MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-111G02
Chromosome	X (Build37)
Map Location	13,169,178 - 13,169,882
singlet/doublet	singlet
Overlap gene	Cask
Upstream gene	Atp6ap2, LOC668986, EG245347, 1810030O07Rik, Crsp2, LOC668987, LOC245350, Ppia-psx_132.1, Usp9x, LOC100043000, LOC100043002, LOC675380, Ddx3x, LOC385326, LOC634019, LOC668990, LOC100043947, LOC100043948, Nyx, LOC675416
Downstream gene	Gpr34, Gpr82, LOC385327, EG385328
Link	Open Mouse BAC browser

Click to get alignment info.

name	Atp6ap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70495 MGI:1917745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668986 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 5 Proteins pseudo : _no_value

name	EG245347 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245347 MGI:3644533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 6 Proteins

name	1810030O07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69155 MGI:1916405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crsp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26896 MGI:1349442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC668987 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC245350 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:245350
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 17 Proteins

name	Ppia-psx_132.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606727
definition	note : peptidylprolyl isomerase A pseudogene x_132.1 pseudo : _no_value

name	Usp9x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22284 MGI:894681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043000 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 2589 ESTs, 8 Proteins

name	LOC100043002 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 124 ESTs, 3 Proteins

name	LOC675380 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ddx3x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13205 MGI:103064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC385326 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 12 Proteins pseudo : _no_value

name	LOC634019 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 19 Proteins pseudo : _no_value

name	LOC668990 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins pseudo : _no_value

name	LOC100043947 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100043948 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043948
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Nyx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236690 MGI:2448607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC675416 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins pseudo : _no_value

name	Cask (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12361 MGI:1309489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23890 MGI:1346334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr82 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319200 MGI:2441734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC385327 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	EG385328 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385328 MGI:3643774
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6ap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801711 GeneID:70495 MGI:1917745
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal accessory protein 2 transcript_id : NM_027439.3

name	EG245347 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407015 GeneID:245347 MGI:3644533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 6 Proteins product : predicted gene, EG245347 transcript_id : XM_141624.4

name	1810030O07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372747 GeneID:69155 MGI:1916405
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810030O07 gene transcript_id : NM_175141.3

name	Crsp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270976 GeneID:26896 MGI:1349442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cofactor required for Sp1 transcriptional activation, subunit 2 transcript_id : NM_001048208.1

name	Crsp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270971 GeneID:26896 MGI:1349442
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cofactor required for Sp1 transcriptional activation, subunit 2 transcript_id : NM_012005.3

name	LOC245350 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407016 GeneID:245350
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 17 Proteins product : similar to Ubiquitin-conjugating enzyme E2Q (putative) 2 transcript_id : XM_141626.5

name	Usp9x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115511017 GeneID:22284 MGI:894681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 9, X chromosome transcript_id : NM_009481.2

name	LOC100043000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270990 GeneID:100043000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 2286 ESTs, 4 Proteins product : similar to ribosomal protein L3, transcript variant 2 transcript_id : XM_001477279.1

name	LOC100043000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270992 GeneID:100043000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 1965 ESTs, 4 Proteins product : similar to ribosomal protein L3, transcript variant 3 transcript_id : XM_001477304.1

name	LOC100043000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270988 GeneID:100043000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 1391 ESTs, 4 Proteins product : similar to ribosomal protein L3, transcript variant 1 transcript_id : XM_001477264.1

name	LOC100043002 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270994 GeneID:100043002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 124 ESTs, 3 Proteins product : hypothetical protein LOC100043002 transcript_id : XM_001477326.1

name	Ddx3x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129795 GeneID:13205 MGI:103064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked transcript_id : NM_010028.2

name	LOC100043947 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271049 GeneID:100043947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to preferentially expressed antigen in melanoma like 7 transcript_id : XM_001481255.1

name	Nyx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352047 GeneID:236690 MGI:2448607
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nyctalopin transcript_id : NM_173415.3

name	Cask (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133504494 GeneID:12361 MGI:1309489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent serine protein kinase (MAGUK family) transcript_id : NM_009806.2

