MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-414K17
Chromosome	X (Build37)
Map Location	10,329,056 - 10,329,558
singlet/doublet	singlet
Overlap gene	none
Upstream gene	1700054O13Rik, 4930557A04Rik, Sytl5, LOC436194, Srpx, Rpgr, Otc, 4933416E14Rik, Tspan7, EG546265, LOC633354, LOC633361, LOC100042912, Mid1ip1
Downstream gene	LOC668982, Ppia-psx_105.1, LOC100042922, LOC100042927, LOC100042929, LOC100042931, OTTMUSG00000016790, LOC100042939, LOC100042943, LOC100042944, LOC100042946, EG236663, 8430439B09Rik, LOC669520
Link	Open Mouse BAC browser

Click to get alignment info.

name	1700054O13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67334 MGI:1914584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930557A04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385317 MGI:1922521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	Sytl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236643 MGI:2668451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC436194 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins pseudo : _no_value

name	Srpx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51795 MGI:1858306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpgr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19893 MGI:1344037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Otc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18416 MGI:97448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933416E14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71180 MGI:1918430
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Tspan7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21912 MGI:1298407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546265 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546265 MGI:3647036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 779 ESTs, 6 Proteins

name	LOC633354 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	LOC633361 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 Proteins pseudo : _no_value

name	LOC100042912 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Mid1ip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68041 MGI:1915291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668982 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins pseudo : _no_value

name	Ppia-psx_105.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547156
definition	note : peptidylprolyl isomerase A pseudogene x_105.1 pseudo : _no_value

name	LOC100042922 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	LOC100042927 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042927
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	LOC100042929 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	LOC100042931 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	OTTMUSG00000016790 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547160 MGI:3649617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042939 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	LOC100042943 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	LOC100042944 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	LOC100042946 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	EG236663 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236663 MGI:3643273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	8430439B09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78147 MGI:1925397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC669520 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669520
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	1700054O13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385599 GeneID:67334 MGI:1914584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700054O13 gene transcript_id : NM_026096.1

name	4930557A04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271037 GeneID:385317 MGI:1922521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : RIKEN cDNA 4930557A04 gene transcript_id : XM_001481251.1

name	Sytl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343248 GeneID:236643 MGI:2668451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin-like 5 transcript_id : NM_177704.2

name	Srpx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367987 GeneID:51795 MGI:1858306
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sushi-repeat-containing protein transcript_id : NM_016911.3

name	Rpgr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755347 GeneID:19893 MGI:1344037
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinitis pigmentosa GTPase regulator transcript_id : NM_011285.1

name	Otc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803523 GeneID:18416 MGI:97448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ornithine transcarbamylase transcript_id : NM_008769.3

name	Tspan7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662760 GeneID:21912 MGI:1298407
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 7 transcript_id : NM_019634.2

name	EG546265 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407006 GeneID:546265 MGI:3647036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 779 ESTs, 6 Proteins product : predicted gene, EG546265 transcript_id : XM_620954.3

name	LOC633354 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271039 GeneID:633354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : similar to lactate dehydrogenase 1, A chain transcript_id : XM_001481252.1

name	LOC100042912 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270966 GeneID:100042912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100042912 transcript_id : XM_001476973.1

name	Mid1ip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801493 GeneID:68041 MGI:1915291
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Mid1 interacting protein 1 (gastrulation specific G12-like (zebrafish)) transcript_id : NM_026524.3

name	LOC100042922 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270968 GeneID:100042922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001476992.1

name	LOC100042927 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270970 GeneID:100042927
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : hypothetical protein LOC100042927 transcript_id : XM_001477006.1

name	LOC100042929 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270972 GeneID:100042929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001477023.1

name	LOC100042931 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270974 GeneID:100042931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001477035.1

name	OTTMUSG00000016790 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347343 GeneID:547160 MGI:3649617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000016790 transcript_id : NM_001025260.2

name	LOC100042939 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270976 GeneID:100042939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001477063.1

name	LOC100042943 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270978 GeneID:100042943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001477078.1

name	LOC100042944 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270980 GeneID:100042944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001477092.1

name	LOC100042946 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270982 GeneID:100042946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001477106.1

