MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-171L19
Chromosome	X (Build37)
Map Location	33,465,083 - 33,465,399
singlet/doublet	singlet
Overlap gene	Dock11
Upstream gene	LOC100039550, LOC100039557, LOC100039573, EG665074, LOC100039585, LOC100039497, EG210457
Downstream gene	Il13ra1, Zcchc12, LOC547166, Lonrf3, EG621901, Pgrmc1, B230333C21Rik, LOC621983, Slc25a43, Slc25a5, C330007P06Rik, Ube2a, Nkrf, Sept6
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039550 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 16 ESTs, 5 Proteins

name	LOC100039557 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs

name	LOC100039573 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	EG665074 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665074 MGI:3648576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 62 ESTs

name	LOC100039585 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 16 ESTs, 5 Proteins

name	LOC100039497 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG210457 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210457 MGI:3648336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins

name	Dock11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75974 MGI:1923224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il13ra1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16164 MGI:105052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zcchc12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72693 MGI:1919943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC547166 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547166
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 8 Proteins pseudo : _no_value

name	Lonrf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74365 MGI:1921615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621901 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621901 MGI:3644556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Pgrmc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53328 MGI:1858305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B230333C21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338351 MGI:2443758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC621983 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 514 ESTs, 10 Proteins pseudo : _no_value

name	Slc25a43 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194744 MGI:2684854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 2 Proteins

name	Slc25a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11740 MGI:1353496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330007P06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77644 MGI:1924894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 231 ESTs, 4 Proteins

name	Ube2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22209 MGI:102959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nkrf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77286 MGI:1924536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sept6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56526 MGI:1888939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039550 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271482 GeneID:100039550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : Xlr-related, meiosis regulated Xmr, transcript variant 2 transcript_id : XM_001473275.1

name	LOC100039550 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271480 GeneID:100039550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : Xlr-related, meiosis regulated Xmr, transcript variant 1 transcript_id : XM_001473259.1

name	LOC100039557 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271484 GeneID:100039557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs product : hypothetical protein LOC100039557 transcript_id : XM_001473294.1

name	EG665074 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271491 GeneID:665074 MGI:3648576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 62 ESTs product : predicted gene, EG665074 transcript_id : XM_974384.2

name	LOC100039585 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271489 GeneID:100039585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : similar to XMR, transcript variant 2 transcript_id : XM_001473346.1

name	LOC100039585 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271487 GeneID:100039585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : similar to XMR, transcript variant 1 transcript_id : XM_001473331.1

name	EG210457 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83000804 GeneID:210457 MGI:3648336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : predicted gene, EG210457 transcript_id : XM_141682.3

name	Dock11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125660463 GeneID:75974 MGI:1923224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dedicator of cytokinesis 11 transcript_id : NM_001009947.3

name	Il13ra1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129910 GeneID:16164 MGI:105052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 13 receptor, alpha 1 transcript_id : NM_133990.4

name	Zcchc12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803251 GeneID:72693 MGI:1919943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCHC domain containing 12 transcript_id : NM_028325.2

name	Lonrf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043954 GeneID:74365 MGI:1921615
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LON peptidase N-terminal domain and ring finger 3 transcript_id : NM_028894.1

name	EG621901 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407282 GeneID:621901 MGI:3644556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG621901 transcript_id : XM_896717.2

name	Pgrmc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131178 GeneID:53328 MGI:1858305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : progesterone receptor membrane component 1 transcript_id : NM_016783.3

name	B230333C21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126432545 GeneID:338351 MGI:2443758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B230333C21 gene transcript_id : NM_001081956.1

name	Slc25a43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407274 GeneID:194744 MGI:2684854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 2 Proteins product : solute carrier family 25, member 43, transcript variant 1 transcript_id : XM_110743.5

name	Slc25a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360208 GeneID:11740 MGI:1353496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 5 transcript_id : NM_007451.3

name	C330007P06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271496 GeneID:77644 MGI:1924894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 230 ESTs, 4 Proteins product : RIKEN cDNA C330007P06 gene, transcript variant 2 transcript_id : XM_895881.3

name	Ube2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130597 GeneID:22209 MGI:102959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2A, RAD6 homolog (S. cerevisiae) transcript_id : NM_019668.3

name	Nkrf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78191783 GeneID:77286 MGI:1924536
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NF-kappaB repressing factor transcript_id : NM_029891.2

