MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-268E05
Chromosome	X (Build37)
Map Location	12,167,240 - 12,167,551
singlet/doublet	singlet
Overlap gene	Atp6ap2
Upstream gene	LOC669520, Rpl23a-ps, LOC100043945, Bcor, 2900008C10Rik, LOC385323, LOC100043946, LOC628441
Downstream gene	LOC668986, EG245347, 1810030O07Rik, Crsp2, LOC668987, LOC245350, Ppia-psx_132.1, Usp9x, LOC100043000, LOC100043002, LOC675380, Ddx3x, LOC385326, LOC634019, LOC668990, LOC100043947, LOC100043948, Nyx, LOC675416, Cask
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC669520 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669520
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Rpl23a-ps (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628338
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100043945 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043945
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	Bcor (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71458 MGI:1918708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	2900008C10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72937 MGI:1920187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs

name	LOC385323 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100043946 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC628441 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628441
definition	note : ribosomal protein L30 pseudogene pseudo : _no_value

name	Atp6ap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70495 MGI:1917745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668986 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 5 Proteins pseudo : _no_value

name	EG245347 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245347 MGI:3644533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 6 Proteins

name	1810030O07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69155 MGI:1916405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crsp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26896 MGI:1349442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC668987 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC245350 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:245350
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 17 Proteins

name	Ppia-psx_132.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606727
definition	note : peptidylprolyl isomerase A pseudogene x_132.1 pseudo : _no_value

name	Usp9x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22284 MGI:894681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043000 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 2589 ESTs, 8 Proteins

name	LOC100043002 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 124 ESTs, 3 Proteins

name	LOC675380 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ddx3x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13205 MGI:103064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC385326 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 12 Proteins pseudo : _no_value

name	LOC634019 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 19 Proteins pseudo : _no_value

name	LOC668990 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins pseudo : _no_value

name	LOC100043947 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100043948 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043948
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Nyx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236690 MGI:2448607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC675416 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins pseudo : _no_value

name	Cask (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12361 MGI:1309489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669520 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271041 GeneID:669520
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical LOC669520 transcript_id : XM_001481253.1

name	Bcor (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66792787 GeneID:71458 MGI:1918708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl6 interacting corepressor transcript_id : NM_175045.2

name	Bcor (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351506 GeneID:71458 MGI:1918708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl6 interacting corepressor transcript_id : NM_175046.2

name	Bcor (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365597 GeneID:71458 MGI:1918708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl6 interacting corepressor transcript_id : NM_175044.2

name	Bcor (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142346423 GeneID:71458 MGI:1918708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl6 interacting corepressor transcript_id : NM_029510.2

name	2900008C10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270986 GeneID:72937 MGI:1920187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs product : RIKEN cDNA 2900008C10 gene transcript_id : XM_001477165.1

name	LOC100043946 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271044 GeneID:100043946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100043946 transcript_id : XM_001481254.1

name	Atp6ap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801711 GeneID:70495 MGI:1917745
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal accessory protein 2 transcript_id : NM_027439.3

name	EG245347 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407015 GeneID:245347 MGI:3644533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 6 Proteins product : predicted gene, EG245347 transcript_id : XM_141624.4

name	1810030O07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372747 GeneID:69155 MGI:1916405
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810030O07 gene transcript_id : NM_175141.3

name	Crsp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270976 GeneID:26896 MGI:1349442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cofactor required for Sp1 transcriptional activation, subunit 2 transcript_id : NM_001048208.1

name	Crsp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270971 GeneID:26896 MGI:1349442
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cofactor required for Sp1 transcriptional activation, subunit 2 transcript_id : NM_012005.3

name	LOC245350 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407016 GeneID:245350
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 17 Proteins product : similar to Ubiquitin-conjugating enzyme E2Q (putative) 2 transcript_id : XM_141626.5

name	Usp9x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115511017 GeneID:22284 MGI:894681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 9, X chromosome transcript_id : NM_009481.2

name	LOC100043000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270990 GeneID:100043000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 2286 ESTs, 4 Proteins product : similar to ribosomal protein L3, transcript variant 2 transcript_id : XM_001477279.1

name	LOC100043000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270992 GeneID:100043000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 1965 ESTs, 4 Proteins product : similar to ribosomal protein L3, transcript variant 3 transcript_id : XM_001477304.1