name	EG236663 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20983169 GeneID:236663 MGI:3643273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : predicted gene, EG236663 transcript_id : XM_141620.1

name	8430439B09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270984 GeneID:78147 MGI:1925397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 8430439B09 gene transcript_id : XM_001477135.1

name	LOC669520 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271041 GeneID:669520
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical LOC669520 transcript_id : XM_001481253.1

name	1700054O13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385600 CCDS:CCDS30012.1 GeneID:67334 MGI:1914584
definition	GO_component : GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : Huntingtin interacting protein M protein_id : NP_080372.1

name	4930557A04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271038 GeneID:385317 MGI:1922521
definition	codon_start : 1 product : hypothetical protein LOC385317 protein_id : XP_001481301.1

name	Sytl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244488 GeneID:236643 MGI:2668451
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006887 - exocytosis [Evidence IDA]; GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 product : synaptotagmin-like 5 protein_id : NP_808372.1

name	Srpx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394362 CCDS:CCDS30013.1 GeneID:51795 MGI:1858306
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : sushi-repeat-containing protein, X chromosome product : sushi-repeat-containing protein, X-chromosome protein_id : NP_058607.1

name	Rpgr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755348 CCDS:CCDS30014.1 GeneID:19893 MGI:1344037
definition	GO_component : GO:0005929 - cilium [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0042462 - eye photoreceptor cell development [Evidence IMP]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence ISS] [Evidence IMP] codon_start : 1 product : retinitis pigmentosa GTpase regulator protein_id : NP_035415.1

name	Otc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679184 CCDS:CCDS30015.1 GeneID:18416 MGI:97448
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0009348 - ornithine carbamoyltransferase complex [Evidence IEA] GO_function : GO:0016597 - amino acid binding [Evidence IEA]; GO:0016743 - carboxyl- and carbamoyltransferase activity [Evidence IEA]; GO:0004585 - ornithine carbamoyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA]; GO:0006520 - amino acid metabolism [Evidence IEA]; GO:0006526 - arginine biosynthesis [Evidence IEA]; GO:0000050 - urea cycle [Evidence IEA] codon_start : 1 note : sparse fur product : ornithine transcarbamylase protein_id : NP_032795.1

name	Tspan7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662761 CCDS:CCDS30016.1 GeneID:21912 MGI:1298407
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : transmembrane 4 superfamily member 2 product : tetraspanin 7 protein_id : NP_062608.2

name	EG546265 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999865 GeneID:546265 MGI:3647036
definition	codon_start : 1 product : similar to Chain A, Crystal Structure Of Human Rangap1-Ubc9 protein_id : XP_620954.2

name	LOC633354 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271040 GeneID:633354
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481302.1

name	LOC100042912 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270967 GeneID:100042912
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477023.1

name	Mid1ip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386020 CCDS:CCDS30018.1 GeneID:68041 MGI:1915291
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0015630 - microtubule cytoskeleton [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007026 - negative regulation of microtubule depolymerization [Evidence IGI] codon_start : 1 product : Mid1 interacting protein protein_id : NP_080800.1

name	LOC100042922 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270969 GeneID:100042922
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477042.1

name	LOC100042927 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270971 GeneID:100042927
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477056.1

name	LOC100042929 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270973 GeneID:100042929
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477073.1

name	LOC100042931 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270975 GeneID:100042931
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477085.1

name	OTTMUSG00000016790 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608196 GeneID:547160 MGI:3649617
definition	codon_start : 1 note : Novel protein similar to Histone H2A product : hypothetical protein LOC547160 protein_id : NP_001020431.1

name	LOC100042939 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270977 GeneID:100042939
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477113.1

name	LOC100042943 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270979 GeneID:100042943
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477128.1

name	LOC100042944 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270981 GeneID:100042944
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477142.1

name	LOC100042946 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270983 GeneID:100042946
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477156.1

name	EG236663 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20983170 GeneID:236663 MGI:3643273
definition	codon_start : 1 product : hypothetical protein protein_id : XP_141620.1

name	8430439B09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270985 GeneID:78147 MGI:1925397
definition	codon_start : 1 product : hypothetical protein LOC78147 protein_id : XP_001477185.1