name	Sept6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382370 GeneID:56526 MGI:1888939
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : septin 6 transcript_id : NM_019942.3

name	LOC100039550 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271481 GeneID:100039550
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001473309.1

name	LOC100039550 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271483 GeneID:100039550
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001473325.1

name	LOC100039557 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271485 GeneID:100039557
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473344.1

name	LOC100039585 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271488 GeneID:100039585
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001473381.1

name	LOC100039585 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271490 GeneID:100039585
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001473396.1

name	EG665074 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271492 GeneID:665074 MGI:3648576
definition	codon_start : 1 product : hypothetical protein protein_id : XP_979478.2

name	EG210457 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83000805 GeneID:210457 MGI:3648336
definition	codon_start : 1 product : similar to testis derived transcript protein_id : XP_141682.3

name	Dock11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125660464 GeneID:75974 MGI:1923224
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0051020 - GTPase binding [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0017048 - Rho GTPase binding [Evidence IPI]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IDA] codon_start : 1 note : spleen specific 238 kDa protein with PH domain product : dedicator of cytokinesis 11 protein_id : NP_001009947.2

name	Il13ra1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254373 CCDS:CCDS30057.1 GeneID:16164 MGI:105052
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 product : interleukin 13 receptor, alpha 1 protein_id : NP_598751.3

name	Zcchc12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312230 CCDS:CCDS30058.1 GeneID:72693 MGI:1919943
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, CCHC domain containing 12 protein_id : NP_082601.1

name	Lonrf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043955 CCDS:CCDS30059.1 GeneID:74365 MGI:1921615
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0004176 - ATP-dependent peptidase activity [Evidence IEA]; GO:0005185 - neurohypophyseal hormone activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006510 - ATP-dependent proteolysis [Evidence IEA] codon_start : 1 product : ring finger protein 127 protein_id : NP_083170.1

name	EG621901 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407283 GeneID:621901 MGI:3644556
definition	codon_start : 1 product : similar to Novel transcript protein_id : XP_901810.2

name	Pgrmc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980806 CCDS:CCDS30060.1 GeneID:53328 MGI:1858305
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA] codon_start : 1 product : progesterone receptor membrane component protein_id : NP_058063.2

name	B230333C21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126432546 GeneID:338351 MGI:2443758
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : Talia protein_id : NP_001075425.1

name	Slc25a43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086109 GeneID:194744 MGI:2684854
definition	codon_start : 1 product : similar to novel mitochondrial carrier domain-containing protein isoform 1 protein_id : XP_110743.3

name	Slc25a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094075 CCDS:CCDS30062.1 GeneID:11740 MGI:1353496
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006839 - mitochondrial transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : adenine nucleotide translocator 2, fibroblast; adenine nucleotide translocase product : solute carrier family 25, member 5 protein_id : NP_031477.1

name	C330007P06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83000747 GeneID:77644 MGI:1924894
definition	codon_start : 1 product : hypothetical protein LOC77644 isoform 2 protein_id : XP_900974.1

name	Ube2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790041 CCDS:CCDS30064.1 GeneID:22209 MGI:102959
definition	GO_component : GO:0000785 - chromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004840 - ubiquitin conjugating enzyme activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0006464 - protein modification [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : ubiquitin-conjugating enzyme HR6A; ubiquitin-conjugating enzyme E2A (RAD6 homolog) product : ubiquitin-conjugating enzyme E2A, RAD6 homolog protein_id : NP_062642.1

name	Nkrf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78191784 CCDS:CCDS30065.1 GeneID:77286 MGI:1924536
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003725 - double-stranded RNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : NF-kappaB repressing factor protein_id : NP_084167.2

name	Sept6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560370 CCDS:CCDS30066.1 GeneID:56526 MGI:1888939
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA] codon_start : 1 product : septin 6 protein_id : NP_064326.2

name	LOC100039497 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039497
definition	number : 1 pseudo : _no_value

name	LOC100039573 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271486 GeneID:100039573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : similar to XMR pseudo : _no_value transcript_id : XR_031148.1

name	LOC547166 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271479 GeneID:547166
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 8 Proteins product : similar to 60S ribosomal protein L13a (Transplantation antigen P198) (Tum-P198 antigen) pseudo : _no_value transcript_id : XR_031016.1

name	LOC621983 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271495 GeneID:621983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 514 ESTs, 10 Proteins product : similar to Ribosomal protein L7 pseudo : _no_value transcript_id : XR_031283.1