name	Gpr34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358042 GeneID:23890 MGI:1346334
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 34 transcript_id : NM_011823.3

name	Gpr82 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802746 GeneID:319200 MGI:2441734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 82 transcript_id : NM_175669.3

name	EG385328 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77539461 GeneID:385328 MGI:3643774
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG385328 transcript_id : NM_001034100.1

name	Atp6ap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21361250 CCDS:CCDS30023.1 GeneID:70495 MGI:1917745
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : ATPase, H+ transporting, lysosomal interacting protein 1; ATPase, H+ transporting, lysosomal interacting protein 2 product : ATPase, H+ transporting, lysosomal accessory protein 2 protein_id : NP_081715.1

name	EG245347 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999881 GeneID:245347 MGI:3644533
definition	codon_start : 1 product : hypothetical protein protein_id : XP_141624.3

name	1810030O07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424732 CCDS:CCDS30024.1 GeneID:69155 MGI:1916405
definition	codon_start : 1 note : Novel transcript product : hypothetical protein LOC69155 protein_id : NP_780350.1

name	Crsp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270977 GeneID:26896 MGI:1349442
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : isoform a is encoded by transcript variant 1; cofactor required for Sp1 transcriptional activation subunit 2 (150 kDa) product : cofactor required for Sp1 transcriptional activation, subunit 2 isoform a protein_id : NP_001041673.1

name	Crsp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270972 GeneID:26896 MGI:1349442
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : isoform b is encoded by transcript variant 2; cofactor required for Sp1 transcriptional activation subunit 2 (150 kDa) product : cofactor required for Sp1 transcriptional activation, subunit 2 isoform b protein_id : NP_036135.3

name	LOC245350 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51830637 GeneID:245350
definition	codon_start : 1 product : similar to Ubiquitin-conjugating enzyme E2Q (putative) 2 protein_id : XP_141626.3

name	Usp9x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115511018 GeneID:22284 MGI:894681
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005544 - calcium-dependent phospholipid binding [Evidence IEA]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : fats facets protein related, X; ubiquitin specific protease 9 SSSRF- isoform product : ubiquitin specific protease 9, X chromosome protein_id : NP_033507.2

name	LOC100043000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270989 GeneID:100043000
definition	codon_start : 1 product : similar to ribosomal protein L3 isoform 1 protein_id : XP_001477314.1

name	LOC100043000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270991 GeneID:100043000
definition	codon_start : 1 product : similar to ribosomal protein L3 isoform 2 protein_id : XP_001477329.1

name	LOC100043000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270993 GeneID:100043000
definition	codon_start : 1 product : similar to ribosomal protein L3 isoform 3 protein_id : XP_001477354.1

name	LOC100043002 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270995 GeneID:100043002
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477376.1

name	Ddx3x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753620 CCDS:CCDS30027.1 GeneID:13205 MGI:103064
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004004 - ATP-dependent RNA helicase activity [Evidence ISS]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003724 - RNA helicase activity [Evidence IEA] codon_start : 1 note : D-E-A-D (aspartate-glutamate-alanine-aspartate) box polypeptide 3; DEAD (aspartate-glutamate-alanine-aspartate) box polypeptide 3; embryonic RNA helicase; fibroblast growth factor inducible 14 product : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked protein_id : NP_034158.1

name	LOC100043947 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271050 GeneID:100043947
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481305.1

name	Nyx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734150 GeneID:236690 MGI:2448607
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 note : no b wave product : nyctalopin protein_id : NP_775591.1

name	Cask (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133504495 GeneID:12361 MGI:1309489
definition	GO_component : GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IDA]; GO:0019717 - synaptosome [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : calcium/calmodulin-dependent serine protein kinase protein_id : NP_033936.2

name	Gpr34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560528 CCDS:CCDS30028.1 GeneID:23890 MGI:1346334
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : G-protein-coupled receptor product : G protein-coupled receptor 34 protein_id : NP_035953.2

name	Gpr82 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316782 CCDS:CCDS30029.1 GeneID:319200 MGI:2441734
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor GPR82 product : G protein-coupled receptor 82 protein_id : NP_783600.1

