MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-358N14
Chromosome	X (Build37)
Map Location	4,118,715 - 4,119,018
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC668957, LOC100043932, OTTMUSG00000016406, LOC673743, OTTMUSG00000016405, OTTMUSG00000016411, LOC668961, LOC100042159, LOC100042168, LOC627187, LOC100042185, OTTMUSG00000016407, OTTMUSG00000016437, OTTMUSG00000016420, LOC547057
Downstream gene	EG546327, EG668965, LOC546185, LOC100043933, LOC670673, LOC100042254, LOC100043934, LOC100042267, LOC100042275, LOC668967, LOC434724, LOC100043935, LOC668968, LOC546182, Mycs
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC668957 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668957
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC100043932 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	OTTMUSG00000016406 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668958 MGI:3709280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins

name	LOC673743 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	OTTMUSG00000016405 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630022 MGI:3709282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	OTTMUSG00000016411 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668960 MGI:3709278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC668961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins

name	LOC100042159 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC100042168 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC627187 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	LOC100042185 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs

name	OTTMUSG00000016407 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627264 MGI:3709183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 11 ESTs, 10 Proteins

name	OTTMUSG00000016437 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668964 MGI:3709272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	OTTMUSG00000016420 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668963 MGI:3709274
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC547057 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547057
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	EG546327 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546327 MGI:3704140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST pseudo : _no_value

name	EG668965 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668965 MGI:3646752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs

name	LOC546185 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 14 Proteins

name	LOC100043933 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043933
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC670673 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670673
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC100042254 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042254
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC100043934 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC100042267 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins

name	LOC100042275 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042275
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins

name	LOC668967 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC434724 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 1 Protein

name	LOC100043935 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043935
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC668968 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC546182 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 Protein

name	Mycs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17870 MGI:1332242
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000016406 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406945 GeneID:668958 MGI:3709280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins product : predicted gene, OTTMUSG00000016406 transcript_id : XM_001006590.1

name	OTTMUSG00000016405 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406948 GeneID:630022 MGI:3709282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : predicted gene, OTTMUSG00000016405 transcript_id : XM_895197.2

name	OTTMUSG00000016411 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406949 GeneID:668960 MGI:3709278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : predicted gene, OTTMUSG00000016411 transcript_id : XM_001006594.1

name	LOC668961 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94406951 GeneID:668961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein transcript_id : XM_001006595.1

name	LOC100042159 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270905 GeneID:100042159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001474533.1

name	LOC100042168 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270907 GeneID:100042168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001474553.1

name	LOC100042185 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270909 GeneID:100042185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs product : similar to 4930408F14Rik protein transcript_id : XM_001474570.1

name	OTTMUSG00000016407 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406954 GeneID:627264 MGI:3709183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 11 ESTs, 10 Proteins product : predicted gene, OTTMUSG00000016407 transcript_id : XM_891923.2

name	OTTMUSG00000016437 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406957 GeneID:668964 MGI:3709272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : predicted gene, OTTMUSG00000016437 transcript_id : XM_001006598.1

name	OTTMUSG00000016420 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406955 GeneID:668963 MGI:3709274
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : predicted gene, OTTMUSG00000016420 transcript_id : XM_001006597.1

name	EG668965 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270911 GeneID:668965 MGI:3646752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs product : predicted gene, EG668965 transcript_id : XM_001474644.1

name	LOC100042254 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270914 GeneID:100042254
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001474674.1

name	LOC100042267 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270916 GeneID:100042267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein transcript_id : XM_001474694.1

name	LOC100042275 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270918 GeneID:100042275
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins product : similar to RIKEN cDNA 1700017G21 gene transcript_id : XM_001474710.1

name	LOC434724 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94406961 GeneID:434724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 1 Protein product : similar to RIKEN cDNA 1700017G21 gene transcript_id : XM_486608.4

