MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-397G23
Chromosome	X (Build37)
Map Location	9,721,668 - 9,722,009
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Lancl3, Xk, 1700012L04Rik, EG628040, LOC100042834, LOC100042839, Rp23-423l11.5, Cybb, EG333452, LOC100042867, Dynlt3, 1700054O13Rik, 4930557A04Rik, Sytl5, LOC436194, Srpx
Downstream gene	Rpgr, Otc, 4933416E14Rik, Tspan7, EG546265, LOC633354, LOC633361, LOC100042912, Mid1ip1, LOC668982, Ppia-psx_105.1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Lancl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236285 MGI:2443335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22439 MGI:103569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700012L04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76383 MGI:1923633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628040 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628040 MGI:3648590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 mRNAs, 261 ESTs, 3 Proteins

name	LOC100042834 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042834
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	LOC100042839 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042839
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	Rp23-423l11.5 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 5 Proteins

name	Cybb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13058 MGI:88574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG333452 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333452 MGI:3643069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins

name	LOC100042867 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042867
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Dynlt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67117 MGI:1914367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700054O13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67334 MGI:1914584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930557A04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385317 MGI:1922521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	Sytl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236643 MGI:2668451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC436194 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins pseudo : _no_value

name	Srpx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51795 MGI:1858306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpgr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19893 MGI:1344037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Otc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18416 MGI:97448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933416E14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71180 MGI:1918430
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Tspan7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21912 MGI:1298407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546265 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546265 MGI:3647036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 779 ESTs, 6 Proteins

name	LOC633354 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	LOC633361 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 Proteins pseudo : _no_value

name	LOC100042912 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Mid1ip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68041 MGI:1915291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668982 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins pseudo : _no_value

name	Ppia-psx_105.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547156
definition	note : peptidylprolyl isomerase A pseudogene x_105.1 pseudo : _no_value

name	Lancl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373066 GeneID:236285 MGI:2443335
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LanC lantibiotic synthetase component C-like 3 (bacterial) transcript_id : NM_173414.2

name	Xk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053936 GeneID:22439 MGI:103569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kell blood group precursor (McLeod phenotype) homolog transcript_id : NM_023500.2

name	1700012L04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350916 GeneID:76383 MGI:1923633
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700012L04 gene transcript_id : NM_029588.2

name	EG628040 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407003 GeneID:628040 MGI:3648590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 mRNAs, 261 ESTs, 3 Proteins product : predicted gene, EG628040 transcript_id : XM_892769.2

name	LOC100042834 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270958 GeneID:100042834
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : hypothetical protein LOC100042834 transcript_id : XM_001476540.1

name	LOC100042839 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270960 GeneID:100042839
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : hypothetical protein LOC100042839 transcript_id : XM_001476550.1

name	Rp23-423l11.5 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407004 GeneID:547154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 5 Proteins product : Novel protein similar to histone H2a (1700012L04Rik) transcript_id : XM_622011.3

name	Cybb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227198 GeneID:13058 MGI:88574
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b-245, beta polypeptide transcript_id : NM_007807.3

name	EG333452 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270962 GeneID:333452 MGI:3643069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : predicted gene, EG333452 transcript_id : XM_285588.6

name	LOC100042867 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270963 GeneID:100042867
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100042867 transcript_id : XM_001476632.1

name	Dynlt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364447 GeneID:67117 MGI:1914367
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein light chain Tctex-type 3 transcript_id : NM_025975.4

name	1700054O13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385599 GeneID:67334 MGI:1914584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700054O13 gene transcript_id : NM_026096.1

name	4930557A04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271037 GeneID:385317 MGI:1922521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : RIKEN cDNA 4930557A04 gene transcript_id : XM_001481251.1

name	Sytl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343248 GeneID:236643 MGI:2668451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin-like 5 transcript_id : NM_177704.2

name	Srpx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367987 GeneID:51795 MGI:1858306
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sushi-repeat-containing protein transcript_id : NM_016911.3