name	EG385328 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77539462 GeneID:385328 MGI:3643774
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : novel protein similar to histone 1, H2a Hist1h2a product : hypothetical protein LOC385328 protein_id : NP_001029272.1

name	LOC668987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668987
definition	number : 1 pseudo : _no_value

name	LOC668987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668987
definition	number : 2 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 1 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 2 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 3 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 4 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 5 pseudo : _no_value

name	LOC100043948 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043948
definition	number : 1 pseudo : _no_value

name	LOC385327 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385327
definition	number : 3 pseudo : _no_value

name	LOC385327 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385327
definition	number : 2 pseudo : _no_value

name	LOC385327 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385327
definition	number : 1 pseudo : _no_value

name	LOC668986 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271046 GeneID:668986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 5 Proteins product : similar to Nol5a protein pseudo : _no_value transcript_id : XR_035069.1

name	LOC385326 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271047 GeneID:385326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 12 Proteins product : similar to Chaperonin subunit 7 (eta) pseudo : _no_value transcript_id : XR_035070.1

name	LOC634019 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270996 GeneID:634019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 19 Proteins product : similar to glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_033207.1

name	LOC668990 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271048 GeneID:668990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins product : similar to vitamin D receptor interacting protein pseudo : _no_value transcript_id : XR_035071.1

name	LOC675416 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271051 GeneID:675416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins product : similar to E1B 19K/Bcl-2-binding protein homolog pseudo : _no_value transcript_id : XR_035072.1