name	LOC546182 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270920 GeneID:546182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 Protein product : similar to 4930408F14Rik protein transcript_id : XM_001487800.1

name	Mycs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754769 GeneID:17870 MGI:1332242
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myc-like oncogene, s-myc protein transcript_id : NM_010850.1

name	OTTMUSG00000016406 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406946 GeneID:668958 MGI:3709280
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001006590.1

name	OTTMUSG00000016405 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83006307 GeneID:630022 MGI:3709282
definition	codon_start : 1 product : hypothetical protein protein_id : XP_900290.1

name	OTTMUSG00000016411 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406950 GeneID:668960 MGI:3709278
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001006594.1

name	LOC668961 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94406952 GeneID:668961
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001006595.1

name	LOC100042159 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270906 GeneID:100042159
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474583.1

name	LOC100042168 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270908 GeneID:100042168
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474603.1

name	LOC100042185 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270910 GeneID:100042185
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001474620.1

name	OTTMUSG00000016407 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999652 GeneID:627264 MGI:3709183
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897016.1

name	OTTMUSG00000016437 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406958 GeneID:668964 MGI:3709272
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001006598.1

name	OTTMUSG00000016420 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406956 GeneID:668963 MGI:3709274
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001006597.1

name	EG668965 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270912 GeneID:668965 MGI:3646752
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001474694.1

name	LOC100042254 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270915 GeneID:100042254
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474724.1

name	LOC100042267 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270917 GeneID:100042267
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001474744.1

name	LOC100042275 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270919 GeneID:100042275
definition	codon_start : 1 product : similar to RIKEN cDNA 1700017G21 gene protein_id : XP_001474760.1

name	LOC434724 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51771883 GeneID:434724
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486608.1

name	LOC546182 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270921 GeneID:546182
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001487850.1

name	Mycs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754770 CCDS:CCDS29953.1 GeneID:17870 MGI:1332242
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : myc-like oncogene, s-myc protein protein_id : NP_034980.1

name	LOC668957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668957
definition	number : 1 pseudo : _no_value

name	LOC668957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668957
definition	number : 2 pseudo : _no_value

name	LOC668957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668957
definition	number : 3 pseudo : _no_value

name	LOC100043932 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043932
definition	number : 2 pseudo : _no_value

name	LOC100043932 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043932
definition	number : 1 pseudo : _no_value

name	LOC673743 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673743
definition	number : 3 pseudo : _no_value

name	LOC673743 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673743
definition	number : 2 pseudo : _no_value

name	LOC673743 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673743
definition	number : 1 pseudo : _no_value

name	LOC627187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627187
definition	number : 2 pseudo : _no_value

name	LOC627187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627187
definition	number : 1 pseudo : _no_value

name	LOC547057 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:547057
definition	number : 2 pseudo : _no_value

name	LOC547057 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:547057
definition	number : 1 pseudo : _no_value

name	LOC100043933 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043933
definition	number : 1 pseudo : _no_value

name	LOC100043933 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043933
definition	number : 2 pseudo : _no_value

name	LOC670673 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670673
definition	number : 3 pseudo : _no_value

name	LOC670673 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670673
definition	number : 2 pseudo : _no_value

name	LOC670673 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670673
definition	number : 1 pseudo : _no_value

name	LOC100043934 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043934
definition	number : 2 pseudo : _no_value

name	LOC100043934 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043934
definition	number : 1 pseudo : _no_value

name	LOC668967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668967
definition	number : 1 pseudo : _no_value

name	LOC668967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668967
definition	number : 2 pseudo : _no_value

name	LOC668967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668967
definition	number : 3 pseudo : _no_value

name	LOC100043935 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043935
definition	number : 1 pseudo : _no_value

name	LOC100043935 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043935
definition	number : 2 pseudo : _no_value

name	LOC668968 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668968
definition	number : 3 pseudo : _no_value

name	LOC668968 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668968
definition	number : 2 pseudo : _no_value

