MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-467D08
Chromosome	X (Build37)
Map Location	11,232,662 - 11,406,322
singlet/doublet	doublet
Overlap gene	LOC669520
Upstream gene	EG546265, LOC633354, LOC633361, LOC100042912, Mid1ip1, LOC668982, Ppia-psx_105.1, LOC100042922, LOC100042927, LOC100042929, LOC100042931, OTTMUSG00000016790, LOC100042939, LOC100042943, LOC100042944, LOC100042946, EG236663, 8430439B09Rik
Downstream gene	Rpl23a-ps, LOC100043945, Bcor, 2900008C10Rik, LOC385323, LOC100043946, LOC628441, Atp6ap2, LOC668986, EG245347, 1810030O07Rik, Crsp2
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG546265 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546265 MGI:3647036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 779 ESTs, 6 Proteins

name	LOC633354 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	LOC633361 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 Proteins pseudo : _no_value

name	LOC100042912 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Mid1ip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68041 MGI:1915291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668982 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins pseudo : _no_value

name	Ppia-psx_105.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547156
definition	note : peptidylprolyl isomerase A pseudogene x_105.1 pseudo : _no_value

name	LOC100042922 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	LOC100042927 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042927
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	LOC100042929 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	LOC100042931 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	OTTMUSG00000016790 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547160 MGI:3649617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042939 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	LOC100042943 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	LOC100042944 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	LOC100042946 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	EG236663 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236663 MGI:3643273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	8430439B09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78147 MGI:1925397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC669520 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669520
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Rpl23a-ps (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628338
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100043945 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043945
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	Bcor (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71458 MGI:1918708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	2900008C10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72937 MGI:1920187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs

name	LOC385323 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100043946 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC628441 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628441
definition	note : ribosomal protein L30 pseudogene pseudo : _no_value

name	Atp6ap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70495 MGI:1917745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668986 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 5 Proteins pseudo : _no_value

name	EG245347 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245347 MGI:3644533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 6 Proteins

name	1810030O07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69155 MGI:1916405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crsp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26896 MGI:1349442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG546265 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407006 GeneID:546265 MGI:3647036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 779 ESTs, 6 Proteins product : predicted gene, EG546265 transcript_id : XM_620954.3

name	LOC633354 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271039 GeneID:633354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : similar to lactate dehydrogenase 1, A chain transcript_id : XM_001481252.1

name	LOC100042912 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270966 GeneID:100042912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100042912 transcript_id : XM_001476973.1

name	Mid1ip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801493 GeneID:68041 MGI:1915291
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Mid1 interacting protein 1 (gastrulation specific G12-like (zebrafish)) transcript_id : NM_026524.3

name	LOC100042922 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270968 GeneID:100042922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001476992.1

name	LOC100042927 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270970 GeneID:100042927
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : hypothetical protein LOC100042927 transcript_id : XM_001477006.1

name	LOC100042929 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270972 GeneID:100042929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001477023.1

name	LOC100042931 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270974 GeneID:100042931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001477035.1

name	OTTMUSG00000016790 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347343 GeneID:547160 MGI:3649617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000016790 transcript_id : NM_001025260.2

name	LOC100042939 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270976 GeneID:100042939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001477063.1

name	LOC100042943 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270978 GeneID:100042943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001477078.1

name	LOC100042944 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270980 GeneID:100042944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001477092.1

name	LOC100042946 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270982 GeneID:100042946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001477106.1

name	EG236663 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20983169 GeneID:236663 MGI:3643273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : predicted gene, EG236663 transcript_id : XM_141620.1

name	8430439B09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270984 GeneID:78147 MGI:1925397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 8430439B09 gene transcript_id : XM_001477135.1

name	LOC669520 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271041 GeneID:669520
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical LOC669520 transcript_id : XM_001481253.1

name	Bcor (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66792787 GeneID:71458 MGI:1918708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl6 interacting corepressor transcript_id : NM_175045.2

name	Bcor (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351506 GeneID:71458 MGI:1918708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl6 interacting corepressor transcript_id : NM_175046.2

name	Bcor (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365597 GeneID:71458 MGI:1918708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl6 interacting corepressor transcript_id : NM_175044.2