name	LOC669520 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271042 GeneID:669520
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481303.1

name	LOC436194 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436194
definition	number : 1 pseudo : _no_value

name	LOC436194 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436194
definition	number : 2 pseudo : _no_value

name	LOC633361 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:633361
definition	number : 2 pseudo : _no_value

name	LOC633361 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:633361
definition	number : 1 pseudo : _no_value

name	4933416E14Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270965 GeneID:71180 MGI:1918430
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 4933416E14 gene transcript_id : XR_032962.1

name	LOC668982 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:94407008 GeneID:668982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins product : similar to High mobility group box 1 pseudo : _no_value transcript_id : XR_002281.1

clone name	MSMg01-181L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541B03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-381P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352F23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-490N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012B12
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-414K17.T7 (MSMg01no414_k17.b1)	MSMg01-414K17.TJ (MSMg01no414_k17.g1)
ACC	AG510910	AG510911
length	783	764
length of high quality (start - end)	499 (77 - 575)	503 (80 - 582)
definition	CHROMAT_FILE: MSMg01no414_k17.b1 PHD_FILE: MSMg01no414_k17.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:32:47 2005	CHROMAT_FILE: MSMg01no414_k17.g1 PHD_FILE: MSMg01no414_k17.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:32:47 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	NNAATCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCG CGGAATTCTCACCTGTTCCATATAGAATGGCTGAGAAGCACCTGAAAAAA TGTTCAACATCCTTAATCATTATGGAAATCCAAATCAAAACAACCCTGAG ATTGCACCTCACACCAGTCAGAATGGCTAAGATCAAAAATTCAGGTGACA TCAGATGCTAGCGAGGATGTGGAGAAAGAGAAACACTTCTCCATTTTTGG TGGGATTGCAAGCTTGTACAACCACTCTGAAAATCAGTCTGATGGTTCCT CAGAAAATTTGACATAGTACTACTGGATTATCCTGCAATACCTCTCCTTG GCATATATCCAGACGATTTTCCAACCGAAGGACACATGCTCCACTATGTT CATAGCAGCCTTATTTATAATAGCCAGAAGCTGAAAAGAACCCAGATGCC CCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACAATGGAG TACTACTCAGCTATTANAAAGAATGAATTTATGAAATTTCTAGCCAAATG GATGGACCTGGAGGGCATCATCCTGAGTGAGGTAACCCAATCACAAAGGA ACTCACACAATATGTACTCACTGATAAGTAGAAATTATCCCAGAAACTTA TAATATTCCATTATCCAGGATCCAAGGCCATGGAACTCCCGAAGAACGAA GACCCAAGGGGGGGAACTTTTGGCCCTTCTTAAAATATGGAAAAAAAAAC CCCCTGAAAAGAGTATATAAATAAACTCTTGGG	NNCCGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXATTCTAATTGTGAAGCTGGCT GATAGGGTTATTGCATGTTCTTCTCTCATGCTGCCAGGTGGCCTGGGGGA GCTGGTGAAATGGGCTCAATCATCTATTAAGGCTTTTCCCGGTCTTAATG TCACCCACTTCTCATCGAAACCCATGGTCGCTGATGTTCATTTCCAAAGG TGATAACAGTGAGGTCATAAGAGATGGGGTTGCTCCTGTTAGGCTTTCAA AGGTAGCAGGCAAGATATCCCTGCCTTTCTTCTTTCTCCACCTTTTCGCA TATGTATATGGCTAACAAAGAAAACCAGACACAAAATACAGACAGTGAAA ACCAAGACATCTTAGAGCATCAGTTTCCTGAAGCACTGATTAAGTAGTTC ATTGCCGTGCTGGGTTATGTGCAAAAATAAAACAGAGGAACTCTCCTCTT TTGGAGGACTCACACAAAAAACCAAACACTGTGCACACGTGTGCATGAAT AAACAGCAGACCATCTGGGCTAAATACTGAAGACTCAAGACAGGTAAAGC CTAGGCACAATGCTCAAGAAACTCATGCAAAAAATGCTTATGGAAGATGT GGTAGCGCTCCCGCCAAAATGATAATTTTAAAAAGACAGTAGGAACTGAA GGGAAATGAAAATCCAGAATGGAAACCCATAAGAATGGAGCAAAGTCTGG AATATATTAAACTA
