MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-523P16
Chromosome	X (Build37)
Map Location	146,638,824 - 146,639,253
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC666888, LOC100039598, LOC100039890, LOC100039612, EG666923, EG624378, LOC100039934, LOC100039629, LOC382243, EG666961, EG666968, OTTMUSG00000018988, LOC100039651, EG624568, LOC382244, LOC100039669, EG666982, EG624631
Downstream gene	EG546387, LOC333588, Tmem29, LOC100040101, Alas2, Apex2, Pfkfb1, Tro, LOC100039716, Maged2, Itih5l, LOC667021, Gnl3l, Fgd1, Tsr2, LOC100040221, EG667027, Wnk3
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC666888 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100039598 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100039890 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 15 ESTs, 9 Proteins

name	LOC100039612 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	EG666923 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666923 MGI:3645202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG624378 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624378 MGI:3644585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100039934 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 16 ESTs, 6 Proteins

name	LOC100039629 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC382243 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666961 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666961 MGI:3644995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG666968 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666968 MGI:3648805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	OTTMUSG00000018988 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434869 MGI:3710639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 16 ESTs, 4 Proteins

name	LOC100039651 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG624568 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624568 MGI:3643049
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC382244 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 16 ESTs, 8 Proteins

name	LOC100039669 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG666982 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666982 MGI:3644367
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG624631 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624631 MGI:3647290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG546387 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546387 MGI:3644989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 130 ESTs, 5 Proteins

name	LOC333588 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:333588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Tmem29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382245 MGI:1923420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs, 1 Protein

name	LOC100040101 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Alas2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11656 MGI:87990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apex2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77622 MGI:1924872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfkfb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18639 MGI:107816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tro (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56191 MGI:1928994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100039716 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins pseudo : _no_value

name	Maged2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80884 MGI:1933391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itih5l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:634882 MGI:2685232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 21 Proteins pseudo : _no_value

name	LOC667021 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667021
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	Gnl3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237107 MGI:2448557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14163 MGI:104566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69499 MGI:1916749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040221 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG667027 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667027 MGI:3648636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Wnk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:279561 MGI:2652875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 29 ESTs, 5 Proteins

name	LOC100039890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272457 GeneID:100039890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 15 ESTs, 5 Proteins product : similar to ovary testis transcribed, transcript variant 1 transcript_id : XM_001473712.1

name	LOC100039890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272459 GeneID:100039890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs, 4 Proteins product : similar to ovary testis transcribed, transcript variant 2 transcript_id : XM_001473728.1

name	LOC100039890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272461 GeneID:100039890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 15 ESTs, 1 Protein product : similar to ovary testis transcribed, transcript variant 3 transcript_id : XM_001473747.1

name	LOC100039934 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272465 GeneID:100039934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 16 ESTs, 2 Proteins product : similar to Ott protein, transcript variant 1 transcript_id : XM_001473791.1

name	LOC100039934 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272467 GeneID:100039934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 1 Protein product : similar to Ott protein, transcript variant 2 transcript_id : XM_001473809.1

name	LOC100039934 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272469 GeneID:100039934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs, 4 Proteins product : similar to Ott protein, transcript variant 3 transcript_id : XM_001473830.1

name	LOC382243 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:130507580 GeneID:382243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ovary testis transcribed like transcript_id : NM_001037716.2

name	OTTMUSG00000018988 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408373 GeneID:434869 MGI:3710639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 16 ESTs, 2 Proteins product : predicted gene, OTTMUSG00000018988, transcript variant 1 transcript_id : XM_486794.3

name	OTTMUSG00000018988 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408374 GeneID:434869 MGI:3710639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 2 Proteins product : predicted gene, OTTMUSG00000018988, transcript variant 3 transcript_id : XM_897991.2

name	LOC382244 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408376 GeneID:382244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 16 ESTs, 4 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 3 transcript_id : XM_356360.4

name	LOC382244 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272473 GeneID:382244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 1 Protein product : novel protein similar to ovary testis transcribed (Ott), transcript variant 1 transcript_id : XM_001473979.1

name	LOC382244 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272475 GeneID:382244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 4 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 2 transcript_id : XM_001473992.1

name	EG624631 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272436 GeneID:624631 MGI:3647290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG624631 transcript_id : XM_889176.3

name	LOC333588 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272484 GeneID:333588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical LOC333588 transcript_id : XM_001474045.1

