI:98976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040719 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040719
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 9 Proteins

name	LOC100040730 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040730
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100040260 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040260
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 86 ESTs, 26 Proteins

name	LOC100040271 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100040765 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC194788 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:194788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100040789 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040789
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC666072 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666072
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100040317 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs, 1 Protein

name	LOC625476 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC625508 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC666096 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC100040867 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040867
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC100040894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC666122 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	6330534C20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702180 GeneID:434778 MGI:3588225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330534C20 gene transcript_id : NM_001034059.1

name	LOC546298 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271562 GeneID:546298
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 mRNAs, 2934 ESTs, 9 Proteins product : similar to ribosomal protein S2 transcript_id : XM_001477049.1

name	LOC100040569 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271543 GeneID:100040569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : hypothetical protein LOC100040569 transcript_id : XM_001474921.1

name	Phf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33563291 GeneID:70998 MGI:1918248
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 6 transcript_id : NM_027642.1

name	Hprt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:96975137 GeneID:15452 MGI:96217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypoxanthine guanine phosphoribosyl transferase 1 transcript_id : NM_013556.2

name	C430049B03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407371 GeneID:72575 MGI:1924903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA C430049B03 gene transcript_id : XM_980571.1

name	Plac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360115 GeneID:56096 MGI:1926287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : placental specific protein 1 transcript_id : NM_019538.4

name	4632404H22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348852 GeneID:78755 MGI:1926005
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4632404H22 gene transcript_id : NM_030167.2

name	4930432H15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131888240 GeneID:73866 MGI:1921116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930432H15 gene transcript_id : NM_028671.2

name	Mospd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802204 GeneID:70380 MGI:1917630
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : motile sperm domain containing 1 transcript_id : NM_027409.2

name	Etd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341018 GeneID:69501 MGI:1916751
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : embryonic testis differentiation transcript_id : NM_175147.2

name	Cxx1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270961 GeneID:72865 MGI:1920115
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CAAX box 1 homolog C (human) transcript_id : NM_028375.3

name	Cxx1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313589 GeneID:66158 MGI:1913408
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CAAX box 1 homolog A (human) transcript_id : NM_024170.1

name	Cxx1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:65787324 GeneID:553127 MGI:3576504
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CAAX box 1 homolog B (human) transcript_id : NM_001018063.1

name	AW822252 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271601 GeneID:331578 MGI:2148030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW822252 transcript_id : XM_001474711.1

name	4930502E18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626043 GeneID:75013 MGI:1922263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930502E18 gene transcript_id : NM_029142.1

name	1700013H16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271603 GeneID:75514 MGI:1922764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : RIKEN cDNA 1700013H16 gene transcript_id : XM_135430.4

name	EG547172 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83001197 GeneID:547172 MGI:3646091
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG547172 transcript_id : XM_622034.2

name	Zfp36l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222289 GeneID:333473 MGI:3525151
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 36, C3H type-like 3 transcript_id : NM_001009549.1

name	Xlr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357146 GeneID:22441 MGI:98976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked lymphocyte-regulated complex transcript_id : NM_011725.3

name	LOC100040719 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271612 GeneID:100040719
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 9 Proteins product : similar to X-linked lymphocyte-regulated protein pM1 transcript_id : XM_001475126.1

name	LOC100040260 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271604 GeneID:100040260
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 86 ESTs, 26 Proteins product : similar to Atf1 protein transcript_id : XM_001474817.1

name	LOC100040271 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271606 GeneID:100040271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040271 transcript_id : XM_001474837.1

name	LOC100040317 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271610 GeneID:100040317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 1 Protein product : similar to Xlr-related, meiosis regulated, transcript variant 2 transcript_id : XM_001474869.1

name	LOC100040317 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271608 GeneID:100040317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Xlr-related, meiosis regulated, transcript variant 1 transcript_id : XM_001474852.1

name	LOC625508 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:83001215 GeneID:625508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to Xlr-related, meiosis regulated transcript_id : XM_890086.1

name	LOC666096 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407432 GeneID:666096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to Xlr-related, meiosis regulated transcript_id : XM_981599.1

name	LOC100040867 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271614 GeneID:100040867
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to Xlr-related, meiosis regulated transcript_id : XM_001475416.1