name	LOC100043000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270988 GeneID:100043000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 1391 ESTs, 4 Proteins product : similar to ribosomal protein L3, transcript variant 1 transcript_id : XM_001477264.1

name	LOC100043002 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270994 GeneID:100043002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 124 ESTs, 3 Proteins product : hypothetical protein LOC100043002 transcript_id : XM_001477326.1

name	Ddx3x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129795 GeneID:13205 MGI:103064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked transcript_id : NM_010028.2

name	LOC100043947 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271049 GeneID:100043947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to preferentially expressed antigen in melanoma like 7 transcript_id : XM_001481255.1

name	Nyx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352047 GeneID:236690 MGI:2448607
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nyctalopin transcript_id : NM_173415.3

name	Cask (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133504494 GeneID:12361 MGI:1309489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent serine protein kinase (MAGUK family) transcript_id : NM_009806.2

name	LOC669520 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271042 GeneID:669520
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481303.1

name	Bcor (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281849 CCDS:CCDS30022.1 GeneID:71458 MGI:1918708
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform d is encoded by transcript variant d; BCL-6 corepressor product : BCL-6 interacting corepressor isoform d protein_id : NP_778211.1

name	Bcor (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281843 GeneID:71458 MGI:1918708
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform b is encoded by transcript variant b; BCL-6 corepressor product : BCL-6 interacting corepressor isoform b protein_id : NP_778209.1

name	Bcor (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66792788 CCDS:CCDS30021.1 GeneID:71458 MGI:1918708
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant c; BCL-6 corepressor product : BCL-6 interacting corepressor isoform c protein_id : NP_778210.2

name	Bcor (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28144863 GeneID:71458 MGI:1918708
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform a is encoded by transcript variant a; BCL-6 corepressor product : BCL-6 interacting corepressor isoform a protein_id : NP_083786.1

name	2900008C10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270987 GeneID:72937 MGI:1920187
definition	codon_start : 1 product : hypothetical protein LOC72937 protein_id : XP_001477215.1

name	LOC100043946 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271045 GeneID:100043946
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481304.1

name	Atp6ap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21361250 CCDS:CCDS30023.1 GeneID:70495 MGI:1917745
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : ATPase, H+ transporting, lysosomal interacting protein 1; ATPase, H+ transporting, lysosomal interacting protein 2 product : ATPase, H+ transporting, lysosomal accessory protein 2 protein_id : NP_081715.1

name	EG245347 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999881 GeneID:245347 MGI:3644533
definition	codon_start : 1 product : hypothetical protein protein_id : XP_141624.3

name	1810030O07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424732 CCDS:CCDS30024.1 GeneID:69155 MGI:1916405
definition	codon_start : 1 note : Novel transcript product : hypothetical protein LOC69155 protein_id : NP_780350.1

name	Crsp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270977 GeneID:26896 MGI:1349442
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : isoform a is encoded by transcript variant 1; cofactor required for Sp1 transcriptional activation subunit 2 (150 kDa) product : cofactor required for Sp1 transcriptional activation, subunit 2 isoform a protein_id : NP_001041673.1

name	Crsp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270972 GeneID:26896 MGI:1349442
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : isoform b is encoded by transcript variant 2; cofactor required for Sp1 transcriptional activation subunit 2 (150 kDa) product : cofactor required for Sp1 transcriptional activation, subunit 2 isoform b protein_id : NP_036135.3

name	LOC245350 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51830637 GeneID:245350
definition	codon_start : 1 product : similar to Ubiquitin-conjugating enzyme E2Q (putative) 2 protein_id : XP_141626.3

name	Usp9x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115511018 GeneID:22284 MGI:894681
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005544 - calcium-dependent phospholipid binding [Evidence IEA]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : fats facets protein related, X; ubiquitin specific protease 9 SSSRF- isoform product : ubiquitin specific protease 9, X chromosome protein_id : NP_033507.2

name	LOC100043000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270989 GeneID:100043000
definition	codon_start : 1 product : similar to ribosomal protein L3 isoform 1 protein_id : XP_001477314.1

name	LOC100043000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270991 GeneID:100043000
definition	codon_start : 1 product : similar to ribosomal protein L3 isoform 2 protein_id : XP_001477329.1

name	LOC100043000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270993 GeneID:100043000
definition	codon_start : 1 product : similar to ribosomal protein L3 isoform 3 protein_id : XP_001477354.1