clone name	MSMg01-108P19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-355A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389D06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-455B06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-272H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260L12
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-171L19.T7 (MSMg01no171_l19.b1)	MSMg01-171L19.TJ (MSMg01no171_l19.g1)
ACC	AG367880	AG367881
length	749	878
length of high quality (start - end)	321 (46 - 366)	---
definition	CHROMAT_FILE: MSMg01no171_l19.b1 PHD_FILE: MSMg01no171_l19.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 19:42:01 2005	CHROMAT_FILE: MSMg01no171_l19.g1 PHD_FILE: MSMg01no171_l19.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 19:42:01 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	TCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGG AATTCCAAGACCTGAACAGTGAGCACTTTCAATCAGTCACAGGCAATTAG CCTCCTTCTAAGGAGACTTCTAAAGCTCCAGCAACAATTTTCCCTGGCTC AGAGACCCATTGCCAAACTGTCCACTAGAAGGCCCAGAGAGAAACACAGG AGGGCACAGCAGAACCACTCAGAGCTGAAAGGATTATTAAGAGTCTTCAA AGATGTATGCCTCAGCTGCAGGGCCCTGTGTATATTCTGACAATAGTCAG AGACTCCCTGATCCTGCTATATACTGCTCATGCTATTCTAGCTGGAGCCA GCCTTGCTGACCCCAGTTNCTCAGTTCTTNNTCGAGNNCGCTCCCATGGT GTGGCTGGAGCCCAAGAACCACTGCTGCTGAAAACAAAAATAGTGACNGA ATGCCTGCTGTGGAGCTGTGTTTGCCCTAGCTCAGAGGCCTTTTCTATTT TTCTTCTAATAGGGGATGAAGACTGGGAAGGCTCACTAAGTAGATGTCAG CATGCCACTTGCACAGGAAGTGGTAGAAAATGACTGTTAACCGACAAAGG CTAAGTGGTTAAATAAAATATGGAGAAATTAAAATAACAGCTTTCCTTAA AGCTGTGGATGTGATGCGTGCGTGTTTTACCTAATTAACTACCATATTAA CTTGCCACTTTTCACCCTCCCGTTTTACCACCCTTCTATTTTCTCCCTT	CTCCTATAAGGAATATATATTTTTTNTATTCTCTTATTCAGTTTTCAACC ACTCGCCTATCTTTATTTATCTTTTTATTTATTCTTACACTATAATAACA ATCGTATTCCCATCTATAATTGTATCTTACGGTTCTTTCTCCTTTTTATC TTGCCTTTCCTTATCCTTCTTGTCATTTTTTCCGAATAACTCTACAGGAC ATACCATCCCTCCTTTTTTTTTTNNNNNNNNCTCCGGCGCGCCCCCAATA AAATGTGCCCCATTAGGTGGTGNNGGGNTTAAGAGGNCCCCCTTTGGGNC CGGGGACCCGGCCCCTTGGGGNCCCGGTTTCGNAAACATTTTTNAGGGGN TGGAAACACTTATCAGGAAAGGNAATCCCGNCGGGNAAAATTCCCCCTTG GNAATAGGGTGGGAATGGGTTTAGCCCAAAAAAAGTTTATTCAAAATTTA CCCCATTATTATCTAACCTATAGGGTCCATAAGAATTTATTATTTAGAAA GTAAGGCCCTAAAAGTGAAGGATGCCTTCAATTCCCACCTTTAAAAAGGG GGGGAACCAAAAAAATTCCTTGTGGAACCCAAAAGGTAATAAAAGTTTCC CCTGAAAAGGGGAAAAAAAAAAAAGGGTGAAAAAGGAAAAAAACCCCCCG GATTTGTGGGTTTTAAGGGGAAAAAACAATGGGGGGAAGTGTGGCCTCCT AGAAAGCCCCCCGGTATCAAAAATTTGTTTTTTTTTTCCAACCCCACCCC CCTCCTAAAAAAAAGGGGGGCGCCCCCAAAGGAGATTTAAANNTTTAAAG AATCAAANNAAAACAAAAAAAAACCCCGCGGTGAGTTTGTTGTTTTGTTG GTTTATGTATATTTTTTGGTTTGGGACC
quality values	Open. Hide. 7 10 6 9 9 11 15 36 37 37 33 32 30 28 28 30 30 30 30 33 33 33 33 43 48 36 36 36 36 36 36 47 53 47 57 43 43 43 48 48 26 29 15 15 15 33 41 57 54 41 42 42 47 68 68 50 50 47 50 57 57 57 68 68 50 50 48 57 47 47 48 57 57 68 68 68 68 51 51 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 38 38 18 18 21 18 18 27 44 43 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 68 68 59 57 57 68 68 68 68 68 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 50 50 50 50 51 68 68 68 68 68 57 57 54 54 57 59 59 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 68 68 57 57 57 57 57 59 59 53 53 53 53 53 57 57 53 53 53 53 53 50 59 59 41 37 21 21 11 12 12 13 