name	LOC100040894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271616 GeneID:100040894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to Xlr-related, meiosis regulated transcript_id : XM_001475448.1

name	LOC666122 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407437 GeneID:666122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to Xlr-related, meiosis regulated transcript_id : XM_981768.1

name	6330534C20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702181 CCDS:CCDS30126.1 GeneID:434778 MGI:3588225
definition	codon_start : 1 product : hypothetical protein LOC434778 protein_id : NP_001029231.1

name	LOC546298 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271563 GeneID:546298
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477099.1

name	LOC100040569 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271544 GeneID:100040569
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474971.1

name	Phf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563292 CCDS:CCDS30127.1 GeneID:70998 MGI:1918248
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : PHD finger protein 6 protein_id : NP_081918.1

name	Hprt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:96975138 GeneID:15452 MGI:96217
definition	EC_number : 2.4.2.8 GO_component : GO:0005737 - cytoplasm [Evidence IEA] [Evidence IDA] GO_function : GO:0004422 - hypoxanthine phosphoribosyltransferase activity [Evidence IDA] [Evidence IMP]; GO:0042802 - identical protein binding [Evidence IPI]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0046083 - adenine metabolism [Evidence IMP] [Evidence IGI]; GO:0006168 - adenine salvage [Evidence IMP]; GO:0007610 - behavior [Evidence IMP]; GO:0021954 - central nervous system neuron development [Evidence IMP]; GO:0021895 - cerebral cortex neuron differentiation [Evidence IMP]; GO:0019835 - cytolysis [Evidence IMP]; GO:0048813 - dendrite morphogenesis [Evidence IMP]; GO:0042417 - dopamine metabolism [Evidence IMP]; GO:0007625 - grooming behavior [Evidence IGI]; GO:0006178 - guanine salvage [Evidence IMP]; GO:0046100 - hypoxanthine metabolism [Evidence IMP] [Evidence IC]; GO:0046651 - lymphocyte proliferation [Evidence IMP]; GO:0009116 - nucleoside metabolism [Evidence IEA]; GO:0045964 - positive regulation of dopamine metabolism [Evidence IMP]; GO:0006164 - purine nucleotide biosynthesis [Evidence IMP]; GO:0006166 - purine ribonucleoside salvage [Evidence IMP] [Evidence IGI]; GO:0001975 - response to amphetamine [Evidence IMP]; GO:0021756 - striatum development [Evidence IMP] codon_start : 1 product : hypoxanthine guanine phosphoribosyl transferase 1 protein_id : NP_038584.2

name	C430049B03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407372 GeneID:72575 MGI:1924903
definition	codon_start : 1 product : hypothetical protein LOC72575 protein_id : XP_985665.1

name	Plac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506575 CCDS:CCDS30128.1 GeneID:56096 MGI:1926287
definition	codon_start : 1 note : ectoplacental cone, invasive trophoblast giant cells, extraembryonic ectoderm and chorion sequence 26 product : placental specific protein 1 protein_id : NP_062411.1

name	4632404H22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313466 CCDS:CCDS30129.1 GeneID:78755 MGI:1926005
definition	codon_start : 1 product : hypothetical protein LOC78755 protein_id : NP_084443.1

name	4930432H15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312034 GeneID:73866 MGI:1921116
definition	codon_start : 1 product : hypothetical protein LOC73866 protein_id : NP_082947.1

name	Mospd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312580 CCDS:CCDS30131.1 GeneID:70380 MGI:1917630
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : motile sperm domain containing 1 protein_id : NP_081685.1

name	Etd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28201997 GeneID:69501 MGI:1916751
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : embryonic testis differentiation-associated product : embryonic testis differentiation protein_id : NP_780356.1

name	Cxx1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386306 GeneID:72865 MGI:1920115
definition	codon_start : 1 note : mammalian retrotransposon derived 8a product : CAAX box 1 homolog C protein_id : NP_082651.1

name	Cxx1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313590 CCDS:CCDS30134.1 GeneID:66158 MGI:1913408
definition	codon_start : 1 product : mammalian retrotransposon derived 8b protein_id : NP_077132.1

name	Cxx1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:65787325 CCDS:CCDS30135.1 GeneID:553127 MGI:3576504
definition	codon_start : 1 note : mammalian retrotransposon derived 8c product : CAAX box 1 homolog B protein_id : NP_001018073.1