name	Rpgr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755347 GeneID:19893 MGI:1344037
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinitis pigmentosa GTPase regulator transcript_id : NM_011285.1

name	Otc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803523 GeneID:18416 MGI:97448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ornithine transcarbamylase transcript_id : NM_008769.3

name	Tspan7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662760 GeneID:21912 MGI:1298407
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 7 transcript_id : NM_019634.2

name	EG546265 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407006 GeneID:546265 MGI:3647036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 779 ESTs, 6 Proteins product : predicted gene, EG546265 transcript_id : XM_620954.3

name	LOC633354 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271039 GeneID:633354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : similar to lactate dehydrogenase 1, A chain transcript_id : XM_001481252.1

name	LOC100042912 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270966 GeneID:100042912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100042912 transcript_id : XM_001476973.1

name	Mid1ip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801493 GeneID:68041 MGI:1915291
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Mid1 interacting protein 1 (gastrulation specific G12-like (zebrafish)) transcript_id : NM_026524.3

name	Lancl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734148 CCDS:CCDS30007.1 GeneID:236285 MGI:2443335
definition	codon_start : 1 exception : mismatches in translation product : LanC lantibiotic synthetase component C-like 3 protein_id : NP_775590.1

name	Xk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963703 CCDS:CCDS30008.1 GeneID:22439 MGI:103569
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0005215 - transporter activity [Evidence ISS] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0006810 - transport [Evidence ISS] [Evidence IEA] codon_start : 1 note : McLeod syndrome gene homolog product : Kell blood group precursor (McLeod phenotype) homolog protein_id : NP_075989.1

name	1700012L04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386420 GeneID:76383 MGI:1923633
definition	GO_component : GO:0005694 - chromosome [Evidence IEA] codon_start : 1 note : Novel protein similar to histone H2a (1700012L04Rik) product : histone variant H2al1 protein_id : NP_083864.1

name	EG628040 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999846 GeneID:628040 MGI:3648590
definition	codon_start : 1 product : similar to Golgi autoantigen, golgin subfamily a, 7 protein_id : XP_897862.1

name	LOC100042834 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270959 GeneID:100042834
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476590.1

name	LOC100042839 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270961 GeneID:100042839
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476600.1

name	Rp23-423l11.5 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:63743381 GeneID:547154
definition	codon_start : 1 product : hypothetical protein protein_id : XP_622011.1

name	Cybb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542440 CCDS:CCDS30010.1 GeneID:13058 MGI:88574
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0050660 - FAD binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cytochrome b-245, beta polypeptide protein_id : NP_031833.2

name	EG333452 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086068 GeneID:333452 MGI:3643069
definition	codon_start : 1 product : hypothetical protein protein_id : XP_285588.2

name	LOC100042867 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270964 GeneID:100042867
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476682.1

name	Dynlt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543851 CCDS:CCDS30011.1 GeneID:67117 MGI:1914367
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0030286 - dynein complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003774 - motor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : T-complex associated-testis-expressed 1-like; vt-complex-associated-testis-expressed 1-like product : t-complex-associated-testis-expressed 1-like protein_id : NP_080251.3

name	1700054O13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385600 CCDS:CCDS30012.1 GeneID:67334 MGI:1914584
definition	GO_component : GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : Huntingtin interacting protein M protein_id : NP_080372.1

name	4930557A04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271038 GeneID:385317 MGI:1922521
definition	codon_start : 1 product : hypothetical protein LOC385317 protein_id : XP_001481301.1

name	Sytl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244488 GeneID:236643 MGI:2668451
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006887 - exocytosis [Evidence IDA]; GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 product : synaptotagmin-like 5 protein_id : NP_808372.1

name	Srpx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394362 CCDS:CCDS30013.1 GeneID:51795 MGI:1858306
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : sushi-repeat-containing protein, X chromosome product : sushi-repeat-containing protein, X-chromosome protein_id : NP_058607.1