name	LOC668968 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668968
definition	number : 1 pseudo : _no_value

name	EG546327 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270924 GeneID:546327 MGI:3704140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG546327 pseudo : _no_value transcript_id : XR_035060.1

name	LOC546185 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270913 GeneID:546185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 14 Proteins product : similar to Germ cell-less protein-like 2 (mGclh) transcript_id : XR_031864.1

clone name	MSMg01-358N14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-352B23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408A19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-495F17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-167D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-215I04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-504B09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-513N02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-451C12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-491C03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-528G01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-531F12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-542K06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-141K01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-351M15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-416O08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-507L22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-418B13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-050F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-096H07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-147B05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-177G10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232N21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232N23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-348L03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-395A20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-471G01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-518F13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-533B16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-538C12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-543C22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-152N19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-101L18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-511E20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-522M19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-139K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-095E06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232F02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-340K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-353F22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-385P03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-432A03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-434A22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-440B04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-440B07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-462O20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-495F18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-542L22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-053O24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-096C12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-122E02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-132O20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-313D10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-335F06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-340I13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346F11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-362I14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-363G09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-383I18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-420K20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-422F05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-441N22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-450O21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-455D18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-466H09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-480E22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-507E22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-537N02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-537P06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-540B11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-521J05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-111D02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-373E17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-365K14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-372L07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-337C16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-152F22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-434D17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-065I23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-124K18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-319E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-120D01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-494F05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-484P08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-403M14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-072F07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-331J22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-494A02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-525O01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-533H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-358M08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-388F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-413H09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-504H23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-520E04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-403I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293C20