name	AW822252 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271602 GeneID:331578 MGI:2148030
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474761.1

name	4930502E18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626044 CCDS:CCDS30136.1 GeneID:75013 MGI:1922263
definition	codon_start : 1 product : hypothetical protein LOC75013 protein_id : NP_083418.1

name	1700013H16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20946689 GeneID:75514 MGI:1922764
definition	codon_start : 1 product : hypothetical protein LOC75514 protein_id : XP_135430.1

name	EG547172 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001198 GeneID:547172 MGI:3646091
definition	codon_start : 1 product : similar to 60S ribosomal protein L38 protein_id : XP_622034.2

name	Zfp36l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222290 CCDS:CCDS30138.1 GeneID:333473 MGI:3525151
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 36-like 3 protein_id : NP_001009549.1

name	Xlr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756021 CCDS:CCDS30139.1 GeneID:22441 MGI:98976
definition	codon_start : 1 note : X-linked gene family of B-cell surface antigens product : X-linked lymphocyte-regulated protein pM1 protein_id : NP_035855.1

name	LOC100040719 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271613 GeneID:100040719
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475176.1

name	LOC100040260 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271605 GeneID:100040260
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474867.1

name	LOC100040271 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271607 GeneID:100040271
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474887.1

name	LOC100040317 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271609 GeneID:100040317
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001474902.1

name	LOC100040317 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271611 GeneID:100040317
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001474919.1

name	LOC625508 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:83001216 GeneID:625508
definition	codon_start : 1 product : hypothetical protein protein_id : XP_895179.1

name	LOC666096 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407433 GeneID:666096
definition	codon_start : 1 product : hypothetical protein protein_id : XP_986693.1

name	LOC100040867 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271615 GeneID:100040867
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475466.1

name	LOC100040894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271617 GeneID:100040894
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475498.1

name	LOC666122 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407438 GeneID:666122
definition	codon_start : 1 product : hypothetical protein protein_id : XP_986862.1

name	LOC665929 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665929
definition	number : 1 pseudo : _no_value

name	LOC624936 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624936
definition	number : 1 pseudo : _no_value

name	LOC624936 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624936
definition	number : 2 pseudo : _no_value

name	LOC624936 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624936
definition	number : 3 pseudo : _no_value

name	LOC624936 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624936
definition	number : 4 pseudo : _no_value

name	LOC624936 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624936
definition	number : 5 pseudo : _no_value

name	LOC624936 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624936
definition	number : 6 pseudo : _no_value

name	LOC385527 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385527
definition	number : 1 pseudo : _no_value

name	LOC385527 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385527
definition	number : 2 pseudo : _no_value

name	LOC100040644 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040644
definition	number : 1 pseudo : _no_value

name	LOC100040644 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040644
definition	number : 2 pseudo : _no_value

name	LOC100040644 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040644
definition	number : 3 pseudo : _no_value

name	LOC100040730 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040730
definition	number : 1 pseudo : _no_value

name	LOC100040730 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040730
definition	number : 2 pseudo : _no_value

name	LOC100040765 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040765
definition	number : 1 pseudo : _no_value

name	LOC194788 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194788
definition	number : 1 pseudo : _no_value

name	LOC194788 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194788
definition	number : 2 pseudo : _no_value

name	LOC194788 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194788
definition	number : 3 pseudo : _no_value

name	LOC194788 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194788
definition	number : 4 pseudo : _no_value

name	LOC100040789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040789
definition	number : 1 pseudo : _no_value

name	LOC100040789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040789
definition	number : 2 pseudo : _no_value

name	LOC100040789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040789
definition	number : 3 pseudo : _no_value

name	LOC100040789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040789
definition	number : 4 pseudo : _no_value

name	LOC100040789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040789
definition	number : 5 pseudo : _no_value

name	LOC100040789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040789
definition	number : 6 pseudo : _no_value

name	LOC100040789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040789
definition	number : 7 pseudo : _no_value

name	LOC100040789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040789
definition	number : 8 pseudo : _no_value

name	LOC666072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666072
definition	number : 1 pseudo : _no_value

name	LOC666072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666072
definition	number : 2 pseudo : _no_value

name	LOC666072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666072
definition	number : 3 pseudo : _no_value