quality values	Open. Hide. 0 0 3 6 6 10 8 8 8 18 18 27 34 28 18 18 11 11 11 25 21 20 20 20 21 26 34 37 26 17 20 20 20 19 23 9 9 9 15 9 9 9 9 10 10 10 15 15 17 20 29 30 19 14 14 19 23 25 30 33 30 21 21 9 11 9 6 6 6 6 6 8 9 10 9 10 19 19 29 29 39 48 57 57 57 57 53 53 57 57 57 50 57 53 50 50 50 42 42 40 40 36 40 43 50 50 50 43 47 50 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 68 50 50 68 68 68 68 57 57 57 68 68 68 68 68 51 50 46 46 46 50 50 50 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 59 59 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 59 59 59 59 68 68 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 52 52 52 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 68 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 41 32 13 12 12 12 12 14 16 38 38 44 44 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 68 68 68 68 68 68 68 68 68 68 68 59 59 59 46 44 43 43 57 57 59 59 59 59 68 59 59 59 57 54 54 54 57 57 68 57 57 57 57 57 57 57 59 68 57 57 57 57 57 54 54 57 57 57 68 68 68 68 68 68 50 53 54 48 48 48 48 48 48 48 57 43 43 36 28 28 34 34 43 43 43 48 48 48 40 40 40 39 39 39 39 39 39 43 36 36 36 59 59 59 59 59 43 36 36 41 39 37 23 23 3 0 3 27 27 37 37 37 37 32 29 31 39 39 39 39 39 37 31 31 37 37 39 59 47 37 27 21 18 14 14 14 27 32 26 26 18 18 16 19 22 19 24 30 29 31 32 13 11 11 15 16 25 29 32 23 28 28 23 19 9 9 9 11 18 15 12 12 11 20 18 20 22 25 25 30 25 25 30 25 25 25 26 17 17 17 18 28 12 8 8 8 8 8 8 8 12 18 22 22 30 27 24 15 15 10 14 12 9 8 8 10 11 13 11 10 9 10 12 19 15 15 14 11 17 11 8 8 8 9 8 10 10 10 9 9 9 10 10 10 10 9 9 11 13 10 9 9 9 10 9 9 8 8 8 8 8 8 12 10 12 14 16 12 13 8 6 6 6 8 7 6 6 6 6 10 10 10 10 11 12 11 8 6 6 6 8 7 10 8 8 8 8 10 10 31 22 15 15 12 12 12 13 9 10 12 9 7 10 10 9 8 9 10 10 11 11 15 14 9 8 8 8 8 8 12 9 9 9 9 8 8 10 10 12 13 12 11 9 9 9 11 8 8 8 8 8 10 10 6 6 6 6 8 8 8 8 8 9 9 11 11 11 11 11 11 11 11	Open. Hide. 0 0 3 6 6 8 15 10 8 8 8 8 8 8 9 9 14 17 31 28 32 31 39 39 39 39 39 37 29 29 37 35 28 23 23 8 7 6 6 6 6 6 6 9 16 13 13 17 16 16 29 30 33 37 37 37 44 37 50 42 41 39 34 25 13 10 10 10 13 15 13 12 18 13 17 22 24 31 26 33 33 36 48 53 53 53 53 53 53 57 57 57 57 57 57 57 57 57 59 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 50 50 50 50 50 51 57 57 57 57 54 57 57 68 68 68 68 68 68 59 59 57 57 57 59 59 68 68 59 68 68 68 59 59 59 59 57 59 57 68 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 59 68 68 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 43 43 43 43 43 47 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 57 53 59 59 59 59 59 27 27 13 10 9 9 9 9 21 29 59 47 47 50 50 50 50 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 68 68 57 57 57 57 57 57 59 59 68 68 57 57 57 57 59 59 57 68 68 68 68 57 59 59 59 68 59 59 59 57 57 57 59 59 59 57 57 57 57 57 57 57 59 59 68 68 68 68 59 68 68 59 59 59 59 68 68 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 59 59 59 59 59 59 59 59 59 68 59 59 59 59 59 57 57 68 68 68 68 68 68 68 54 54 54 54 54 54 54 54 54 54 57 57 57 59 59 59 59 59 59 59 59 59 59 59 59 59 59 48 48 48 48 41 50 42 41 37 37 37 35 29 32 41 41 41 47 41 41 39 39 39 59 59 59 59 59 48 48 59 46 46 47 47 43 41 37 37 41 41 41 43 40 40 37 43 25 25 11 14 14 25 32 32 21 18 19 21 22 32 25 25 32 36 36 37 37 34 30 18 28 12 18 18 13 13 15 25 19 23 18 23 17 22 22 26 26 35 31 18 24 11 11 11 20 15 23 20 18 21 18 22 15 12 8 8 8 14 16 24 12 11 11 11 13 11 9 9 9 8 8 17 13 12 9 12 12 13 15 19 9 13 22 8 8 8 8 8 6 7 7 8 8 10 10 13 10 10 13 11 10 12 15 19 12 12 12 16 12 12 11 11 11 11 12 8 18 9 11 11 14 13 14 14 9 9 9 10 10 12 12 12 16 11 15 10 9 9 9 9 9 12 9 10 9 10 10 15 19 10 10 8 8 8 8 9 9 9 9 9 10 20 20 22 13 9 12 8 8 8 8 8 8 8 8 8 8 10 10 9 9 8 8 12 9 9 8 8 6 8 6 6 6 8 8 8 8 8 7 8 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no414_k17.g1 MSMg01no414_k17.g1 CHROMAT_FILE:
MSMg01no414_k17.g1 PHD_FILE: MSMg01no414_k17.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 18:32:47 2005
         (503 letters)