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-358N14.T7 (MSMg01no358_n14.b1)	MSMg01-358N14.TJ (MSMg01no358_n14.g1)
ACC	AG468406	AG468407
length	732	723
length of high quality (start - end)	464 (37 - 500)	471 (67 - 537)
definition	CHROMAT_FILE: MSMg01no358_n14.b1 PHD_FILE: MSMg01no358_n14.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 22:53:13 2005	CHROMAT_FILE: MSMg01no358_n14.g1 PHD_FILE: MSMg01no358_n14.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 22:53:13 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	plural
sequence	XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGAATTCTAGA ACCATAGAAACGCCTGGAAATATTAGAAGAACAAATAAGGATGTGAGGTC TGGATAAACATCTTATGCTGCTGAGCATAAGATGTGGGGGGAAGCTTGGG AGACCTGGCAAACATCAGAGTCCTACTTGGCCTGTTAGGCCAGATGTACA TGGGAATGCTGGGTAATATGAGTATCTCAGTACACATAGAAGGTCTCAAT AATGATTAGAGTCTTATAAAGCACAGAAGCCAAATGAAGTCTAATATAAA TGTGAGGTCTGGTACAGAAATGAGGTCTAGTAACTTAGGGAGGCCTAGAG AATATGGAAGGCCTTGTGACCAAGCAGGTTATGGCTCCCTGGAATACCTG TTAAATTTGAGTGACCTGGGATGCATGGGCTTTCTGAGAAAAACTTGCGG CTTGCTAAGCCCTGGAACCTGGAAAGCTTAGGAGGTGTGATAAGCATTAN AAGCCTGGTGAATAAGGACAGGATTATTAAGCCTGGGGATGCTAGAATCC AAAAATGATGGGGGAAGCCCTGCAGGTCTAGAAGGATTGGGAGGTGTGGA AATACCTCACAAGAGTGTTATGCCTGTGGAGGCTGGAAAAGAACTGCCAC GATGAGATGGTCCCACCCTGGGGAAGCCCAATAGCGGGGAAAGCCCATAA CCTTAGAAAACCTGGGACCCTTGGAGACCTAC	TXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXACTCATACACTTAGATCTTTGGGTACAGAATTAG CATTACAATACATAGACCAAACCTCAATCTATACAAAGAACTACAGGCAA CTAAAGAATGCTGAAAGGGGGTGAAATTCTTTCCCTGTGAAAAAGATACA ACTGATTTTCCTAAAAAACTTGCATACAAGTAACATTATACATACTGAGC AGGTTGTATTAGGAATTTGTATGTATATGCATATACATGTATGCATAAAT ATATGTATGTAATGATAATTAAGGTAAAAAGAGGCAATGGGTAAGAAATA GTGCAAAGAGAGTATATAGAAAGACTTGAAGGAGAAAAGGAAGGGGAAAT GGTATAAATGCACAACAATCTCAAAATATAAAAGAAATAATATTTACAAA AACCAAGTCCTGAACAGTGTAAATAATAGATGACATATCAAAAAATAGGT GGTGAATCACATGGGGACTGACCCCAGATGAAAAGTTTCAAATAATCAAA TGTTGAGAGAGGAAGAACCATCTTTCCACAAGGATGAATCCTTGAATGGT TGGTTATATAACACCAAATGGGCAGTCTTAGAATATACACTTGTCCCCAT TTAAGAACCCCTTTGTCTCCCTTTTGAGGACCAGGCCTGTTGTCCAAAAA GGCCATAAAGCCCCCCTTATAAA
quality values	Open. Hide. 34 38 39 39 35 31 20 25 13 12 12 15 15 28 34 41 22 21 12 12 12 27 30 25 12 11 11 11 12 18 28 23 19 12 14 14 27 33 47 44 20 19 17 19 29 24 41 42 37 39 32 32 22 19 12 12 12 22 25 39 59 59 57 57 57 57 57 47 47 47 47 47 47 51 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 51 68 68 68 68 68 68 68 51 51 51 68 68 68 68 50 50 50 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 51 50 50 50 50 57 68 68 68 68 68 68 68 68 68 68 68 68 50 50 50 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 50 54 54 54 54 54 57 59 59 59 59 59 59 59 59 59 59 59 59 59 57 57 57 57 57 50 50 48 57 48 57 57 57 48 48 48 48 48 48 48 50 47 59 47 47 33 30 25 22 21 25 31 36 39 39 39 39 41 41 41 37 37 43 43 47 59 59 47 47 47 39 39 39 59 39 44 39 39 39 39 43 43 43 43 43 39 47 39 39 33 37 33 37 31 36 39 39 31 25 29 25 27 20 25 22 26 30 32 47 41 39 25 25 11 11 13 23 21 20 23 23 23 23 32 32 31 31 37 37 37 23 23 3 0 3 14 18 17 15 16 13 10 10 12 16 17 17 19 18 20 19 32 24 30 25 29 26 25 20 28 23 16 16 11 11 11 12 13 12 15 16 15 16 24 15 16 15 16 10 9 9 12 11 9 11 11 15 20 22 22 22 10 8 8 8 8 11 17 24 17 17 16 19 8 8 6 6 6 8 6 9 9 12 9 12 12 12 12 13 18 18 20 18 11 11 12 9 9 9 9 9 9 10 10 12 8 8 8 8 8 8 7 9 9 10 8 10 8 7 7 7 12 12 7 7 7 7 8 8 8 8 8 8 8 8 8 8 14 14 18 22 15 12 11 10 9 9 9 10 8 8 6 6 6 8 8 10 13 9 9 9 11 12 14 10 10 7 7 7 6 8 8 10 8 8 8 11 9 10 10 6 6 8 6 6 6 6 8 6 9 12 11 10 10 10 10 10 10 8 8 8 8 8 8 10 10 10 9 9 9 10 11 12 10 10 10 11 11 11 11 11 10 10 10 10 10 10 11 9 10 10 10 10 9 9 9	Open. Hide. 8 8 8 8 8 10 14 30 32 37 39 39 39 39 44 39 39 44 44 39 37 31 15 10 10 10 10 17 19 21 21 21 30 30 44 50 50 50 47 47 50 47 47 53 53 53 53 53 57 44 43 34 37 48 42 42 42 57 57 57 42 42 41 41 50 50 50 50 50 50 50 50 68 68 68 68 68 68 68 50 50 50 50 51 68 68 68 68 68 68 68 68 68 68 68 68 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 57 57 68 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 62 62 62 68 68 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 59 59 57 68 68 68 68 68 57 57 68 57 59 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 59 59 59 59 68 59 59 57 54 54 54 54 54 57 59 59 59 59 59 43 43 43 59 46 57 57 57 54 54 57 57 57 48 57 57 57 48 48 48 57 57 57 39 39 35 39 39 57 57 44 44 43 43 40 41 59 59 47 43 41 32 32 39 39 37 37 30 35 35 59 59 48 48 48 57 57 57 39 43 39 43 39 39 39 34 34 25 25 25 34 34 39 39 39 35 31 25 28 23 20 23 20 32 31 36 36 36 36 37 37 34 31 36 39 36 37 34 37 32 28 24 33 23 14 14 14 21 21 32 32 34 31 24 22 18 19 12 9 9 9 9 13 23 23 11 11 11 17 19 11 11 11 19 18 22 18 25 25 25 18 27 13 13 13 15 15 22 25 28 28 24 22 19 19 11 11 11 16 16 15 15 10 10 10 16 15 19 18 19 19 26 20 20 18 19 17 15 15 9 14 9 9 9 12 16 13 12 12 12 12 17 19 17 15 22 24 37 31 18 16 11 11 10 10 10 13 13 10 10 10 9 9 9 10 11 15 13 16 14 10 9 10 9 9 8 8 8 8 12 11 10 9 12 10 9 13 9 9 10 9 10 10 11 11 11 12 12 17 17 25 17 21 10 10 10 10 11 12 12 12 9 12 10 13 9 9 8 8 8 8 8 8 8 11 19 15 9 7 7 6 7 10 10 9 8 8 8 8 8 8 9 10 12 14 7 6 6 6 6 12 7