name	LOC666072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666072
definition	number : 4 pseudo : _no_value

name	LOC666072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666072
definition	number : 5 pseudo : _no_value

name	LOC666072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666072
definition	number : 6 pseudo : _no_value

name	LOC625476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625476
definition	number : 1 pseudo : _no_value

name	LOC625476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625476
definition	number : 2 pseudo : _no_value

name	LOC625476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625476
definition	number : 3 pseudo : _no_value

name	LOC625476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625476
definition	number : 4 pseudo : _no_value

name	LOC625476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625476
definition	number : 5 pseudo : _no_value

name	LOC100041925 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271561 GeneID:100041925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 235 ESTs, 9 Proteins product : similar to ribosomal protein S17 pseudo : _no_value transcript_id : XR_033016.1

name	LOC100040609 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271545 GeneID:100040609
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 45 Proteins product : similar to casein kinase 1, gamma 3 pseudo : _no_value transcript_id : XR_032024.1

clone name	MSMg01-481A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333H24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505G02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-353D22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-342J15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-075F15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-276O20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-095P13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505I14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-538A23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-447N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054N20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-058F11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-352I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-375M11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-381I21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-433B21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-112F11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-536M22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-377J23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-389D18
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-150H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068D14
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-075F15.T7 (MSMg01no075_f15.b1)	MSMg01-075F15.TJ (MSMg01no075_f15.g1)
ACC	AG298190	AG298191
length	669	678
length of high quality (start - end)	456 (67 - 522)	387 (76 - 462)
definition	CHROMAT_FILE: MSMg01no075_f15.b1 PHD_FILE: MSMg01no075_f15.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:23:59 2005	CHROMAT_FILE: MSMg01no075_f15.g1 PHD_FILE: MSMg01no075_f15.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:24:00 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	plural
sequence	ATXXXXXXXXXXXXXXXXXXXXXXXXCTACTCCCAAGAAATCCGCGGAAT TCTGATTTTCCCCATCAGACCCTGGGCTTATTTTTGGTTGGGAGACTATT AACGATTGCTTCTAATTCTTTAGGGGTGTTATGACCCACACTACAGTCTT GCCAGAAAGAATTCCCACAGGACACTCGGATCCTTCTGCAGTAAAGCTTT AATGCATCTCGAGAGATAGATGATCAGCTTCAGGACAGGAGACCCAGAGA GCAGAAAACCCCTCCCTTATATAGGCTGTGAAGTACAGTTAGAAGTATGG TTGGAGACGTGCACCACCGGAATTGTCTGCCCACCATCAGCCTGATGACG CCATTGGAGAGACAGGGCTCAGGTAATGGAAAGATACCCCGATGCCTGTG CACACTCACCACGAGCAATAGTGACAATGGTGTTGTGAGCACCATCTTGT AATGGTGGCCGTGAGGACGGCTCCTCACATCTCACCCTTTTCTTTTATGT TAGAAGCAACAGGCCACACAGTATGGAGAGTGGAGATAGAGGTCAAATTC CCACTGTGCAAGCATAGGGGCCTTACACAAAATCTCCTTCCAGGCTCGTC ACCCAGAGGGGTCTTGGTCAGCTCCCCTGTCGTTTTTACTGGGGGGAAGG ACACTAGGACACTCAACCA	NACGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXATTAAAAACGAACTGAAAACCAGTC TTCATTTACCTCTACCTGTTGTTAAAAGGGCAGATTCCCGAAATTTCTAT GTATAGGCTCCAATTGCCTCAAAATACAGAGGCTCCTCTCAGCCTCAGAA GTGCTGGGACTTCAGACATAATTCAGGCCAGGTTGTTGTTATTTATTTGT TGTTTTGGTTTAGGACAGTAAGCTCTAACTCTATATCTCAGGATTGTCTG AAACCTCACCTGCAGCTTTGACTGGCCTTGAAACTGAAGTCCCCAGCCTT ACAAATGTACCTGGGCCTGAGGAAATATGTGTTCTTTATTTTTTATATTT AAATTTTTGTTTGCCCGCTTGTTTGTTTGTTTGTTTTTTATTCCTTTTTT CCTTGTTGAAGATTGAAACCATAGCTTCTTGCTGTAGCAGTAAAATATTT TTCCAGCCAGAAAAACTTTATATTTTAGATCTGCTTTAGATTTGTATTAT GATGAAAAAAATTGAGGAGCTTGTTTATGATAAAAGCTACCCTGATTTCA TTTGTAAATTGAGATGTAATACAATTTACTCTAATTTTATTTTATCCTTA GAAACAATGGGTACTAATTGTTAGATTT