name	LOC100043002 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270995 GeneID:100043002
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477376.1

name	Ddx3x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753620 CCDS:CCDS30027.1 GeneID:13205 MGI:103064
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004004 - ATP-dependent RNA helicase activity [Evidence ISS]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003724 - RNA helicase activity [Evidence IEA] codon_start : 1 note : D-E-A-D (aspartate-glutamate-alanine-aspartate) box polypeptide 3; DEAD (aspartate-glutamate-alanine-aspartate) box polypeptide 3; embryonic RNA helicase; fibroblast growth factor inducible 14 product : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked protein_id : NP_034158.1

name	LOC100043947 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271050 GeneID:100043947
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481305.1

name	Nyx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734150 GeneID:236690 MGI:2448607
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 note : no b wave product : nyctalopin protein_id : NP_775591.1

name	Cask (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133504495 GeneID:12361 MGI:1309489
definition	GO_component : GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IDA]; GO:0019717 - synaptosome [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : calcium/calmodulin-dependent serine protein kinase protein_id : NP_033936.2

name	Rpl23a-ps (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628338
definition	number : 1 pseudo : _no_value

name	LOC385323 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385323
definition	number : 2 pseudo : _no_value

name	LOC385323 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385323
definition	number : 1 pseudo : _no_value

name	LOC668987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668987
definition	number : 1 pseudo : _no_value

name	LOC668987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668987
definition	number : 2 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 1 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 2 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 3 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 4 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 5 pseudo : _no_value

name	LOC100043948 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043948
definition	number : 1 pseudo : _no_value

name	LOC100043945 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271043 GeneID:100043945
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to glyceraldehyde-3-phosphate dehydrogenase (phosphorylating)-like pseudo : _no_value transcript_id : XR_035068.1

name	LOC668986 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271046 GeneID:668986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 5 Proteins product : similar to Nol5a protein pseudo : _no_value transcript_id : XR_035069.1

name	LOC385326 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271047 GeneID:385326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 12 Proteins product : similar to Chaperonin subunit 7 (eta) pseudo : _no_value transcript_id : XR_035070.1

name	LOC634019 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270996 GeneID:634019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 19 Proteins product : similar to glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_033207.1

name	LOC668990 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271048 GeneID:668990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins product : similar to vitamin D receptor interacting protein pseudo : _no_value transcript_id : XR_035071.1

name	LOC675416 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271051 GeneID:675416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins product : similar to E1B 19K/Bcl-2-binding protein homolog pseudo : _no_value transcript_id : XR_035072.1