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no358_n14.g1 MSMg01no358_n14.g1 CHROMAT_FILE:
MSMg01no358_n14.g1 PHD_FILE: MSMg01no358_n14.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 22:53:13 2005
         (471 letters)



>mm_chrX_4118148_4119018
          Length = 871

 Score =  580 bits (300), Expect = e-170
 Identities = 303/304 (99%)
 Strand = Plus / Minus

                                                                       
Query: 168 cattatacatactgagcaggttgtattaggaatttgtatgtatatgcatatacatgtatg 227
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 871 cattatacatactgagcaggttgtattaggaatttgtatgtatatgcatatacatgtatg 812

                                                                       
Query: 228 cataaatatatgtatgtaatgataattaaggtaaaaagaggcaatgggtaagaaatagtg 287
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 811 cataaatatatgtatgtaatgataattaaggtaaaaagaggcaatgggtgagaaatagtg 752

                                                                       
Query: 288 caaagagagtatatagaaagacttgaaggagaaaaggaaggggaaatggtataaatgcac 347
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 751 caaagagagtatatagaaagacttgaaggagaaaaggaaggggaaatggtataaatgcac 692

                                                                       
Query: 348 aacaatctcaaaatataaaagaaataatatttacaaaaaccaagtcctgaacagtgtaaa 407
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 691 aacaatctcaaaatataaaagaaataatatttacaaaaaccaagtcctgaacagtgtaaa 632

                                                                       
Query: 408 taatagatgacatatcaaaaaataggtggtgaatcacatggggactgaccccagatgaaa 467
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 631 taatagatgacatatcaaaaaataggtggtgaatcacatggggactgaccccagatgaaa 572

               
Query: 468 agtt 471
           ||||
Sbjct: 571 agtt 568


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 15
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 471
Length of database: 871
Length adjustment: 10
Effective length of query: 461
Effective length of database: 861
Effective search space:   396921
Effective search space used:   396921
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information