quality values	Open. Hide. 6 6 6 6 9 15 30 25 16 16 14 14 14 29 30 33 33 33 29 33 33 33 27 21 10 9 9 6 6 9 9 10 8 11 11 9 9 8 8 8 8 12 21 30 41 41 33 33 33 33 31 27 26 12 10 8 8 8 8 15 14 18 22 22 14 13 19 19 26 37 48 48 57 57 50 50 50 57 57 57 57 57 53 50 42 42 42 42 42 42 57 54 57 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 54 54 54 54 57 57 57 68 68 68 68 50 50 51 51 51 51 51 57 57 57 50 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 52 52 50 50 50 50 50 50 57 57 57 57 57 68 68 68 68 68 68 57 57 46 46 50 50 50 50 57 57 68 57 57 57 68 68 68 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 50 50 50 50 50 50 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 47 47 47 42 43 37 37 37 42 37 39 42 42 47 57 57 57 57 54 54 54 57 57 57 57 57 57 59 59 59 68 68 68 68 68 68 57 57 57 54 54 54 57 57 54 54 57 59 57 48 48 43 57 43 48 48 57 57 57 43 47 43 43 43 43 43 43 50 50 41 36 26 21 12 12 11 11 11 11 12 12 21 25 34 59 41 50 50 50 50 48 59 48 59 59 57 57 48 48 48 48 48 44 43 48 48 48 48 48 54 54 54 54 48 48 43 43 43 43 47 57 57 48 48 46 46 47 47 48 43 43 43 43 46 46 48 47 43 43 43 43 48 48 48 48 48 48 48 54 50 50 57 50 57 50 59 57 57 57 57 59 59 59 59 59 57 50 50 50 48 41 40 40 31 32 23 23 14 14 14 22 29 34 37 37 37 41 37 37 37 30 35 35 47 39 48 48 48 48 48 48 57 59 59 59 48 48 57 48 53 48 48 40 40 40 39 37 37 39 31 28 30 30 33 33 39 39 37 37 37 37 37 40 39 39 39 39 43 43 43 48 48 57 59 59 59 59 57 57 54 54 54 57 57 57 57 54 54 54 57 57 57 57 57 54 40 40 25 25 25 34 32 28 29 29 34 36 39 39 36 29 33 28 28 22 19 19 11 10 13 17 13 13 12 19 12 12 11 16 17 22 24 30 30 36 39 43 37 30 30 32 32 36 43 43 43 43 37 35 33 30 28 21 21 11 11 11 25 25 37 39 32 22 22 17 17 17 21 26 26 21 13 21 28 22 22 20 18 15 10 10 10 10 20 19 32 32 19 19 11 14 14 23 22 15 15 15 17 17 32 24 24 24 25 27 32 32 32 37 37 27 21 18 20 20 32 32 41 41 37 37 34 32 20 15 15 24 22 37 37 30 33 30 30 18 17 16 16 14 14 24 30 25 31 22 26 25 22 10 10 8 8 8 11 8 8 8 16 26 30 23 23 14 14 14	Open. Hide. 0 3 6 8 8 13 8 8 8 8 17 17 11 11 9 16 13 21 23 24 37 37 30 30 32 32 32 32 29 33 12 12 11 11 11 11 11 11 11 11 15 21 21 30 20 30 32 33 31 36 36 36 36 33 33 33 30 26 15 18 8 8 8 8 8 17 25 41 41 33 33 33 33 33 36 36 36 36 57 57 57 59 57 57 57 57 50 50 50 53 53 53 59 54 42 40 42 40 42 47 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 68 68 68 68 68 68 68 68 68 50 51 50 50 50 57 57 68 68 68 68 50 51 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 50 51 51 51 51 50 68 68 68 68 57 68 68 51 51 50 50 50 50 57 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 57 57 57 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 44 44 32 19 18 17 17 17 41 38 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 68 68 68 68 59 59 54 54 54 57 54 54 54 68 68 54 54 68 68 57 57 59 59 59 59 59 68 59 59 59 59 59 59 59 59 59 59 59 59 59 57 57 57 57 53 53 59 59 59 59 59 47 34 14 12 8 8 8 8 11 11 18 18 31 34 43 48 48 48 48 59 59 57 57 59 43 37 43 43 43 48 57 57 57 57 57 59 48 48 48 57 57 47 36 36 36 36 35 36 33 30 30 22 22 19 27 21 22 20 32 19 17 10 8 8 8 8 10 17 20 19 19 13 13 13 24 23 19 11 10 13 17 19 21 30 28 37 37 33 33 34 43 39 39 25 25 19 19 13 16 12 12 13 24 22 24 23 24 20 20 24 23 23 10 10 10 23 27 32 23 20 20 23 23 28 27 27 24 17 17 19 17 19 26 26 37 37 37 39 39 39 37 39 35 35 28 28 23 23 19 18 10 8 8 8 9 17 16 28 18 18 11 11 11 16 10 11 11 21 15 19 15 15 11 13 13 13 15 15 10 8 8 8 10 10 12 14 15 11 12 10 10 9 9 23 19 19 9 8 6 6 6 8 11 8 9 9 14 13 14 12 10 10 10 10 10 11 10 13 8 8 8 8 10 13 12 10 9 10 11 8 13 8 8 8 10 11 15 10 12 11 8 8 8 8 8 8 8 8 6 6 10 8 8 8 8 7 7 10 8 8 6 6 6 8 8 9 10 10 14 11