clone name	MSMg01-186H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319K24
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-268E05.T7 (MSMg01no268_e05.b1)	MSMg01-268E05.TJ (MSMg01no268_e05.g1)
ACC	AG408753	AG408754
length	736	740
length of high quality (start - end)	317 (45 - 361)	303 (77 - 379)
definition	CHROMAT_FILE: MSMg01no268_e05.b1 PHD_FILE: MSMg01no268_e05.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:06:31 2005	CHROMAT_FILE: MSMg01no268_e05.g1 PHD_FILE: MSMg01no268_e05.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:06:31 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	TCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGA ATTCTTTCCCCCACCTCAGCCTTTCCTATAATCTTCTTGGGAGACACCTC CCCTGGGGGACATTCCTTGAGCTTCTCCAGTCTGTCTTCGAGAGGGAGTT AGTGTCCCTTCCTCAGAGACTCCACGATCTTGTGCAGTGAGCTTCTATGA ATGATGGAACAAAATCAATCAACTTAAAAAAGGGATATGGGCTACTTCTG TCTCCAGGACATCAGAGACCAAAATCAACTCCCTCCTTTACAAGCATCTG TACCAATACCATGTGTTAGCTCTTGGTCCTTTTTCTCCAGGCTAAATATC TGAACTTTTTCTATTTTTCTCCCCCCCCGCCCCTCATAGCCCAGGTTCCC TAGTTCTTTCTAGTTCCCTAACACTGAATACAAAACAAACAGTGAAATCT GAGCTCTTAAAGATGTTTTCCACTAAATCACGCTTAGTCACCATGGAAAA TAACACTGTACTGACACCTGACAAGAGCCAGCAGCTCAGACAACTGTTAT ATGAACTAAACCACTTTAGCAAGGCTAGCATGTCCGGACCATGGAGAGAA ATAATTATTTTACCTTAGACAAAAACCAAACCAAAAACCAAGACCTCCCT GACTCANAATGTCATAGAGCTGAACACAGTGGTACTCATAAGGCAGAGAC AGGCAGATCTCTCTGAGGTCAGGGACATCTAGGTCT	CCGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXTCACCTGAGGAATACCGAATGGCG GAGAAACACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCA AATCAAAACAACCCTGAGATTCCACTTCACTCCAGTCAGAATGGCTAAGA TAAAAAACTCAGGTGACAGCAGATGCTGGCGAGGATGTGGAGAAAGGGGA ACACTCCTCCATTGTTGGTGGGATTGCAAGCTTGTACAACCACTCTGGAA ATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTACCGGAGGATC CCGCAATACCTCTCCTGGTTATATATCCACGAACATGTCCCAACCGGTAA GAAGAACACATGCTCCACTATGTTCATAGCAGCCTTGTTTATAATAGCCA GAAGCTGGAAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAA ATGTGGTACATTTACACAATGGAATACTACTCAGCTATTAAAAAAATGAA TTTATGAAATTCCTAAGCAAATGGATGGACCTGGAGGGCATCATCCTGAG TGAAGGAACCCAATCACAAAAGAACTCACACAACATGTACTCACTGATAA GTGGATAATAGCCCAGAAACTTAGGATACCCAAGATATGAGATACAACTT GCCAAACGCATGAAATTCAAGAAGAACGAAGACCAAAGTG
quality values	Open. Hide. 8 8 8 8 8 9 13 25 37 37 30 30 25 24 24 30 23 23 22 28 28 28 43 48 35 35 30 30 32 36 57 57 53 48 48 48 48 57 57 42 42 34 36 36 42 43 68 68 47 47 42 42 50 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 68 68 68 68 68 68 68 68 68 59 59 59 68 68 68 68 68 68 68 68 68 68 68 51 51 50 51 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 59 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 54 54 54 59 59 68 59 57 44 44 32 40 42 42 32 35 42 59 59 68 68 59 59 57 57 57 57 57 57 59 59 59 59 59 59 59 59 59 59 59 59 50 50 50 47 47 44 36 43 11 11 8 8 7 8 10 9 10 10 10 10 8 9 9 9 11 12 6 6 6 7 6 10 10 11 27 27 59 59 59 59 59 59 59 59 59 59 57 57 57 57 59 57 59 59 59 59 59 59 59 59 59 59 59 59 33 33 18 15 13 13 13 19 19 12 10 8 8 8 8 9 8 17 8 8 8 8 21 28 47 47 47 46 47 43 39 37 35 39 43 47 47 43 59 59 59 59 59 59 59 57 57 57 57 68 68 68 68 68 68 68 68 54 54 54 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 59 57 57 57 57 57 57 59 59 59 57 57 59 59 68 68 68 68 68 68 68 59 59 43 43 43 59 59 59 68 68 68 68 68 57 57 57 59 59 59 59 57 54 54 54 54 54 54 59 59 59 48 48 57 57 57 57 57 57 57 59 59 59 59 48 48 48 48 48 31 31 31 30 27 30 43 41 41 44 44 44 59 47 50 50 50 50 50 50 57 57 57 50 53 50 50 50 50 59 59 41 34 34 28 24 25 43 43 44 41 37 44 43 41 37 37 41 41 41 59 40 36 26 32 30 37 33 31 31 41 43 47 59 41 41 39 37 23 23 3 0 3 25 27 37 37 30 28 28 37 34 40 39 39 30 28 24 24 25 30 36 36 36 35 29 29 30 32 33 33 37 37 37 31 25 20 20 23 23 32 21 23 19 17 14 16 19 30 22 22 12 16 12 14 17 21 24 14 14 9 9 9 13 15 22 19 18 20 19 15 11 11 18 24 18 17 24 19 19 17	Open. Hide. 6 6 6 6 11 10 10 9 9 16 23 44 43 48 48 48 48 48 37 37 42 41 39 39 39 39 37 44 44 37 37 37 37 39 41 50 50 43 36 33 36 36 42 42 57 57 57 57 53 53 50 50 50 50 53 68 68 68 68 68 68 42 42 36 36 41 42 44 57 57 42 48 41 41 43 48 50 50 50 50 50 57 57 57 68 50 50 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 68 68 68 68 68 68 51 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 51 51 50 50 50 51 68 68 68 68 68 50 51 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 59 57 57 57 57 57 57 68 68 68 68 57 57 57 68 59 59 59 68 68 68 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 57 68 68 68 68 68 68 68 57 57 57 57 54 59 59 59 68 68 68 68 57 57 57 57 57 59 59 68 68 68 68 68 68 50 48 42 42 43 57 59 68 68 68 68 68 68 68 68 57 57 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 47 42 42 47 48 48 47 54 57 59 59 68 68 68 68 68 68 59 59 57 57 53 53 53 53 53 53 53 53 53 59 59 59 59 59 59 59 59 59 47 36 33 24 21 15 12 12 12 12 15 20 32 34 36 28 14 9 9 9 9 9 10 13 13 15 14 14 22 41 41 59 59 59 59 59 59 59 59 59 59 59 48 48 48 57 57 57 57 57 57 59 68 68 68 68 68 68 68 59 59 47 31 31 20 20 20 20 21 28 36 39 43 39 47 39 35 35 44 44 57 57 68 68 68 68 68 68 57 59 57 59 59 57 57 57 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 54 57 46 46 40 37 39 39 43 59 57 57 68 57 57 57 48 48 48 57 48 48 48 57 57 57 59 59 59 59 59 59 59 48 47 47 47 28 28 15 15 13 13 13 17 34 30 47 50 39 33 33 33 33 33 39 59 44 41 41 43 30 28 13 14 12 27 23 37 37 37 37 37 44 37 37 39 39 37 37 37 37 37 37 37 39 39 39 39 47 59 59 59 48 48 48 48 48 48 43 43 41 41 25 30 18 20 19 16 25 27 37 37 39 42 42 40 41 41 41 41 41 59 37 32 29 32 36 36 24 19 10 6 6 8 19 23 41 41 46 46 47 47 46 41 39 22 18 9 9 9 15 28 37 25 27 32 37 37 37 37 37 39 31 31 41 41 35 29 29 17 19 10 10 8 13 17 26 26 32 26 34 41 44 34 30 21 13 14 18 18 23 23 35 34 34 16 12 11 12 12 27 22 24 22 22 22 34 34 23 23 11 8 6 7 7 9 9 11 16 16 23 23 31 22 15 16 16 15 17 30 15 13 7 7 7 10 10 11 10 10 10