clone name	MSMg01-378C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126N19
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-111G02.T7 (MSMg01no111_g02.b1)	MSMg01-111G02.TJ (MSMg01no111_g02.g1)
ACC	AG324064	AG324065
length	1,174	1,187
length of high quality (start - end)	712 (87 - 798)	707 (83 - 789)
definition	CHROMAT_FILE: MSMg01no111_g02.b1 PHD_FILE: MSMg01no111_g02.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:15:37 2005	CHROMAT_FILE: MSMg01no111_g02.g1 PHD_FILE: MSMg01no111_g02.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:15:37 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	TAATCACNNNNNGACACTGGGCGCTATAGACTCCTATAGGGAGAGGATCC GCGGAATTCTCACCTGAGGAATACTCATTGAGTGACAAGCACCTGGAAAA ATGTTCAGCATCCTTCATCATCAGGGAAATGCAAATCAAAACAACCCTGA GTATTCCACCTCACACCAGTCAGAATGGCTAAGATCAAAAATTCAGGTGA CAGCAGATGCTGGCGAGGATGTGTAGAAAGAGGAACACTCCTCTATTGTT GGTGGGATTGCAAGCTTGTACAACCACTCTGGAAATCAGTCTGGCGGTTC CTCAGAAAATTAGACATAGTACTACCGGAGGATCCAGCAACACCTCTCCT GTGCATACATCCAAGAAGATGTCCCAACCGGTAAGAAGGACACATGCTTC ACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAGCTGGAACGAACC CAGATGTCCCTAAACAGAGGAATGGATACAGAAAATGTGGTAATTTACAC AATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAG GCAAATGGATGGACCTGGAGGGCATCATCCTGAGTGAGGTAACCCAATCA CAAAAGAACTCACATGATATGTACTCACTGATAAGTGGATATTAGCCTAG ATACTTAGAATACCCAAGATATAAGATACAATTTGTGATTGAAACTCATG AAACTCAAGAAGAACGAAGACCAAAGTGTGGACACTGTGCCCCTTCTTAG AATTGGGAACAAAACACCCATGGAAGGAGTTATAGAGACAAAGTTTGGAG CGGAAACAAAAGGATGGAGCATCTAGAGACCTGCCTATCTGGGGATCCAT ACCATAATCAGCCTCCAAACGCTGACCCCATTGCATACACTCACAAGATT TTGCTGAAAGGACCCTGATATAGCTGTCTCTTGTGAAACTATGCCGGGGC CTAGCAACCCCAGAAGTGGATACTTCCAGGTGGAATGAAATTCCCAAGCC AAATAAATGGACCTGGCAGGGGCATCCTCCCTGAAGTGGAGGTAACCCCA ATCCCCAAAAAAAACCTCCCATGAATATGGTACTCCCTGGGGGGGGGGGG ATTTTTTCCCCCAAAAACGCGATTTATTCCCCCCGATATTTAGAAATATT TGGATCCTCATTTTGTTAAAAACC	CAATAACNTTNTTCGCAGCGAGNCXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXCCATTTTAACTCCAGCTCATCTCGCTT TCACAGGCACATGTCCACAGGTATATATAGCCATGCACATACTCACATAA ATAATAATTTTTTTTAAAAAGGCAAGTAGTGGTGACACATGCCTTTAATC TCAGCACTCAGGAGACAGATTTCTGAGTTCAAGGCCAGCATGATCTACAG AGTGATTTTTCAGGATACCCAAGGCTACACAGAAAAACCCTGTCTTGAAA AACAAATGATAAAAATAAAAGTGTGGCCCAAATGCTAAAAAGAACCTCAT ATGGTAAATACAAATTGGAATTAAGAAGAAAATAGAGTTATTGCAAAGCA CAGCATTACTGAACACATGATTCAGGTGCATTGCTGAAGGTAATCTGTGG TTTGAGGTAATAGAGAAGAGCACTGCAACAGGAGTCCCAGGTGGGTGCTG GGATTCATTCCTCTGCTCCCTGTCTGTTTGTGGCCCTTGGATAGGTTATT GAACCCTCATAATATGCCTCTAGTTTTTCAAATACAAAAGCACTTGCCTA CATAGCAGGTTATTGTAAAGTCACATAAGATAGCAAGGATAAAAACATAA ATTGTCATATGTGTGTGTTATTATGAAGATAATTTCCATTATGATTTTTT TTTCTGTGCATGGTAGCTCACACCTGTAATCCCATCTCTTGGGAACACGA GACAAGAAAATCAGGAACTTGAGGTCATCCTGAACTATATAGTGAGACTC TATGTCCAAAAAAATATTTTTTTCCTATGGGTAAACCATCTATTCTAATC CTTACCTCTAAATTCTTAAAAATTTGTTCAGGAAAAATCAAGGACCCTTT TGAAGCATCCTTTCTCAACCAGAAATTCTAAAAATCCTAGCCCAAAACCC AAGAACTGAATAGGGGTGCCTGGGGGTTATGCCATTTAAAAAACTTATCT CCCTAAAAAAAAGCTTGTGGAACCTACTTAAAGGTCTGAATTTTTTGTAA GGGCAATTTAAAAAATTTTACTTCCAAGGGTTTTTTATAAGGGAAAATAA AATTCTTCTTTTCAAACTCTTTGGGAAAAAAAAATGGCCCTTGGGGTTCT CCAATATTGTGCAACAAATATTTGTTTCCCTCACCGC