name	Rpgr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755348 CCDS:CCDS30014.1 GeneID:19893 MGI:1344037
definition	GO_component : GO:0005929 - cilium [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0042462 - eye photoreceptor cell development [Evidence IMP]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence ISS] [Evidence IMP] codon_start : 1 product : retinitis pigmentosa GTpase regulator protein_id : NP_035415.1

name	Otc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679184 CCDS:CCDS30015.1 GeneID:18416 MGI:97448
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0009348 - ornithine carbamoyltransferase complex [Evidence IEA] GO_function : GO:0016597 - amino acid binding [Evidence IEA]; GO:0016743 - carboxyl- and carbamoyltransferase activity [Evidence IEA]; GO:0004585 - ornithine carbamoyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA]; GO:0006520 - amino acid metabolism [Evidence IEA]; GO:0006526 - arginine biosynthesis [Evidence IEA]; GO:0000050 - urea cycle [Evidence IEA] codon_start : 1 note : sparse fur product : ornithine transcarbamylase protein_id : NP_032795.1

name	Tspan7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662761 CCDS:CCDS30016.1 GeneID:21912 MGI:1298407
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : transmembrane 4 superfamily member 2 product : tetraspanin 7 protein_id : NP_062608.2

name	EG546265 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999865 GeneID:546265 MGI:3647036
definition	codon_start : 1 product : similar to Chain A, Crystal Structure Of Human Rangap1-Ubc9 protein_id : XP_620954.2

name	LOC633354 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271040 GeneID:633354
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481302.1

name	LOC100042912 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270967 GeneID:100042912
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477023.1

name	Mid1ip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386020 CCDS:CCDS30018.1 GeneID:68041 MGI:1915291
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0015630 - microtubule cytoskeleton [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007026 - negative regulation of microtubule depolymerization [Evidence IGI] codon_start : 1 product : Mid1 interacting protein protein_id : NP_080800.1

name	LOC436194 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436194
definition	number : 1 pseudo : _no_value

name	LOC436194 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436194
definition	number : 2 pseudo : _no_value

name	LOC633361 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:633361
definition	number : 2 pseudo : _no_value

name	LOC633361 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:633361
definition	number : 1 pseudo : _no_value

name	4933416E14Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270965 GeneID:71180 MGI:1918430
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 4933416E14 gene transcript_id : XR_032962.1

name	LOC668982 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:94407008 GeneID:668982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins product : similar to High mobility group box 1 pseudo : _no_value transcript_id : XR_002281.1