13 13 21 30 32 59 59 59 59 59 59 59 59 59 59 59 59 59 59 57 57 59 59 59 59 59 50 50 41 34 30 20 15 8 6 6 3 0 3 9 9 9 9 9 18 9 9 3 0 0 3 9 6 6 3 0 0 3 15 12 25 28 47 59 59 59 48 48 48 48 57 57 57 57 57 57 57 57 57 53 57 57 57 57 57 57 57 57 37 34 28 28 28 28 32 31 28 20 21 25 17 17 9 11 8 10 9 8 11 11 9 11 11 12 27 3 0 3 23 22 34 31 31 35 35 39 37 39 43 43 35 35 35 39 39 47 47 47 48 59 48 57 57 57 57 57 68 59 59 57 57 57 48 48 57 59 57 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 59 68 57 57 43 42 37 37 30 30 32 37 40 36 41 37 46 46 57 57 47 47 39 39 32 28 28 28 32 40 33 30 30 37 37 39 39 39 36 36 39 43 37 37 28 28 28 37 41 48 47 41 41 37 37 37 43 43 41 41 36 37 41 43 44 37 35 37 37 37 34 34 31 30 30 37 37 39 37 37 30 29 17 17 19 15 24 15 12 12 12 16 10 10 10 12 12 17 20 17 11 11 11 16 15 20 20 31 30 28 18 18 23 28 19 17 10 10 10 15 19 34 22 22 22 30 24 24 25 28 34 36 37 37 33 16 11 10 9 8 8 8 8 8 8 10 11 13 15 10 12 13 9 8 8 8 8 8 10 11 8 6 6 6 6 8 10 8 8 12 8 8 8 8 11 8 8 8 9 10 8 8 8 8 9 12 15 9 10 9 9 9 6 8 6 6 8 10 16 14 11 10 8 8 10 12 10 10 8 8 8 8 17 19 16 15 11 11 11 13 12 16 14 8 8 8 6 6 8 8 8 6 6 8 13 15 12 12	Open. Hide. 8 8 10 10 21 18 13 11 10 9 9 8 8 6 8 8 8 11 11 11 15 13 7 7 3 0 3 7 8 6 6 8 8 8 8 8 8 6 6 6 6 7 17 17 13 8 8 6 6 8 6 6 8 8 12 8 8 8 10 8 8 6 7 6 6 6 10 8 9 9 11 11 17 8 9 12 14 14 14 9 9 10 10 10 8 8 8 8 8 8 8 8 6 8 8 8 8 8 8 8 8 6 6 6 6 6 6 11 8 8 8 6 6 6 6 7 7 8 8 8 8 8 8 6 6 7 8 8 8 6 6 6 7 12 8 10 8 8 6 6 8 10 10 10 8 9 9 9 9 9 9 10 9 8 8 10 8 8 10 11 9 8 8 8 6 8 8 8 8 8 8 8 8 8 8 10 19 19 17 21 8 8 8 8 8 8 8 8 6 7 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 9 9 9 9 8 8 8 8 9 12 19 15 25 19 9 9 3 0 0 0 0 0 0 0 0 3 6 8 8 8 6 6 6 6 8 8 8 8 10 10 15 9 9 9 10 8 8 8 8 7 7 7 6 6 6 6 6 7 8 7 7 8 8 7 7 3 0 0 3 7 3 0 3 8 10 9 9 10 8 3 0 3 8 8 9 8 6 6 6 6 6 3 0 3 6 6 7 7 6 6 6 7 7 7 6 9 11 10 8 6 8 6 6 8 3 0 3 9 10 10 9 14 10 10 11 3 0 3 9 9 8 10 11 11 8 8 3 0 3 9 11 12 3 0 3 8 8 11 10 9 9 10 11 11 10 10 7 9 9 8 8 8 8 8 8 3 0 3 8 8 9 8 8 3 0 3 8 8 3 0 3 8 7 9 9 13 14 14 17 12 8 6 6 6 3 0 3 9 8 8 10 10 8 8 9 11 11 9 9 9 10 10 11 11 11 14 17 17 15 19 13 13 12 23 25 21 15 10 9 9 6 8 6 6 6 8 10 8 9 8 8 8 8 8 10 11 10 8 12 11 13 11 7 6 6 6 6 6 7 7 7 9 9 9 12 12 15 9 10 8 8 8 8 11 12 12 15 14 16 12 14 9 9 9 9 9 9 9 9 9 10 11 14 10 11 10 9 8 8 6 6 6 8 8 14 13 13 11 10 10 8 8 8 8 8 9 15 15 12 11 10 10 10 10 8 8 9 8 8 6 7 7 8 8 9 6 6 6 6 15 10 20 12 19 9 9 9 9 10 8 8 8 8 8 7 16 8 8 8 8 9 9 9 8 8 6 6 6 6 8 8 8 8 8 8 8 9 9 10 9 10 8 8 10 10 14 15 9 9 8 8 8 8 8 9 9 9 9 9 8 12 12 12 15 12 20 20 17 18 8 8 8 8 8 8 10 8 14 9 7 6 6 6 7 7 14 12 10 10 10 10 12 18 19 11 10 8 8 8 8 8 8 8 8 8 11 9 8 8 8 8 8 8 8 10 8 8 8 8 9 9 16 21 16 16 16 19 15 15 9 9 9 10 11 14 14 13 13 10 9 9 8 8 8 8 8 8 8 8 9 10 10 10 10 11 11 11 11 11 11 12 25 25 26 30 16 16 11 11 8 8 6 6 13 8 17 15 18 9 9 9 9 12 12 37 39 30 25 19 12 6 6 6 6 8 8 8 8 8 8 8 9 13 13 12 13 13 15 19 18 18 20 24 34 21 18 13 13 13 15 16 15 8 8 8 8 10 8 8 8 8 8 8 8 10 8 6 6 8 6 7 6 6 6 3 0 0 3 7 6 6 6 6 10 10 9 9 9 3 3 3 0 0 3 9 9 9 9 11 11 16 10 10 8 3 3 6 6 7 7 6 7 7 7 7 6 6 6 6 8 8 6 6 6 6 8 8 8 10 8 8 8 8 8 10 10 13 8 9 9 9 8 8 11 10 6 8 8 7 10 8 8 8 8 12 8 8 6 6 6 6 6