quality values	Open. Hide. 6 8 8 8 8 8 3 0 0 0 0 0 3 9 9 9 7 7 8 8 10 12 12 11 8 8 8 8 8 17 19 10 8 8 11 12 16 24 26 35 30 24 28 28 33 36 37 37 40 43 48 43 42 42 43 43 50 50 50 50 50 36 36 36 31 31 31 31 31 33 37 25 21 9 9 9 9 9 11 12 10 11 12 18 12 12 14 26 25 37 31 31 31 31 33 36 53 57 57 59 57 57 57 53 53 53 50 44 39 37 37 23 19 8 8 8 8 8 13 16 21 26 26 37 37 48 48 48 48 59 59 59 39 32 30 33 33 40 40 57 57 57 57 57 50 50 50 50 50 42 43 47 47 51 68 68 68 68 68 68 68 68 68 68 68 68 50 50 51 51 50 48 57 57 57 59 68 50 50 50 51 50 57 59 59 59 57 57 59 59 59 59 57 48 48 57 57 57 68 68 68 68 59 57 59 59 59 59 59 68 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 68 68 68 68 59 59 57 57 57 57 57 59 57 57 68 68 57 57 68 68 57 57 57 57 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 68 68 68 57 57 57 57 57 59 59 59 59 59 59 59 59 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 68 68 68 68 68 68 68 62 62 62 62 52 52 62 62 68 68 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 43 43 39 39 43 39 39 43 44 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 68 68 62 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 62 62 62 62 62 52 52 52 62 62 62 62 62 62 68 62 62 62 52 52 62 62 62 62 62 62 62 62 62 62 52 52 62 62 62 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 62 52 52 57 59 59 59 57 57 59 59 68 68 68 68 68 57 57 57 57 57 57 57 59 59 59 59 59 59 59 59 59 59 57 57 59 59 59 59 57 57 57 57 57 57 57 57 57 57 57 57 52 57 57 57 57 68 59 59 57 57 57 59 59 68 57 57 57 57 57 57 57 57 54 57 52 57 52 50 47 47 57 50 54 54 54 54 57 57 54 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 59 59 57 57 57 54 47 57 57 57 57 57 57 54 54 44 44 40 25 28 25 31 42 42 50 54 59 59 59 59 59 48 48 48 48 48 57 57 57 48 48 48 48 48 57 57 59 43 43 36 36 43 43 43 43 46 47 59 59 41 30 22 19 17 17 21 23 32 23 23 28 34 34 41 40 37 36 41 37 47 37 35 31 31 31 31 31 26 31 35 34 30 28 25 24 20 20 24 24 21 22 22 31 32 41 39 37 37 39 37 39 37 39 32 31 31 41 59 59 41 46 30 31 30 37 31 35 37 39 37 36 32 25 27 32 29 27 33 28 28 28 28 34 33 27 27 22 25 27 39 39 37 36 36 32 29 17 19 10 12 11 9 9 10 13 19 30 32 32 31 29 17 18 18 14 14 11 18 18 19 27 19 19 22 31 32 29 25 33 32 19 19 23 22 11 11 15 18 23 10 10 10 14 13 10 8 8 11 8 9 12 19 21 30 25 35 22 21 15 13 21 19 26 23 18 17 11 11 9 10 10 13 13 24 13 19 11 12 13 16 17 21 21 21 23 18 19 9 10 8 8 8 9 9 19 14 23 24 23 31 15 17 11 9 9 9 9 9 14 16 12 9 9 13 9 10 10 18 16 28 32 25 27 32 32 32 18 15 8 8 8 19 22 14 12 12 8 8 10 10 8 10 11 18 18 18 17 11 10 10 9 11 10 9 10 10 10 10 16 16 11 10 10 10 12 11 10 9 9 9 8 8 10 10 10 10 8 8 8 8 8 8 9 9 9 9 9 8 8 8 8 10 11 8 8 8 8 9 9 10 13 13 9 8 9 9 10 16 9 10 10 10 10 11 17 17 14 14 19 11 11 10 13 11 18 22 24 17 14 9 8 8 10 8 14 13 10 9 9 10 10 9 10 9 9 9 14 10 10 8 8 6 6 6 8 9 13 13 11 10 10 11 16 17 18 9 9 10 7 13 7 9 10 10 16 16 23 19 16 15 11 11 10 13 10 11 8 8 8 8 8 8 8 9 9 9 9 9 12 13 12 10 10 12 12 18 17 15 16 16 28 15 16 11 11 11 11 11 16 12 11 11 12 11 9 13 8 8 8 10 13 10 8 8 6 8 6 6 6 6 8 8 8 10 10 21 13 16 11 10 10 8 8 8 8 8 8 8 8 8 6 6 8 8 14 9 8 8 8 8 8 6 7 7 12 13 16 11 10 8 8 8 8 13 7 7 8 8 8	Open. Hide. 8 8 8 8 9 9 3 0 3 3 0 3 6 6 6 6 6 6 6 6 8 3 0 3 6 6 8 8 8 8 13 8 8 9 9 16 12 21 22 20 22 21 28 28 31 29 35 28 28 28 28 28 35 37 37 37 35 35 35 35 36 36 36 31 41 37 50 47 47 34 19 10 9 9 9 7 9 9 10 10 11 