name	Bcor (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142346423 GeneID:71458 MGI:1918708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl6 interacting corepressor transcript_id : NM_029510.2

name	2900008C10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270986 GeneID:72937 MGI:1920187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs product : RIKEN cDNA 2900008C10 gene transcript_id : XM_001477165.1

name	LOC100043946 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271044 GeneID:100043946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100043946 transcript_id : XM_001481254.1

name	Atp6ap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801711 GeneID:70495 MGI:1917745
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal accessory protein 2 transcript_id : NM_027439.3

name	EG245347 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407015 GeneID:245347 MGI:3644533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 6 Proteins product : predicted gene, EG245347 transcript_id : XM_141624.4

name	1810030O07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372747 GeneID:69155 MGI:1916405
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810030O07 gene transcript_id : NM_175141.3

name	Crsp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270976 GeneID:26896 MGI:1349442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cofactor required for Sp1 transcriptional activation, subunit 2 transcript_id : NM_001048208.1

name	Crsp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270971 GeneID:26896 MGI:1349442
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cofactor required for Sp1 transcriptional activation, subunit 2 transcript_id : NM_012005.3

name	EG546265 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999865 GeneID:546265 MGI:3647036
definition	codon_start : 1 product : similar to Chain A, Crystal Structure Of Human Rangap1-Ubc9 protein_id : XP_620954.2

name	LOC633354 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271040 GeneID:633354
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481302.1

name	LOC100042912 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270967 GeneID:100042912
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477023.1

name	Mid1ip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386020 CCDS:CCDS30018.1 GeneID:68041 MGI:1915291
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0015630 - microtubule cytoskeleton [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007026 - negative regulation of microtubule depolymerization [Evidence IGI] codon_start : 1 product : Mid1 interacting protein protein_id : NP_080800.1

name	LOC100042922 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270969 GeneID:100042922
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477042.1

name	LOC100042927 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270971 GeneID:100042927
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477056.1

name	LOC100042929 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270973 GeneID:100042929
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477073.1

name	LOC100042931 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270975 GeneID:100042931
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477085.1

name	OTTMUSG00000016790 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608196 GeneID:547160 MGI:3649617
definition	codon_start : 1 note : Novel protein similar to Histone H2A product : hypothetical protein LOC547160 protein_id : NP_001020431.1

name	LOC100042939 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270977 GeneID:100042939
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477113.1

name	LOC100042943 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270979 GeneID:100042943
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477128.1

name	LOC100042944 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270981 GeneID:100042944
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477142.1

name	LOC100042946 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270983 GeneID:100042946
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477156.1

name	EG236663 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20983170 GeneID:236663 MGI:3643273
definition	codon_start : 1 product : hypothetical protein protein_id : XP_141620.1

name	8430439B09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270985 GeneID:78147 MGI:1925397
definition	codon_start : 1 product : hypothetical protein LOC78147 protein_id : XP_001477185.1

name	LOC669520 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271042 GeneID:669520
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481303.1

name	Bcor (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281849 CCDS:CCDS30022.1 GeneID:71458 MGI:1918708
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform d is encoded by transcript variant d; BCL-6 corepressor product : BCL-6 interacting corepressor isoform d protein_id : NP_778211.1

name	Bcor (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281843 GeneID:71458 MGI:1918708
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform b is encoded by transcript variant b; BCL-6 corepressor product : BCL-6 interacting corepressor isoform b protein_id : NP_778209.1

name	Bcor (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66792788 CCDS:CCDS30021.1 GeneID:71458 MGI:1918708
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant c; BCL-6 corepressor product : BCL-6 interacting corepressor isoform c protein_id : NP_778210.2

name	Bcor (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28144863 GeneID:71458 MGI:1918708
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform a is encoded by transcript variant a; BCL-6 corepressor product : BCL-6 interacting corepressor isoform a protein_id : NP_083786.1

name	2900008C10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270987 GeneID:72937 MGI:1920187
definition	codon_start : 1 product : hypothetical protein LOC72937 protein_id : XP_001477215.1

name	LOC100043946 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271045 GeneID:100043946
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481304.1