name	Tmem29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408378 GeneID:382245 MGI:1923420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 34 ESTs, 1 Protein product : transmembrane protein 29, transcript variant 1 transcript_id : XM_356361.4

name	Tmem29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408377 GeneID:382245 MGI:1923420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs, 1 Protein product : transmembrane protein 29, transcript variant 2 transcript_id : XM_898013.2

name	LOC100040101 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272487 GeneID:100040101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100040101 transcript_id : XM_001474106.1

name	Alas2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130319 GeneID:11656 MGI:87990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aminolevulinic acid synthase 2, erythroid transcript_id : NM_009653.2

name	Apex2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21541817 GeneID:77622 MGI:1924872
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apurinic/apyrimidinic endonuclease 2 transcript_id : NM_029943.1

name	Pfkfb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361607 GeneID:18639 MGI:107816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 6-phosphofructo-2-kinase/fructose-2, 6-biphosphatase 1 transcript_id : NM_008824.2

name	Tro (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110618257 GeneID:56191 MGI:1928994
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trophinin transcript_id : NM_019548.3

name	Tro (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110618254 GeneID:56191 MGI:1928994
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trophinin transcript_id : NM_001002272.2

name	Maged2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507637 GeneID:80884 MGI:1933391
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family D, 2 transcript_id : NM_030700.1

name	Gnl3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674223 GeneID:237107 MGI:2448557
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein-like 3 (nucleolar)-like transcript_id : NM_198110.1

name	Fgd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131060 GeneID:14163 MGI:104566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FYVE, RhoGEF and PH domain containing 1 transcript_id : NM_008001.3

name	Tsr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352950 GeneID:69499 MGI:1916749
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TSR2, 20S rRNA accumulation, homolog (S. cerevisiae) transcript_id : NM_175146.3

name	Wnk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408422 GeneID:279561 MGI:2652875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 29 ESTs, 5 Proteins product : WNK lysine deficient protein kinase 3, transcript variant 3 transcript_id : XM_909586.2

name	LOC100039890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272458 GeneID:100039890
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001473762.1

name	LOC100039890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272462 GeneID:100039890
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_001473797.1

name	LOC100039890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272460 GeneID:100039890
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001473778.1

name	LOC100039934 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272466 GeneID:100039934
definition	codon_start : 1 product : similar to Ott protein isoform 1 protein_id : XP_001473841.1

name	LOC100039934 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272468 GeneID:100039934
definition	codon_start : 1 product : similar to Ott protein isoform 2 protein_id : XP_001473859.1

name	LOC100039934 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272470 GeneID:100039934
definition	codon_start : 1 product : similar to Ott protein isoform 3 protein_id : XP_001473880.1

name	LOC382243 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:130507581 GeneID:382243
definition	codon_start : 1 product : ovary testis transcribed like protein_id : NP_001032805.2

name	OTTMUSG00000018988 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772479 GeneID:434869 MGI:3710639
definition	codon_start : 1 product : hypothetical protein LOC434869 isoform 1 protein_id : XP_486794.1

name	OTTMUSG00000018988 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408375 GeneID:434869 MGI:3710639
definition	codon_start : 1 product : hypothetical protein LOC434869 isoform 3 protein_id : XP_903084.2

name	LOC382244 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:38086787 GeneID:382244
definition	codon_start : 1 product : hypothetical protein LOC382244 isoform 3 protein_id : XP_356360.1

name	LOC382244 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272476 GeneID:382244
definition	codon_start : 1 product : hypothetical protein LOC382244 isoform 2 protein_id : XP_001474042.1

name	LOC382244 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272474 GeneID:382244
definition	codon_start : 1 product : hypothetical protein LOC382244 isoform 1 protein_id : XP_001474029.1

name	EG624631 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272437 GeneID:624631 MGI:3647290
definition	codon_start : 1 product : similar to AU022751 protein protein_id : XP_894269.3

name	LOC333588 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272485 GeneID:333588
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474095.1

name	Tmem29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004391 GeneID:382245 MGI:1923420
definition	codon_start : 1 product : similar to chromosome X open reading frame 44, isoform 1 protein_id : XP_356361.3

name	Tmem29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004389 GeneID:382245 MGI:1923420
definition	codon_start : 1 product : similar to chromosome X open reading frame 44, isoform 2 protein_id : XP_903106.1

name	LOC100040101 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272488 GeneID:100040101
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474156.1