clone name	MSMg01-482I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351E08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-303I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318J24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-335A23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-522O10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-064M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541B03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-381P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168C06
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-397G23.T7 (MSMg01no397_g23.b1)	MSMg01-397G23.TJ (MSMg01no397_g23.g1)
ACC	AG497776	AG497777
length	763	1,309
length of high quality (start - end)	422 (42 - 463)	---
definition	CHROMAT_FILE: MSMg01no397_g23.b1 PHD_FILE: MSMg01no397_g23.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:09:52 2005	CHROMAT_FILE: MSMg01no397_g23.g1 PHD_FILE: MSMg01no397_g23.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:09:52 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	TXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTTTCGAGGATCCGCGGAATT CAGGTCAAGATCCCAGAGGCAAAAGCTGAGGCAGAGAACACAGAGGAGTG TTATTTACTGGCTTGCTCATCATGGCTTGGTCATCCTGCTTTCTTATGCA TGCCCAGGGATACCATTGCCCACAGTGGCAATTACATTAATGATTAACCA AGAAAATGACCCACAGACATGCTTACAAACCAATTTGATGGTGATAAATT TTCAATATATGTTTTTTCTTCCAAAGTGACTCTATTTGTGTTGAGTTGAC AAAAATCTAACCAGTACAAAGGACAATGATTTTTGTCTTCAAATATGGTA TTAACTGTCAACCCCTTGAAGGGTCTTTTATCTTTTCTGGACTGATGTTT CCTTCTTGGCTTAGCTTGCTAAACTATCTTATCAGAAATAAGAATGAACA GAGACTTACTCTTAAAAAAGTTGGTGAGAATACAAACTCTTCCTTTGATG ATAGGNATATTCCAGTTGGGTCTGGATTTCTAAATATCTGAGGCAGCTGG TAGAATACTTATGATACAGTACGAAGACCCCATTCAATCTGATCATCCGT TGGAAAAACCCGAAAAAACCTGGCCTAAATGATCAAGCTGGGAAGGAGGA TATTGTGCCCCAAAACCCCTTCGGCCCCTCCGGAGGGGGAACCAAAAACC CTGAAACAATTTGGGAAGGGCCCACCCCTCGCCCCCGAACATTTTAGATC TTTATTGGAACCA	CGTGCCACTGTCGCGCTTCGTGTCTCGGCGACGGAAGCGCGGGTGTCTCG GTCGTCTAGACCGGGCAGTCAAATGGGCCGGAATAAGAATTACATCTGGT GATCGCCGACTGGCAAGATCTCTACGAACCTGTGGATTATCTGGTACACT ATACTGTGCGCAATGGGTAATTACGATACTGTAGGTCGTCAGTCTACCGA TGATAGTACTTCTGGAGCAAGAACATANAGTCCGCGTACATCTTATCCAC TATACTCTAACGATATCAACATGACGTAGTCGCCCTAATGAAACTAGTCT GATCGTCTACTTTTAGGCGACGCACGACGCGTATGATATCACACCGGGCG AGATCACACCACATATCTGGTGTGTTAATGGTGTACTGGACTGGAGCTGT ACCATAGTACACGCTGTCGTGTTGGCCGGAAGCCCATGACTTAATAGCGA TAATACGGGCGTGGTAGCGAACGATACTGCCGCGATCAGACACGCCCTGG ACAGCCTCACGAGTGTTTGTATGTACGATTGGAGGTGTCGGCCCGGCGCA ATGTCGATATCGCGCGTAGAGCGCGATATATACGTAACAAATCGGTGACG GAACATATCCGACTGGTATAACCGAGTTTTACTGACGAGGCGAGACCGCC AACGGAACGCCGTGTGTACGTGGTAGCCAGCGGCACTATTTGCCGTCGTG ATACGTGATAACATGCAATACTTCCCGCGCTGTGCTACAACATATTTATC GCGAGCAATACTCACGTCACCGATGTATACTAAGTGTATTGGCAAGTAGA GTCAATATGAACGGCGCTCCACATCGATAATGAGCGCACCCGCTCGGCAG TATTATTCTTGCCGCAAATTACGCACCGGCTTGCCTATCTAGCAGAGCGT