name	Atp6ap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21361250 CCDS:CCDS30023.1 GeneID:70495 MGI:1917745
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : ATPase, H+ transporting, lysosomal interacting protein 1; ATPase, H+ transporting, lysosomal interacting protein 2 product : ATPase, H+ transporting, lysosomal accessory protein 2 protein_id : NP_081715.1

name	EG245347 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999881 GeneID:245347 MGI:3644533
definition	codon_start : 1 product : hypothetical protein protein_id : XP_141624.3

name	1810030O07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424732 CCDS:CCDS30024.1 GeneID:69155 MGI:1916405
definition	codon_start : 1 note : Novel transcript product : hypothetical protein LOC69155 protein_id : NP_780350.1

name	Crsp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270977 GeneID:26896 MGI:1349442
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : isoform a is encoded by transcript variant 1; cofactor required for Sp1 transcriptional activation subunit 2 (150 kDa) product : cofactor required for Sp1 transcriptional activation, subunit 2 isoform a protein_id : NP_001041673.1

name	Crsp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270972 GeneID:26896 MGI:1349442
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : isoform b is encoded by transcript variant 2; cofactor required for Sp1 transcriptional activation subunit 2 (150 kDa) product : cofactor required for Sp1 transcriptional activation, subunit 2 isoform b protein_id : NP_036135.3

name	LOC633361 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:633361
definition	number : 2 pseudo : _no_value

name	LOC633361 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:633361
definition	number : 1 pseudo : _no_value

name	Rpl23a-ps (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628338
definition	number : 1 pseudo : _no_value

name	LOC385323 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385323
definition	number : 2 pseudo : _no_value

name	LOC385323 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385323
definition	number : 1 pseudo : _no_value

name	LOC668982 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:94407008 GeneID:668982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins product : similar to High mobility group box 1 pseudo : _no_value transcript_id : XR_002281.1

name	LOC100043945 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271043 GeneID:100043945
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to glyceraldehyde-3-phosphate dehydrogenase (phosphorylating)-like pseudo : _no_value transcript_id : XR_035068.1

name	LOC668986 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271046 GeneID:668986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 5 Proteins product : similar to Nol5a protein pseudo : _no_value transcript_id : XR_035069.1