name	Alas2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859502 GeneID:11656 MGI:87990
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0003870 - 5-aminolevulinate synthase activity [Evidence IMP] [Evidence ISS] [Evidence IEA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0030218 - erythrocyte differentiation [Evidence IMP]; GO:0006783 - heme biosynthesis [Evidence IEA] [Evidence IMP]; GO:0006879 - iron ion homeostasis [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : erythroid-specific ALAS; 5-aminolevulinate synthase product : aminolevulinic acid synthase 2, erythroid protein_id : NP_033783.1

name	Apex2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21541818 CCDS:CCDS30463.1 GeneID:77622 MGI:1924872
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003906 - DNA-(apurinic or apyrimidinic site) lyase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : AP endonuclease 2 protein_id : NP_084219.1

name	Pfkfb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74315988 CCDS:CCDS30464.1 GeneID:18639 MGI:107816
definition	GO_component : GO:0043540 - 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 complex [Evidence ISS] GO_function : GO:0003873 - 6-phosphofructo-2-kinase activity [Evidence ISS] [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004331 - fructose-2,6-bisphosphate 2-phosphatase activity [Evidence ISS] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006003 - fructose 2,6-bisphosphate metabolism [Evidence ISS] [Evidence IEA]; GO:0006094 - gluconeogenesis [Evidence ISS]; GO:0006096 - glycolysis [Evidence ISS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : PFK-2/FBPase-2 gene A; 6-phosphofructo-2-kinase/fructose-2,6-biphosphata se 1 product : 6-phosphofructo-2-kinase/fructose-2, 6-biphosphatase 1 protein_id : NP_032850.1

name	Tro (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50593514 GeneID:56191 MGI:1928994
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence ISS]; GO:0030308 - negative regulation of cell growth [Evidence IDA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; necdin and trophinin like; trophinin-2; magphinin-alpha; magphinin-gamma; magphinin-beta 2; melanoma antigen, family D, 3-like product : trophinin isoform 3 protein_id : NP_062421.2

name	Tro (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50593518 CCDS:CCDS30465.1 GeneID:56191 MGI:1928994
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence ISS]; GO:0030308 - negative regulation of cell growth [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; necdin and trophinin like; trophinin-2; magphinin-alpha; magphinin-gamma; magphinin-beta 2; melanoma antigen, family D, 3-like product : trophinin isoform 1 protein_id : NP_001002272.1

name	Maged2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507638 CCDS:CCDS30466.1 GeneID:80884 MGI:1933391
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 function : unknown product : melanoma antigen family D, 2 protein_id : NP_109625.1

name	Gnl3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674224 GeneID:237107 MGI:2448557
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein-like 3 (nucleolar)-like protein_id : NP_932778.1

name	Fgd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982367 CCDS:CCDS30467.1 GeneID:14163 MGI:104566
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence IDA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : faciogenital dysplasia product : faciogenital dysplasia homolog protein_id : NP_032027.2

name	Tsr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424736 CCDS:CCDS30468.1 GeneID:69499 MGI:1916749
definition	codon_start : 1 product : TSR2, 20S rRNA accumulation, homolog protein_id : NP_780355.1

name	Wnk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408423 GeneID:279561 MGI:2652875
definition	codon_start : 1 note : overriding stop codons product : similar to Serine/threonine-protein kinase WNK3 (Protein kinase with no lysine 3) (Protein kinase, lysine-deficient 3) isoform 3 protein_id : XP_914679.2 transl_except : (pos:147671256..147671258,aa:OTHER)

name	LOC666888 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666888
definition	number : 1 pseudo : _no_value

name	LOC100039598 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039598
definition	number : 2 pseudo : _no_value

name	LOC100039598 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039598
definition	number : 1 pseudo : _no_value

name	LOC100039612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039612
definition	number : 1 pseudo : _no_value

name	LOC100039612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039612
definition	number : 2 pseudo : _no_value

name	LOC100039612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039612
definition	number : 3 pseudo : _no_value

name	LOC100039612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039612
definition	number : 4 pseudo : _no_value

name	EG666923 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666923
definition	number : 1 pseudo : _no_value

name	EG624378 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624378
definition	number : 2 pseudo : _no_value

name	EG624378 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624378
definition	number : 1 pseudo : _no_value

name	LOC100039629 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039629
definition	number : 2 pseudo : _no_value

name	LOC100039629 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039629
definition	number : 1 pseudo : _no_value

name	EG666961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666961
definition	number : 1 pseudo : _no_value

name	EG666968 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666968
definition	number : 3 pseudo : _no_value