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no171_l19.b1 MSMg01no171_l19.b1 CHROMAT_FILE:
MSMg01no171_l19.b1 PHD_FILE: MSMg01no171_l19.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 19:42:01 2005
         (321 letters)



>mm_chrX_33464879_33465599
          Length = 721

 Score =  590 bits (305), Expect = e-173
 Identities = 314/317 (99%)
 Strand = Plus / Minus

                                                                       
Query: 5   gaattccaagacctgaacagtgagcactttcaatcagtcacaggcaattagcctccttct 64
           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 521 gaattccaagacctgaacagtgagcactttcaatcagccacaggcaattagcctccttct 462

                                                                       
Query: 65  aaggagacttctaaagctccagcaacaattttccctggctcagagacccattgccaaact 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 461 aaggagacttctaaagctccagcaacaattttccctggctcagagacccattgccaaact 402

                                                                       
Query: 125 gtccactagaaggcccagagagaaacacaggagggcacagcagaaccactcagagctgaa 184
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 401 gtccactagaaggcccagagagaaacacaggagggcacagcagaaccactcagagctgaa 342

                                                                       
Query: 185 aggattattaagagtcttcaaagatgtatgcctcagctgcagggccctgtgtatattctg 244
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 341 aggattattaagagtcttcaaagatgtatgcctcagctgcagggccctgtgtatattctg 282

                                                                       
Query: 245 acaatagtcagagactccctgatcctgctatatactgctcatgctattctagctggagcc 304
           |||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 281 acaatagtcagagattccctgaccctgctatatactgctcatgctattctagctggagcc 222

                            
Query: 305 agccttgctgaccccag 321
           |||||||||||||||||
Sbjct: 221 agccttgctgaccccag 205


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 16
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 321
Length of database: 721
Length adjustment: 9
Effective length of query: 312
Effective length of database: 712
Effective search space:   222144
Effective search space used:   222144
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information