ATACGTACGGCGGTCGAATATCTAGAACATATAATCGAGCGGTCGTTGTC GTTGTCAGGTATGATACAGTGACTCAGTAATCTACCCGCACGCGTGTCCA CACTATGCGGCTCACACCTCATCGATATATATATCGNTGATAATTAGGTC CGGCAGTAGCAGAAGTGCGCGCAGACTTAATATTATATACGANAGACGCC GACGNGCACCTGCCCGTCTCTGGATGTTCACACGGCTTCGTGTTGTGAAC CAGGCGCTCGGATACGCGTCAAATCCTCTCCTAGTCAGACATATACTATT AATGTCGGGTTANTCTAGCGCGGGCGCTGCGCCGATTCGTCACCGAATCG AGTAAGATACACTCGGNCGCGTACGCTAATACGTGGTCATGATATCTCNG CGTGCTACG
quality values	Open. Hide. 8 8 8 10 21 33 32 34 34 22 18 18 27 28 37 37 37 37 41 44 44 27 24 24 24 24 28 27 16 16 10 12 12 9 9 9 8 10 10 10 10 20 23 32 34 29 31 31 28 28 23 20 20 30 30 30 21 15 10 11 12 10 11 10 10 10 19 22 37 30 30 35 37 59 44 48 43 43 40 43 43 57 57 48 50 50 43 47 42 47 42 42 42 48 57 48 48 48 48 54 54 54 54 54 68 54 57 57 57 54 57 57 57 57 54 57 57 47 44 47 41 39 39 43 48 57 57 57 57 57 57 43 46 44 57 57 57 54 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 50 47 42 42 30 38 46 48 57 68 57 57 59 57 57 57 59 59 59 59 59 59 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 52 57 59 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 57 57 57 57 68 57 57 57 57 57 57 59 57 57 57 57 57 68 68 57 57 57 57 57 57 57 57 68 68 68 68 68 57 57 52 52 52 57 59 68 59 59 59 59 59 59 59 59 59 59 59 57 57 43 43 43 50 59 57 57 57 57 68 68 68 68 68 59 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 46 46 40 57 57 57 57 57 57 59 57 44 43 43 46 57 57 57 57 57 57 59 59 57 57 57 44 44 28 28 28 44 44 59 59 59 54 54 54 57 57 68 68 59 59 43 43 43 43 43 48 44 44 48 48 48 43 43 48 48 48 57 57 48 57 57 59 59 48 48 47 47 47 59 59 43 41 37 37 41 43 47 47 37 37 30 30 30 37 34 37 41 43 41 37 36 32 32 41 30 34 17 17 18 30 30 39 39 36 39 39 41 47 47 59 59 41 37 37 34 28 19 13 13 27 27 44 59 59 43 37 29 25 25 32 24 24 30 30 30 34 34 36 37 34 40 39 37 33 30 15 11 14 11 17 21 19 10 8 8 8 10 12 12 12 18 16 14 12 12 12 13 12 24 22 24 24 23 24 24 31 26 25 25 22 26 25 21 24 12 12 11 8 3 0 3 8 8 10 10 16 11 11 11 17 12 18 15 10 10 9 11 12 9 10 11 8 8 8 11 9 10 10 10 9 12 12 12 14 9 9 9 10 10 11 12 11 8 8 8 8 6 6 6 6 8 11 12 10 10 10 15 16 14 21 21 18 18 15 12 13 11 9 9 9 9 9 10 12 12 11 8 8 6 7 6 8 6 8 8 8 8 8 8 8 8 8 7 7 7 7 8 9 12 13 11 10 8 9 9 9 10 10 14 14 12 11 11 10 10 8 8 8 8 10 8 8 8 10 10 8 11 12 12 12 11 9 9 9 9 9 8 8 8 8 9 9 9 9 9 9 9 10 10 10 10 9 8 11 10 12 9 9 10 10 10 9 8 8 8 8 8 8 10 11 8 6 6 6 8 8 10 10 8 10 9 9 9 11 16 12 11 12 12 12 11 11 11 13 13 9 9 9 9 9 8 9 9 9 8 8 11 13 10 10 10 11 10 9 9 10 9 9 9 10 10 9 9 7 8 12 19 24 15 12 10 8 8 8 8 10 9 8 6 6 8 8 8 8 9 17 8 8 8 8 8 8 10 11 11 13 11	Open. Hide. 9 9 9 9 9 8 8 8 8 8 6 6 6 7 10 10 8 8 8 8 8 8 8 12 12 9 9 10 9 9 8 10 11 8 8 8 8 8 6 6 6 8 8 8 8 8 8 8 8 10 8 8 8 8 10 8 8 8 8 8 11 7 6 6 6 6 8 6 7 10 8 8 8 8 8 8 8 11 13 10 9 12 8 8 8 8 8 8 8 9 10 10 10 10 