13 17 24 30 30 33 33 33 33 36 36 50 50 50 50 50 50 50 50 50 57 53 50 50 50 50 50 37 30 22 21 10 9 9 9 11 11 17 18 18 18 18 28 33 33 36 36 38 38 36 39 39 32 36 30 43 43 53 53 53 53 53 57 57 68 68 68 68 47 47 47 47 47 68 68 68 68 68 68 68 68 51 50 50 50 68 50 68 68 68 68 68 68 68 68 57 57 57 57 57 57 48 48 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 57 57 57 57 57 52 57 57 57 57 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 68 68 68 68 68 68 59 59 59 59 59 59 57 57 57 59 59 59 59 59 57 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 62 62 68 68 62 62 62 68 62 62 62 62 62 62 62 62 62 62 62 52 52 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 62 68 68 68 68 62 62 62 62 62 62 39 62 62 44 44 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 44 39 23 14 14 27 39 43 52 43 44 62 62 62 62 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 68 62 62 62 62 62 62 62 62 52 52 52 52 62 62 62 62 62 52 52 62 62 62 62 41 43 43 52 52 52 62 62 62 62 62 62 62 52 52 52 62 62 62 62 62 52 62 62 62 52 62 62 62 52 45 45 62 62 62 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 68 68 68 68 62 62 62 62 57 59 59 59 59 59 57 57 57 57 57 57 57 59 57 57 57 52 52 57 59 59 59 59 57 57 57 59 59 59 59 59 59 59 59 59 68 68 68 68 68 68 57 57 57 57 57 57 59 59 59 59 59 59 57 57 57 57 68 68 59 59 59 59 59 57 57 57 54 57 57 59 59 57 57 57 57 57 48 46 57 59 59 54 57 57 44 44 42 44 43 59 47 57 48 47 47 46 46 44 44 42 44 40 37 28 36 36 40 36 37 37 35 35 35 44 48 57 57 47 43 43 47 47 48 54 59 54 54 54 54 54 54 59 54 54 57 57 54 54 48 48 48 48 48 48 59 48 48 48 59 57 57 57 57 57 48 57 57 57 57 48 48 48 48 47 50 47 41 43 18 17 15 16 19 21 37 37 37 41 46 39 39 39 37 41 39 39 39 31 34 39 41 34 34 34 34 41 47 46 46 39 39 37 37 37 37 43 43 47 41 46 46 37 30 30 30 28 20 28 28 24 29 28 30 22 24 22 22 22 28 28 37 30 30 33 37 39 39 32 28 20 17 22 21 28 30 34 32 30 28 24 25 24 28 30 37 37 37 31 28 20 15 25 11 11 11 21 20 28 24 24 21 21 24 24 21 22 24 28 28 28 28 25 25 35 37 30 30 33 30 30 17 15 19 25 26 37 37 37 32 25 25 15 13 13 15 10 14 15 10 10 15 17 30 14 14 14 17 17 30 20 15 12 12 16 21 28 30 23 19 10 10 10 17 16 30 25 27 32 29 32 20 12 9 9 8 8 8 20 9 9 9 15 13 13 13 23 20 14 9 9 9 14 10 13 11 17 17 19 19 23 16 13 10 12 8 10 11 11 19 10 10 10 17 17 9 12 12 17 12 12 12 12 11 10 10 10 10 10 8 8 10 13 14 14 12 12 12 18 11 9 8 8 8 10 8 8 10 16 17 18 17 13 13 12 10 10 10 10 9 9 9 8 10 10 9 8 8 10 10 15 13 8 8 8 8 8 10 8 8 8 8 8 8 8 8 8 13 16 13 13 14 23 13 14 13 11 11 8 8 8 8 8 8 10 10 10 9 9 8 8 12 16 16 28 22 18 16 12 10 10 10 13 9 10 10 10 11 9 8 8 8 12 12 20 15 15 18 10 9 9 9 9 9 10 10 11 12 30 23 15 8 8 8 8 8 8 8 8 11 15 12 11 10 10 10 8 8 10 8 9 9 14 13 9 8 8 8 8 8 8 9 9 9 9 9 14 22 31 39 23 15 8 8 8 8 10 10 8 8 10 11 10 9 11 10 15 12 10 10 11 10 8 8 8 10 8 9 14 12 15 12 12 11 11 11 9 8 8 8 8 8 9 9 9 11 11 31 22 9 9 9 9 9 12 10 6 6 6 6 8 8 8 8 8 8 8 8 8 9 10 8 8 10 8 10 8 8 6 6 6 6 11 12 10 9 9 10 12 10 6 6 8 8 10 8 8 8 10 8 8 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no111_g02.g1 MSMg01no111_g02.g1 CHROMAT_FILE:
MSMg01no111_g02.g1 PHD_FILE: MSMg01no111_g02.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 18:15:37 2005
         (707 letters)