>mm_chrX_10328856_10329758
          Length = 903

 Score =  965 bits (499), Expect = 0.0
 Identities = 502/503 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   attctaattgtgaagctggctgatagggttattgcatgttcttctctcatgctgccaggt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 attctaattgtgaagctggctgatagggttattgcatgttcttctctcatgctgccaggt 260

                                                                       
Query: 61  ggcctgggggagctggtgaaatgggctcaatcatctattaaggcttttcccggtcttaat 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 ggcctgggggagctggtgaaatgggctcaatcatctattaaggcttttcccggtcttaat 320

                                                                       
Query: 121 gtcacccacttctcatcgaaacccatggtcgctgatgttcatttccaaaggtgataacag 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 gtcacccacttctcatcgaaacccatggtcgctgatgttcatttccaaaggtgataacag 380

                                                                       
Query: 181 tgaggtcataagagatggggttgctcctgttaggctttcaaaggtagcaggcaagatatc 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 tgaggtcataagagatggggttgctcctgttaggctttcaaaggtagcaggcaagatatc 440

                                                                       
Query: 241 cctgcctttcttctttctccaccttttcgcatatgtatatggctaacaaagaaaaccaga 300
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 cctgcctttctgctttctccaccttttcgcatatgtatatggctaacaaagaaaaccaga 500

                                                                       
Query: 301 cacaaaatacagacagtgaaaaccaagacatcttagagcatcagtttcctgaagcactga 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 501 cacaaaatacagacagtgaaaaccaagacatcttagagcatcagtttcctgaagcactga 560

                                                                       
Query: 361 ttaagtagttcattgccgtgctgggttatgtgcaaaaataaaacagaggaactctcctct 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 561 ttaagtagttcattgccgtgctgggttatgtgcaaaaataaaacagaggaactctcctct 620

                                                                       
Query: 421 tttggaggactcacacaaaaaaccaaacactgtgcacacgtgtgcatgaataaacagcag 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 621 tttggaggactcacacaaaaaaccaaacactgtgcacacgtgtgcatgaataaacagcag 680

                                  
Query: 481 accatctgggctaaatactgaag 503
           |||||||||||||||||||||||
Sbjct: 681 accatctgggctaaatactgaag 703


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 25
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 503
Length of database: 903
Length adjustment: 10
Effective length of query: 493
Effective length of database: 893
Effective search space:   440249
Effective search space used:   440249
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information