name	EG666968 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666968
definition	number : 2 pseudo : _no_value

name	EG666968 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666968
definition	number : 1 pseudo : _no_value

name	LOC100039651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039651
definition	number : 1 pseudo : _no_value

name	LOC100039651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039651
definition	number : 2 pseudo : _no_value

name	LOC100039651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039651
definition	number : 3 pseudo : _no_value

name	LOC100039651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039651
definition	number : 4 pseudo : _no_value

name	EG624568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624568
definition	number : 2 pseudo : _no_value

name	EG624568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624568
definition	number : 1 pseudo : _no_value

name	LOC100039669 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039669
definition	number : 1 pseudo : _no_value

name	LOC100039669 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039669
definition	number : 2 pseudo : _no_value

name	LOC100039669 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039669
definition	number : 3 pseudo : _no_value

name	EG666982 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666982
definition	number : 1 pseudo : _no_value

name	LOC667021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667021
definition	number : 6 pseudo : _no_value

name	LOC667021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667021
definition	number : 5 pseudo : _no_value

name	LOC667021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667021
definition	number : 4 pseudo : _no_value

name	LOC667021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667021
definition	number : 3 pseudo : _no_value

name	LOC667021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667021
definition	number : 2 pseudo : _no_value

name	LOC667021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667021
definition	number : 1 pseudo : _no_value

name	LOC100040221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040221
definition	number : 1 pseudo : _no_value

name	EG667027 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667027
definition	number : 1 pseudo : _no_value

name	EG546387 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149272483 GeneID:546387 MGI:3644989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 130 ESTs, 5 Proteins product : predicted gene, EG546387 transcript_id : XR_001595.2

name	LOC100039716 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272438 GeneID:100039716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : similar to ribosomal protein L13 pseudo : _no_value transcript_id : XR_031183.1

name	Itih5l (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149272489 GeneID:634882 MGI:2685232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 21 Proteins product : inter-alpha (globulin) inhibitor H5-like pseudo : _no_value transcript_id : XR_031663.1