clone name	MSMg01-136O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541B03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-381P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352F23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-490N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323P18
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-467D08.T7 (MSMg01no467_d08.b1)	MSMg01-467D08.TJ (MSMg01no467_d08.g1)
ACC	AG550973	AG550974
length	739	772
length of high quality (start - end)	243 (75 - 317)	174 (73 - 246)
definition	CHROMAT_FILE: MSMg01no467_d08.b1 PHD_FILE: MSMg01no467_d08.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:43:00 2005	CHROMAT_FILE: MSMg01no467_d08.g1 PHD_FILE: MSMg01no467_d08.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:43:00 2005
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(11,232,662 - 11,232,902)	(11,406,149 - 11,406,322)
sequence	CCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTTTCCAAACACCGCGGA ATTCATCTCTGCTTCCACAAAAGGCATTTATCACCCCGTGCCCAGGATGC AGACATCGCCCTCCTTCAGATCCTCCTGCTGAGAAAGAAGGCCTTGTCAG ACACATGAAACCAGCCCCTCTGGACATCTGGACAAGGCATAGCCCTCTGG CTGAGCACGAGGCTCCCCTGAACACTGTAGAAAGTCAAAGGAGGGCCCTT GTTCCCAGAGCCAAAGGGCCCGACTAAATGGTTGCAGCTGGGCACAGAGG GGGTGAGAGGGGTGATATTTTTTTCAGGCCCTCTTGGCTGGCTGCCTTAG GCATCTCTATAAGACAGCCTATAAAGCAAGTCTGCTTGCCGAAGAAGTTT CTAGAGCTGGCTGCTTTACGAAAGCCCGTTGGCTAATAGTTTAGAATGTT CGACCCATAACTGGTGGCGACTAAAATGTCCTTTGCCTTTCAAGTGCCCC ATCTTCTAGTGAAAGTTATCTTTTTCCTGTAGCTAGTCTTATTAATAAGT CTATATCTTGTATAATCATCATCCCCCTCCATATAACCACTCTACCATCC CCTGCCTGGTCCTTTACGCTTTCTCTCATATTCTTGCACAACCTTTTGTA TATTTTTTTTGCTATTTATGCCTTACTCCACAAACCCCCTATACTATCTC TTTCCCCCCATTTTATTTCTCTTATGATCCCCATCCTTT	CATGCAGTGTGTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXTCAGAAAATCTCCATGTGACAGCTGAGCAGGCACTCTCTT CCCTCCTTCTTCAGTATCACCCTGTCCTTTGTAAGACAAGGCTCTTGGAG AGGGGCGATTTAGTATGTGTGTTGGAATAGGATGAGGAGGACGGAGAGGA ATAGTCTTCTATGGAACACATCTTTCCTGATATGCCCCTCTGTAACTGTT TAGGTCTCCTGGTCCATGCCCATGCCCTCACCATGCATCCCATTGTCTCC CTCTCTGACTCTCTTCGTATTTTAAAGAACTCTGCTGGTACCTTCCATTG TTTTGTTTTCCTCCGCATACGTACCTCCCTGTACTCATAGCTCACGAAGG CCTGTGTTATGTTACAACCTCACCTTTTTGTTATCGTATCTTTGTCTTCT CACTTGCTTCCGTGTTTGGCTTTGTGACCCTTTTTCTATTATCCTTGTCT TCGTTTTTTTTCTTTCCTTTTTTTCTCTCCTTCCTTCCCTCCTTTTTTCT TTCCCTCTCTCCCCCCTCTTTTTTTACCCCTTTCTTTCCATTTTTTCCTC CCCTCTCTTTATATTTTTCATTTCCCCCACCCCCCCTTCCTCTGTCCCCT TCCTTTTCATCTTTCTTTCCTTTTCTCTTTATTTTCGCCCCTTCTTCTCC TCCCCCCCCTCTTTTTTTTTCTTACTCCATTCCTTTTCCTTACACCCTTT TACTCTTTTTCCTTTTTCCGCC
quality values	Open. Hide. 6 6 8 8 8 8 8 8 17 26 21 19 20 29 15 19 8 8 8 15 19 24 33 41 24 24 14 19 18 27 23 13 13 6 7 7 9 9 7 13 8 8 8 10 10 8 15 11 21 21 30 31 31 31 33 33 33 29 29 8 6 6 6 7 7 8 9 8 8 9 8 8 8 11 15 19 34 36 37 31 31 31 36 36 50 59 57 57 57 57 53 53 47 47 42 42 48 43 43 37 30 30 43 43 54 68 68 68 68 68 68 68 68 46 42 26 18 12 12 19 27 42 48 57 57 57 59 68 68 57 57 57 57 57 57 57 57 59 57 57 68 68 68 68 68 68 68 68 68 57 68 68 68 68 51 50 50 50 41 41 50 47 44 44 43 43 57 57 59 59 59 54 54 57 57 57 57 57 68 68 57 57 52 52 52 52 57 57 50 50 37 37 41 59 59 59 59 59 52 52 52 52 57 54 57 57 57 52 52 52 57 57 59 57 59 59 59 57 52 52 47 57 57 68 57 57 43 43 31 35 43 43 50 43 57 43 44 44 57 59 59 59 59 48 48 48 48 32 34 35 31 31 42 37 44 57 46 43 43 43 44 57 57 57 59 59 54 54 47 59 43 47 54 59 46 43 43 59 42 41 41 46 39 42 