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no268_e05.b1 MSMg01no268_e05.b1 CHROMAT_FILE:
MSMg01no268_e05.b1 PHD_FILE: MSMg01no268_e05.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 21:06:31 2005
         (317 letters)



>mm_chrX_12167036_12167751
          Length = 716

 Score =  598 bits (309), Expect = e-175
 Identities = 312/313 (99%), Gaps = 1/313 (0%)
 Strand = Plus / Minus

                                                                       
Query: 5   gaattctttcccccacctcagcctttcctataatcttcttgggagacacctcccctgggg 64
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 516 gaattctttcccccacctcagcctttcctataatcttcttgggagacacctcccctgggg 457

                                                                       
Query: 65  gacattccttgagcttctccagtctgtcttcgagagggagttagtgtcccttcctcagag 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 456 gacattccttgagcttctccagtctgtcttcgagagggagttagtgtcccttcctcagag 397

                                                                       
Query: 125 actccacgatcttgtgcagtgagcttctatgaatgatggaacaaaatcaatcaacttaaa 184
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 396 actccacgatcttgtgcagtgagcttctatgaatgatggaacaaaatcaatcaacttaaa 337

                                                                       
Query: 185 aaagggatatgggctacttctgtctccaggacatcagagaccaaaatcaactccctcctt 244
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 336 aaagggatatgggctacttctgtctccaggacatcagagaccaaaatcaactccctcctt 277

                                                                       
Query: 245 tacaagcatctgtaccaataccatgtgttagctcttggtcctttttctccaggctaaata 304
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 276 tacaagcatctgtaccaataccatgtgttagctcttggtcctttttctccaggctaaa-a 218

                        
Query: 305 tctgaactttttc 317
           |||||||||||||
Sbjct: 217 tctgaactttttc 205


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 15
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 317
Length of database: 716
Length adjustment: 9
Effective length of query: 308
Effective length of database: 707
Effective search space:   217756
Effective search space used:   217756
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information