clone name	MSMg01-541N09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-535B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-469I22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-523P16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-078P12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-083G04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-496H16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-059C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509H16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-444B11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-387I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118M08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-523P16.T7 (MSMg01no523_p16.b1)	MSMg01-523P16.TJ (MSMg01no523_p16.g1)
ACC	AG594166	AG594167
length	755	764
length of high quality (start - end)	711 (45 - 755)	682 (77 - 758)
definition	CHROMAT_FILE: MSMg01no523_p16.b1 PHD_FILE: MSMg01no523_p16.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:58:05 2005	CHROMAT_FILE: MSMg01no523_p16.g1 PHD_FILE: MSMg01no523_p16.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:58:05 2005
singlet/doublet	singlet	---
BLAST hit	plural	no hit data
sequence	TCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGA ATTCATCTTCGAGTGTTTTCAAATTCATAATTGTCCAGAGCAATGATTAG TGTAAAAAATAATAAGAGAAATTGAACTATTTCCATGTGTGCATTATGGG AACCAAGCCAAACAGTTGTTATTTTACATACTTCAATTGCCAGAGCAATA AGCACGTTGGTTTCTTTCCAGGTTTACTCTCCAATAGCAGTAAGGAGTCT TTCTTTTCTTTTTTTTTTATTTTTTTCAATTTTTTATTTTATTTTATATA TTAGGTATTTTATTCATTTACATTTCCAATGCTATCACAAAAGTCCCCCA TACCCTCCCCCCCACTCCCCTACCCACCCACTCCTACTTCTTGACACTAG TGTTCCCCTGAACTGAGGCATATAAAGTTTGCAAGACCAATGGGCCTCTC TTTCCACTAATGGCCAACTAGGCCATCTTCTGATACATATGCAGTACCTG GGGNGGGGGGTTGTTCCACCTATAGGGTTGCAGATCCCTTTAGCTCCTTG GGTACTTTCTCTAGCTCCTCCATTGGGGGCCCTGTGATCAATCCAGTAGC TGACTGTGAGCATCCATTTCTGTATTTGCTAGGCCCTGGCATAGCCTCAT AAGAGACAGCTATATCAGGATCGTTTCAGCAAAATCTTGCTAGTGTGTGC AATGGTGTCAGAGTTTGGAGGCTGATTATGGGATGGATCCCCGGGTATGG CAGTC	CGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXAATAACTCACTTAAAGAGATACAG GAGAACACTGCTAAAGAGTTACAAGTCCTTAAAGAAAAACAGGAAAACAC AACCAAACAGGTAGAAGTCCTTATAGAAAAACAGGAAAACACATCCAAAC AGGTGATGGAAATGAACAAAACCATACTAGACCTAAAAAGGGAAGTAGAC ACAATAAAGAAAACCCAAAGTGAGGCAACGATGGAGATAGAAAACCTAGG AAAGAAATCGGGAACCATAGATGCCAGCATCAGCAACAGAATACAAGAGA TGGAAGAGAGAATCTCAGGTGCAGAAGACTCCATAGAGAACATCAGCACA ACAATCAAAGAAAATGGAAAATGCAGAAAGATCCTAACTAAAAACATCCA GGAAATCCAGGACACAATGAGAAGACCAAACCTACGGATAATAGGAGTGG ATGAGAATGAAGATTTTCAACTCAAAGGACCAGCAAACATCTTCAACAAA ATTATTGAAGAAAACTTCCCAAATCTAAAGAAAGAGATGCCCATGAACAT ACAAGAAGCCTACAGAACTCCAAATAGACTGGACCAGAAAAGAAATTCCT CCCGACACATACTAATCAGAACATCAAATGCACTAAATAAAGATAAAATA CTAAAAGCAGTAAGGGAAAAAGGTCAAGTAACATATAAAGGCAAGCCTAT CAGAATTACACCAG
quality values	Open. Hide. 8 10 8 8 8 9 10 15 34 23 13 12 12 12 14 28 19 20 20 20 22 28 41 34 23 17 17 17 17 25 25 37 25 25 25 39 39 39 43 19 16 16 14 14 25 30 37 37 23 19 18 30 32 30 30 31 31 39 50 50 47 50 37 37 37 37 37 33 31 27 25 22 30 30 30 30 31 31 31 33 33 36 53 35 35 28 24 24 35 44 53 53 53 36 36 33 33 33 30 37 37 37 37 37 39 39 37 35 32 37 37 37 37 37 37 59 59 44 31 28 24 28 28 35 44 53 57 53 53 53 53 47 42 42 42 42 47 57 68 68 68 68 68 68 68 68 68 68 57 53 48 50 50 50 50 50 51 50 50 50 50 68 68 50 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 53 50 50 50 53 53 59 59 59 59 59 57 57 53 53 50 47 53 44 59 59 43 36 36 36 39 39 39 39 44 44 44 47 47 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 59 57 57 54 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 59 59 59 59 50 50 50 50 47 47 59 27 17 3 0 3 17 19 59 59 47 47 47 48 48 48 59 57 57 57 57 57 57 57 59 59 59 59 59 59 59 59 59 59 48 57 57 57 57 68 57 57 59 59 59 59 59 59 59 59 59 59 57 57 54 57 57 57 59 68 68 59 59 59 59 59 59 59 59 57 57 57 57 57 57 59 68 59 59 59 59 59 59 59 54 48 48 50 50 47 54 54 54 59 59 54 48 59 48 54 54 34 34 48 43 43 43 42 46 46 46 48 59 57 59 48 48 48 59 59 59 59 48 48 48 46 40 42 41 39 39 39 31 31 31 31 39 43 44 41 46 39 43 39 47 47 39 39 43 43 39 39 39 43 33 34 30 37 37 43 59 59 47 46 41 34 34 33 28 29 37 37 39 41 47 41 34 34 25 25 32 34 31 36 39 39 39 39 46 40 40 48 48 39 39 35 35 35 37 37 41 34 34 32 29 29 32 37 39 37 28 26 14 14 14 30 30 36 36 37 31 31 39 30 37 30 25 25 33 32 37 30 36 32 35 31 36 35 37 31 31 31 30 22 24 30 31 36 39 39 37 39 30 34 25 20	Open. Hide. 6 6 6 10 10 8 8 8 8 14 21 32 29 37 32 31 31 37 32 37 39 39 39 39 37 31 31 37 37 33 28 21 13 10 11 11 18 16 27 18 21 21 30 27 37 37 32 32 35 37 37 37 37 37 39 50 42 41 37 23 11 6 6 6 6 15 23 43 59 59 30 28 28 28 36 36 38 38 50 57 53 53 50 47 47 50 57 59 59 59 59 59 57 57 57 57 54 50 47 51 51 68 53 51 50 50 68 50 50 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 59 59 68 68 68 57 68 68 68 68 57 57 54 57 57 57 57 57 68 68 68 68 68 57 68 57 57 57 57 57 68 57 68 57 57 57 57 57 57 57 57 57 57 57 59 59 59 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 59 59 68 68 57 57 57 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 68 68 68 68 68 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 45 62 62 62 62 62 62 62 62 68 68 62 62 62 62 52 43 62 62 68 68 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 68 68 62 62 62 62 62 62 62 62 68 68 68 68 62 62 62 62 62 62 62 62 57 57 57 68 57 57 59 59 57 57 57 57 57 57 57 57 57 57 57 59 68 68 68 57 57 57 57 57 57 59 59 57 57 59 59 57 57 57 57 57 68 59 59 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 54 57 57 57 57 52 52 57 57 52 52 52 59 57 57 57 57 57 57 47 57 57 57 57 57 57 57 57 57 57 57 47 47 47 57 57 57 57 57 57 68 68 57 57 57 59 54 59 59 57 57 57 57 57 57 48 48 48 48 54 57 57 57 54 59 59 59 59 68 68 68 59 57 57 46 46 43 48 48 48 48 57 50 50 48 48 48 47 43 43 43 43 44 44 48 43 48 48 43 47 46 46 41 41 41 41 39 39 32 28 28 39 43 41 41 46 46 41 37 37 32 27 27 32 35 59 43 39 36 41 30 30 30 33 33 33 43 48 43 43 43 43 43 39 39 43 47 48 59 57 57 48 48 43 43 43 43 39 39 39 41 47 39 41 32 34 34 32 25 25 34 34 40 48 59 59 59 59 47 41 41 41 32 32 39 41 41 41 47 46 46 48 59 59 47 46 46 41 41 39 38 37 37 37 41 44 43 39 31 31 25 30 30 29 29 41 41 32 32 41 41 41 41 41 47 41 43 31 28 30 25 31 37 31 36 41 43 34 34 28 15 17 18 18 20 30 23 23 16 20 21 18