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no075_f15.g1 MSMg01no075_f15.g1 CHROMAT_FILE:
MSMg01no075_f15.g1 PHD_FILE: MSMg01no075_f15.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 17:24:00 2005
         (387 letters)



>mm_chrX_51099922_51100709
          Length = 788

 Score =  308 bits (159), Expect = 5e-88
 Identities = 295/343 (86%), Gaps = 17/343 (4%)
 Strand = Plus / Minus

                                                                       
Query: 4   aaaaacgaactgaaaaccagtcttcatttacctctacctgttgttaaaagggcagattcc 63
           |||||| ||||||| |||||||||||||| |||||||||| | || ||||| |||||| |
Sbjct: 486 aaaaacaaactgaagaccagtcttcattttcctctacctggtattgaaaggccagattgc 427

                                                                       
Query: 64  cgaaatttctatgtataggctcc-aattgcctcaaaatacagaggctcctctcagcctca 122
           |||||||| ||| |||||||||| || |||||| |||| |||||||||||||||||||||
Sbjct: 426 cgaaatttgtatatataggctccaaactgcctccaaatccagaggctcctctcagcctca 367

                                                                       
Query: 123 gaagtgctgggacttcagacataattcaggccaggttgttgtt-atttatttgttgtttt 181
           ||| ||||||||||||||||||||||||||||||| ||| ||| |||||| |||||||||
Sbjct: 366 gaaatgctgggacttcagacataattcaggccaggctgt-gtttatttatgtgttgtttt 308

                                                                       
Query: 182 ggtttagg-acagtaagctctaactctatatctcaggattgtctg-aaacctcacctgca 239
           |||||||| | ||| |||||||||||| |||||||||  ||| || ||||||||  ||||
Sbjct: 307 ggtttaggga-agtgagctctaactctgtatctcaggcgtgt-tggaaacctcatgtgca 250

                                                                       
Query: 240 gctttgactggccttgaaactgaagtccccagccttacaaatgtacctggg--cctgagg 297
           |||| ||||  |||||||| |||||||| |||||||||||||||||   ||  || ||||
Sbjct: 249 gcttggactttccttgaaagtgaagtcctcagccttacaaatgtaca--ggaaccggagg 192

                                                      
Query: 298 aaatatg--tgttctttattttttatatttaaatttttgtttg 338
           ||| |||  ||||  ||||||||||| ||||| ||||| ||||
Sbjct: 191 aaacatgcttgtt--ttattttttatttttaa-ttttt-tttg 153


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 6
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 387
Length of database: 788
Length adjustment: 9
Effective length of query: 378
Effective length of database: 779
Effective search space:   294462
Effective search space used:   294462
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information