>mm_chrX_13169084_13170190
          Length = 1107

 Score = 1324 bits (685), Expect = 0.0
 Identities = 701/707 (99%), Gaps = 2/707 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctccagctcatctcgctttcacaggcacatgtccacaggtatatatagccatgcacatac 60
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 799 ctccagctcatctcgctttcacaggcacatgtacacaggtatatatagccatgcacatac 740

                                                                       
Query: 61  tcacataaataataattttttttaaaaaggcaagtagtggtgacacatgcctttaatctc 120
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 739 tcacataaataataatttttttttaaaaggcaagtagtggtgacacatgcctttaatctc 680

                                                                       
Query: 121 agcactcaggagacagatttctgagttcaaggccagcatgatctacagagtgatttttca 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 679 agcactcaggagacagatttctgagttcaaggccagcatgatctacagagtgatttttca 620

                                                                       
Query: 181 ggatacccaaggctacacagaaaaaccctgtcttgaaaaacaaatgataaaaataaaagt 240
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 619 ggatacccacggctacacagaaaaaccctgtcttgaaaaacaaatgataaaaataaaagt 560

                                                                       
Query: 241 gtggcccaaatgctaaaaagaacctcatatggtaaatacaaattggaattaagaagaaaa 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 559 gtggcccaaatgctaaaaagaacctcatatggtaaatacaaattggaattaagaagaaaa 500

                                                                       
Query: 301 tagagttattgcaaagcacagcattactgaacacatgattcaggtgcattgctgaaggta 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 499 tagagttattgcaaagcacagcattactgaacacatgattcaggtgcattgctgaaggta 440

                                                                       
Query: 361 atctgtggtttgaggtaatagagaagagcactgcaacaggagtcccaggtgggtgctggg 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 439 atctgtggtttgaggtaatagagaagagcactgcaacaggagtcccaggtgggtgctggg 380

                                                                       
Query: 421 attcattcctctgctccctgtctgtttgtggcccttggataggttattgaaccctcataa 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 379 attcattcctctgctccctgtctgtttgtggcccttggataggttattgaaccctcataa 320

                                                                       
Query: 481 tatgcctctagtttttcaaatacaaaagcacttgcctacatagcaggttattgtaaagtc 540
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 319 tatgcctctagtttttcaaatacaaaagcacttgcctacatagcaggttattgtaaagtc 260

                                                                       
Query: 541 acataagatagcaaggataaaaacataaattgtcatatgtgtgtgttattatgaagataa 600
           |||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 259 acataagatagcaaggataaaaacataaattgtcata--tgtgtgttattatgaagataa 202

                                                                       
Query: 601 tttccattatgatttttttttctgtgcatggtagctcacacctgtaatcccatctcttgg 660
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 tttccattatgatttttttttctgtgcatggtagctcacacctgtaatcccatctcttgg 142

                                                          
Query: 661 gaacacgagacaagaaaatcaggaacttgaggtcatcctgaactata 707
           || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 141 gaccacgagacaagaaaatcaggaacttgaggtcatcctgaactata 95


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 36
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 707
Length of database: 1107
Length adjustment: 10
Effective length of query: 697
Effective length of database: 1097
Effective search space:   764609
Effective search space used:   764609
X1: 9 (17.8 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 9 (18.3 bits)
S2: 9 (18.1 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information