10 10 10 6 8 7 6 8 8 8 8 12 10 8 8 8 6 6 6 6 8 8 6 6 8 8 9 9 6 8 6 6 8 8 11 10 11 12 12 12 12 8 6 6 6 6 6 11 11 9 8 8 8 8 8 8 6 6 8 8 10 13 10 9 9 9 9 8 8 8 8 8 8 11 12 12 13 10 8 8 10 8 8 8 8 8 8 8 6 7 8 8 6 7 7 7 7 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 8 8 6 6 8 6 8 8 8 8 10 11 3 0 3 13 8 8 6 7 6 6 11 11 10 11 10 10 8 8 8 8 8 8 8 11 11 10 10 10 8 8 8 8 8 8 8 9 8 8 8 8 9 8 8 8 8 8 6 6 8 8 8 8 8 8 8 8 12 8 8 8 8 8 8 9 9 9 9 9 10 10 13 8 8 8 8 8 8 11 8 8 6 6 6 7 10 10 9 9 10 10 8 8 8 8 8 8 8 8 9 11 11 10 8 8 6 6 6 6 8 10 8 8 8 8 6 6 6 6 8 8 8 9 9 10 10 10 10 10 11 8 8 8 8 10 11 10 8 8 8 8 8 9 9 9 8 8 6 7 8 8 11 11 8 6 6 6 8 8 11 11 10 8 8 8 8 8 8 8 10 6 6 6 6 8 10 13 13 10 10 8 8 8 6 6 8 8 11 11 13 10 10 10 8 8 8 8 8 8 8 8 8 8 8 8 10 10 13 10 8 8 8 8 8 8 11 11 6 6 6 6 6 7 10 8 8 8 8 10 6 6 8 8 8 8 8 6 8 6 6 8 6 8 8 8 6 6 8 8 8 8 6 6 6 8 11 11 11 10 10 10 10 8 8 6 6 8 8 8 8 8 8 8 8 10 8 8 9 10 10 8 8 8 8 6 6 8 8 8 9 9 9 15 8 8 6 6 8 8 10 10 10 10 10 8 8 8 8 8 8 8 8 8 10 10 13 6 6 6 6 6 6 7 9 10 10 9 9 6 8 8 8 8 8 8 8 8 8 10 8 8 8 8 6 6 8 8 10 10 10 10 13 10 10 10 10 8 8 6 6 6 6 10 11 11 9 8 8 10 8 8 8 10 10 8 8 10 8 8 8 8 8 8 8 6 6 8 10 8 8 8 10 11 10 10 6 6 8 8 6 6 6 6 6 8 8 10 8 8 7 9 9 10 11 9 8 6 6 6 6 8 8 10 8 10 11 11 10 10 6 6 7 6 8 6 6 6 6 8 8 9 11 15 14 12 8 10 10 10 8 8 6 6 8 6 6 8 6 7 12 12 8 8 8 8 8 8 8 12 13 13 8 8 8 8 8 8 10 8 8 8 8 10 8 8 8 8 8 8 8 8 11 8 8 8 8 8 10 8 9 10 11 10 9 8 8 6 6 8 8 10 8 8 8 8 10 8 11 8 8 8 8 8 8 8 6 6 6 6 8 8 10 10 13 8 8 8 11 8 8 10 10 10 8 10 10 9 8 8 8 8 8 10 10 10 7 7 8 8 8 9 9 9 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 7 8 9 8 8 8 8 8 8 8 8 10 8 8 8 8 8 8 10 13 8 9 9 8 8 12 8 8 8 8 10 15 10 10 8 8 8 8 8 8 8 8 8 8 10 8 8 8 6 8 8 6 7 8 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 11 8 10 10 8 7 7 6 8 8 8 12 9 11 11 10 12 12 12 10 8 8 8 8 10 12 11 11 12 16 9 9 9 10 10 8 8 8 8 8 8 8 6 6 6 6 8 8 10 8 8 8 8 9 10 13 10 10 12 8 6 6 8 8 9 6 8 8 8 8 8 6 6 8 8 8 8 6 6 8 6 6 8 6 6 6 8 10 10 11 10 8 8 6 6 10 6 6 8 8 10 8 8 8 8 10 10 16 10 10 8 8 8 8 8 8 10 10 20 10 11 11 10 10 10 10 13 10 11 11 10 8 8 6 6 7 8 8 10 6 6 8 7 6 6 6 8 8 6 6 6 6 8 8 8 8 8 8 6 6 8 8 3 0 3 8 8 8 8 8 8 8 8 11 9 9 8 6 6 6 6 8 8 6 6 6 8 6 8 8 8 10 8 8 6 6 7 7 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 6 6 8 8 3 0 3 6 6 6 8 6 8 8 8 7 3 0 3 8 8 8 8 10 10 10 10 8 11 10 11 8 8 8 6 6 6 9 12 15 12 8 8 6 6 8 7 6 8 10 10 10 8 10 10 8 8 6 6 8 8 6 6 6 6 7 7 10 10 10 10 10 8 6 8 8 8 10 12 10 8 8 8 8 8 8 8 8 8 8 9 9 9 10 9 9 9 11 8 8 8 8 8 8 8 10 8 8 8 8 8 8 6 8 6 6 6 8 7 7 8 10 10 12 3 0 3 8 6 6 6 8 7 6 6 6 8 8 6 6 6 6 6 6 8 6 6 8 6 11 10 10 8 8 10 8 8 6 7 7 12 11 8 8 6 6 6 6 8 8 8 8 10 12 14 12 6 6 3 0 3 7 9 10 8 8 8 8 8 8 8 8 8 10 9 8 8 8 8 9 8 8 8 8 8 8 8 8 8 7 3 0 3 13 17 13 12 12 13 15 15 12