43 48 48 48 42 39 39 37 43 43 43 37 37 28 32 28 37 37 39 59 39 43 43 37 37 39 30 23 12 11 10 8 8 8 8 8 19 14 12 12 15 16 21 28 32 43 43 48 48 43 43 40 40 43 47 47 35 35 35 40 40 57 43 40 30 28 28 28 31 32 47 25 30 18 18 12 19 11 11 15 21 27 28 36 24 19 12 15 18 24 36 42 39 36 37 37 43 43 44 44 47 59 59 44 42 37 28 28 18 18 15 19 19 36 38 38 44 35 32 32 30 32 36 30 24 22 22 32 36 37 57 32 26 12 11 11 11 23 24 39 39 26 28 14 15 21 22 22 28 40 37 37 33 24 22 21 19 16 10 10 17 28 22 28 23 24 14 14 13 15 15 18 20 16 11 13 13 21 13 12 12 12 12 11 12 12 21 18 17 14 10 10 10 9 12 12 8 8 8 15 12 10 10 12 24 12 11 11 15 19 15 19 23 27 32 20 20 20 26 26 28 18 15 10 10 9 9 10 9 9 10 11 10 10 15 16 23 16 16 9 9 9 9 12 12 12 11 12 12 10 13 10 10 8 10 12 18 16 19 13 12 13 15 15 16 15 8 10 10 8 8 8 11 22 18 15 12 12 8 8 8 8 8 8 8 8 10 11 18 18 28 16 17 13 12 10 8 8 8 8 8 8 8 8 8 8 8 8 8 10 8 8 10 12 12 17 17 9 9 8 10 12 10 8 8 8 8 8 6 8 8 12 8 8 8 10 15 15 12 11 11 11 10 10 10 10 10 14 10 10 8 8 8 10 8 8 8 11 8 9 10 8 8 10 8 8 8 10 12 12 12 12 12 11 13 9 9 8 8 8 10 10 8 9 8 8 10 13 8 8 8 8 8 8 8 8 8 8 8 10 8 10 10 8 8 6 6 8 8 8 8 8 8 10 13 10 8 8 8 10 10 17 22 17 11 10 11 8 9 8 10 10 13 10 8 8 8 8 6 6 6 6 8 8 10 10 8 8 8 8 8 8 8 10 8	Open. Hide. 8 8 8 8 8 8 9 13 9 9 9 10 10 12 19 37 43 43 43 39 39 41 37 37 44 44 39 25 25 9 6 6 6 8 6 6 6 8 8 9 11 17 17 16 15 12 14 14 14 27 23 50 42 41 25 27 11 7 7 7 8 6 6 6 6 6 6 15 15 20 15 24 18 21 28 30 48 36 36 36 38 38 38 57 57 57 57 57 59 57 57 57 48 48 53 57 68 68 68 68 68 68 68 68 68 68 68 68 57 42 32 24 24 24 23 43 43 30 30 30 43 44 59 59 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 54 57 57 57 57 57 57 46 50 50 50 50 50 50 50 35 39 44 57 57 57 57 48 48 48 57 57 57 57 57 57 50 50 50 50 50 50 57 57 57 57 68 57 50 47 47 57 48 50 47 41 47 42 42 41 48 59 43 47 47 48 48 46 46 43 43 43 43 43 57 48 48 42 48 47 57 57 48 48 34 34 34 36 36 36 43 43 43 43 46 46 41 47 32 24 15 12 10 9 9 9 9 9 9 12 18 19 28 41 41 59 59 37 34 28 25 25 25 36 37 43 43 40 43 28 26 11 10 10 13 10 10 12 24 24 15 19 12 19 19 40 37 39 35 21 19 8 8 8 8 9 18 30 34 48 43 47 39 24 16 10 8 8 6 6 6 7 6 6 6 6 6 8 8 7 8 11 22 12 14 17 11 9 9 9 10 10 12 10 8 8 8 6 9 22 22 27 13 14 14 26 24 15 10 8 8 8 8 8 13 23 12 9 8 8 8 10 13 8 17 17 25 25 23 25 25 28 34 39 43 28 26 13 13 13 18 13 8 8 8 8 8 8 10 8 8 8 8 8 8 12 15 15 22 12 10 9 8 8 8 15 13 11 11 11 11 11 10 10 10 10 10 12 12 11 11 11 11 11 11 11 11 11 12 11 11 11 11 13 10 8 10 8 10 9 18 18 26 21 17 10 9 9 9 10 9 9 9 8 10 8 8 8 8 12 12 21 15 15 8 8 8 8 8 8 9 11 11 11 12 11 11 9 14 12 12 10 10 8 8 8 8 8 10 12 10 8 8 6 6 8 8 8 8 10 10 22 16 15 12 10 9 9 9 8 10 8 8 8 8 10 15 16 10 10 9 9 12 10 10 10 8 8 8 8 8 8 9 12 10 10 8 8 8 11 15 19 20 15 9 11 11 13 11 9 8 19 14 12 8 8 8 12 8 8 8 10 18 21 28 22 23 18 24 18 18 11 11 11 12 13 10 10 10 10 12 11 12 13 8 8 8 8 15 11 22 15 27 15 14 14 13 10 10 8 8 8 8 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 10 12 15 14 11 11 15 13 15 10 10 10 15 15 13 12 9 9 8 8 6 6 8 13 16 19 13 10 10 10 12 12 12 10 8 7 7 10 10 10 8 9 10 10 13 9 9 9 10 8 8 6 6 10 10 10 10 8 6 6 17 12 13 8 8 8 8 19 11 12 9 8 10 8 8 8 8 8 8 8 8 10 15 15 21 21 16 13 13 15 15 19 9 9 8 8 8 9 11 13 8 8 11 16 12 13 12 13 9 8 8 8 8 12 15 15 10 10 8 8 8 8 11 8 8 13 16 15 12 11 10 10 10 13 15 16 13 12 10 10 10 12 10 10 9 11 9 9 9 9