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no523_p16.b1 MSMg01no523_p16.b1 CHROMAT_FILE:
MSMg01no523_p16.b1 PHD_FILE: MSMg01no523_p16.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 20:58:05 2005
         (711 letters)



>mm_chrX_146638824_146639933
          Length = 1110

 Score =  777 bits (402), Expect = 0.0
 Identities = 420/430 (97%), Gaps = 8/430 (1%)
 Strand = Plus / Minus

                                                                       
Query: 5   gaattcatcttcgagtgttttcaaattcataattgtccagagcaatgattagtgtaaaaa 64
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 430 gaattcatcttcgagtgtttccaaattcataattgtccagagcaatgattagtgtaaaaa 371

                                                                       
Query: 65  ataataagagaaattgaactatttccatgtgtgcattatgggaaccaagccaaacagttg 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 370 ataataagagaaattgaactatttccatgtgtgcattatgggaaccaagccaaacagttg 311

                                                                       
Query: 125 ttattttacatacttcaattgccagagcaataagcacgttggtttctttccaggtttact 184
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 310 ttattttacatacttcaattgccagagcaataagcacgttggtttctttccaggtttact 251

                                                                       
Query: 185 ctccaatagcagtaaggagtctttcttttctttttttttt-------attttttt-caat 236
           ||||||||||||||||||||||||||||||||||||||||       |||||||| ||||
Sbjct: 250 ctccaatagcagtaaggagtctttcttttcttttttttttttttttcattttttttcaat 191

                                                                       
Query: 237 tttttattttattttatatattaggtattttattcatttacatttccaatgctatcacaa 296
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 190 tttttattttattttatatattaggtattttattcatttacatttccaatgctatcgcaa 131

                                                                       
Query: 297 aagtcccccataccctcccccccactcccctacccacccactcctacttcttgacactag 356
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 130 aagtcccccataccctcccccccactcccctacccacccactcctacttcttgacactag 71

                                                                       
Query: 357 tgttcccctgaactgaggcatataaagtttgcaagaccaatgggcctctctttccactaa 416
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 70  tgttcccctgaactgaggcatataaagtttgcaagaccaatgggcctctctttccactaa 11

                     
Query: 417 tggccaacta 426
           ||||||||||
Sbjct: 10  tggccaacta 1


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 22
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 711
Length of database: 1110
Length adjustment: 10
Effective length of query: 701
Effective length of database: 1100
Effective search space:   771100
Effective search space used:   771100
X1: 9 (17.8 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 9 (18.3 bits)
S2: 9 (18.1 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information