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no397_g23.b1 MSMg01no397_g23.b1 CHROMAT_FILE:
MSMg01no397_g23.b1 PHD_FILE: MSMg01no397_g23.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 18:09:52 2005
         (422 letters)



>mm_chrX_9721188_9722009
          Length = 822

 Score =  625 bits (323), Expect = 0.0
 Identities = 338/343 (98%), Gaps = 3/343 (0%)
 Strand = Plus / Minus

                                                                       
Query: 82  tggcttggtcatcctgctttcttatgcatgcccagggataccattgcccacagtggcaat 141
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 822 tggcttggtcagcctgctttcttatgcatgcccagggataccattgcccacagtggcaat 763

                                                                       
Query: 142 tacattaatgattaaccaagaaaatgacccacagacatgcttacaaaccaatttgatggt 201
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 762 tacattaatgattaaccaagaaaatgacccacagacatgcttacaaaccaatttgatggt 703

                                                                       
Query: 202 gataaattttcaatatatgttttttcttccaaagtgactcta-tttgtgttgagttgaca 260
           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 702 gataaattttcaatatatgttttttcttccaaagtgactctagtttgtgttgagttgaca 643

                                                                       
Query: 261 aaaatctaaccagtacaa-aggacaatgatttttgtcttcaaatatggtattaactgtca 319
           |||||||||||||||||| | ||||||||||||| |||||||||||||||||||||||||
Sbjct: 642 aaaatctaaccagtacaaca-gacaatgatttttatcttcaaatatggtattaactgtca 584

                                                                       
Query: 320 accccttgaagggtcttttatcttttctggactgatgtttccttcttggcttagcttgct 379
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 583 accccttgaagggtcttttatcttttctggactgatgtttccttcttggcttagcttgct 524

                                                      
Query: 380 aaactatcttatcagaaataagaatgaacagagacttactctt 422
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 523 aaactatcttatcagaaataagaatgaacagagacttactctt 481


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 16
Number of extensions: 3
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 422
Length of database: 822
Length adjustment: 9
Effective length of query: 413
Effective length of database: 813
Effective search space:   335769
Effective search space used:   335769
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information