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no467_d08.b1 MSMg01no467_d08.b1 CHROMAT_FILE:
MSMg01no467_d08.b1 PHD_FILE: MSMg01no467_d08.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 19:43:00 2005
         (243 letters)



>mm_chrX_11232462_11233104
          Length = 643

 Score =  466 bits (241), Expect = e-136
 Identities = 241/241 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   catttatcaccccgtgcccaggatgcagacatcgccctccttcagatcctcctgctgaga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 catttatcaccccgtgcccaggatgcagacatcgccctccttcagatcctcctgctgaga 260

                                                                       
Query: 61  aagaaggccttgtcagacacatgaaaccagcccctctggacatctggacaaggcatagcc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 aagaaggccttgtcagacacatgaaaccagcccctctggacatctggacaaggcatagcc 320

                                                                       
Query: 121 ctctggctgagcacgaggctcccctgaacactgtagaaagtcaaaggagggcccttgttc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 ctctggctgagcacgaggctcccctgaacactgtagaaagtcaaaggagggcccttgttc 380

                                                                       
Query: 181 ccagagccaaagggcccgactaaatggttgcagctgggcacagagggggtgagaggggtg 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 ccagagccaaagggcccgactaaatggttgcagctgggcacagagggggtgagaggggtg 440

            
Query: 241 a 241
           |
Sbjct: 441 a 441


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 14
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 243
Length of database: 643
Length adjustment: 9
Effective length of query: 234
Effective length of database: 634
Effective search space:   148356
Effective search space used:   148356
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

Query= MSMg01no467_d08.g1 MSMg01no467_d08.g1 CHROMAT_FILE:
MSMg01no467_d08.g1 PHD_FILE: MSMg01no467_d08.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 19:43:00 2005
         (174 letters)



>mm_chrX_11405949_11406522
          Length = 574

 Score =  337 bits (174), Expect = 3e-97
 Identities = 174/174 (100%)
 Strand = Plus / Minus

                                                                       
Query: 1   catgtgacagctgagcaggcactctcttccctccttcttcagtatcaccctgtcctttgt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 374 catgtgacagctgagcaggcactctcttccctccttcttcagtatcaccctgtcctttgt 315

                                                                       
Query: 61  aagacaaggctcttggagaggggcgatttagtatgtgtgttggaataggatgaggaggac 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 314 aagacaaggctcttggagaggggcgatttagtatgtgtgttggaataggatgaggaggac 255

                                                                 
Query: 121 ggagaggaatagtcttctatggaacacatctttcctgatatgcccctctgtaac 174
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 254 ggagaggaatagtcttctatggaacacatctttcctgatatgcccctctgtaac 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 8
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 174
Length of database: 574
Length adjustment: 8
Effective length of query: 166
Effective length of database: 566
Effective search space:    93956
Effective search space used:    93956
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information