MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-095K18
Chromosome	3 (Build37)
Map Location	93,763,551 - 93,764,688
singlet/doublet	singlet
Overlap gene	Tdpoz5
Upstream gene	2310001H18Rik, Lce3f, Crct1, Lce1m, EG229571, Crnn, EG229574, EG668300, LOC668304, Flg, LOC100042701, Hrnr, Rptn, EG383891, Tchh, Tchhl1, S100a11, S100a10, EG433623, Tdpoz2, Tdpoz1, LOC668325, LOC545550, EG436563, Tdpoz4, Tdpoz3, EG668341, LOC668344, EG668346
Downstream gene	EG668353, EG668356, LOC668359, LOC100042761, LOC433624, LOC668367, LOC433625, LOC100043188, EG383977, EG245290, EG668385, EG212727, Them4, Them5, Gm659, Rorc, Lingo4, Tdrkh, Oaz3, Mrpl9, LOC668403, 2310007A19Rik, Tnrc4, Snx27, LOC100043228, EG668409, Tuft1, LOC100042793, BC021767, Selenbp2, LOC100042801, Cgn, Pogz, Psmb4, Selenbp1, Rfx5
Link	Open Mouse BAC browser

Click to get alignment info.

name	2310001H18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69514 MGI:1916764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Lce3f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69520 MGI:1916770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crct1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74175 MGI:1921425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lce1m (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66203 MGI:1913453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG229571 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229571 MGI:3645677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crnn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381457 MGI:2685861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG229574 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229574 MGI:3645678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668300 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668300 MGI:3648599
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1891 ESTs, 8 Proteins

name	LOC668304 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Flg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14246 MGI:95553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 2 Proteins

name	LOC100042701 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Hrnr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68723 MGI:3046938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs

name	Rptn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20129 MGI:1099055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG383891 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383891 MGI:3643701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	Tchh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99681 MGI:2177944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 48 ESTs, 2 Proteins

name	Tchhl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71325 MGI:1918575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	S100a11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20195 MGI:1338798
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	S100a10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20194 MGI:1339468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433623 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433623 MGI:3645005
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 14 Proteins

name	Tdpoz2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399673 MGI:3027902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tdpoz1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207213 MGI:2449436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668325 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 Proteins pseudo : _no_value

name	LOC545550 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 21 Proteins

name	EG436563 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436563 MGI:3645792
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 Proteins

name	Tdpoz4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399675 MGI:3027904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tdpoz3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399674 MGI:3027903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668341 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668341 MGI:3648183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	LOC668344 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 20 Proteins

name	EG668346 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668346 MGI:3704095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 9 ESTs, 22 Proteins

name	Tdpoz5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399676 MGI:3027905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668353 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668353 MGI:3644976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 19 Proteins

name	EG668356 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668356 MGI:3644979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	LOC668359 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 9 ESTs, 22 Proteins

name	LOC100042761 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 18 Proteins pseudo : _no_value

name	LOC433624 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433624
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 20 Proteins

name	LOC668367 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668367
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 21 Proteins pseudo : _no_value

name	LOC433625 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 19 Proteins pseudo : _no_value

name	LOC100043188 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043188
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 21 Proteins

name	EG383977 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383977 MGI:3644284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	EG245290 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245290 MGI:3646925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 Proteins

name	EG668385 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668385 MGI:3643267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	EG212727 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212727 MGI:3643869
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	Them4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75778 MGI:1923028
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Them5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66198 MGI:1913448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm659 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271944 MGI:2685505
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins

name	Rorc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19885 MGI:104856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lingo4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320747 MGI:2444651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tdrkh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72634 MGI:1919884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oaz3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53814 MGI:1858170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78523 MGI:2137211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668403 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 6 Proteins pseudo : _no_value

name	2310007A19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66353 MGI:1913603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnrc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78784 MGI:1926034
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76742 MGI:1923992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043228 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 2 Proteins pseudo : _no_value

name	EG668409 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668409 MGI:3646595
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 596 ESTs, 5 Proteins pseudo : _no_value

name	Tuft1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22156 MGI:109572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042793 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	BC021767 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545551 MGI:3615512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 66 ESTs, 5 Proteins

name	Selenbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20342 MGI:104859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042801 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042801
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Cgn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70737 MGI:1927237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 103 ESTs, 5 Proteins

name	Pogz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229584 MGI:2442117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19172 MGI:1098257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Selenbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20341 MGI:96825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rfx5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53970 MGI:1858421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310001H18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251294 GeneID:69514 MGI:1916764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA 2310001H18 gene transcript_id : XM_001478585.1

name	Lce3f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66267724 GeneID:69520 MGI:1916770
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 3F transcript_id : NM_001018079.1

name	Crct1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801668 GeneID:74175 MGI:1921425
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich C-terminal 1 transcript_id : NM_028798.2

name	Lce1m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865967 GeneID:66203 MGI:1913453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 1M transcript_id : NM_025420.2

name	EG229571 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801996 GeneID:229571 MGI:3645677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG229571 transcript_id : NM_001034860.2

name	Crnn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487100 GeneID:381457 MGI:2685861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cornulin transcript_id : NM_001081200.1

name	EG229574 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370014 GeneID:229574 MGI:3645678
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG229574 transcript_id : NM_001013804.1

name	EG668300 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369747 GeneID:668300 MGI:3648599
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1891 ESTs, 8 Proteins product : predicted gene, EG668300 transcript_id : XM_001000750.1

name	LOC668304 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94369749 GeneID:668304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to filaggrin transcript_id : XM_001000758.1

name	Flg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251298 GeneID:14246 MGI:95553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 2 Proteins product : filaggrin transcript_id : XM_485270.5

name	Hrnr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369753 GeneID:68723 MGI:3046938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs product : hornerin transcript_id : XM_001000796.1

name	Rptn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112421059 GeneID:20129 MGI:1099055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : repetin transcript_id : NM_009100.2

name	EG383891 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251356 GeneID:383891 MGI:3643701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG383891 transcript_id : XM_357312.4

name	Tchh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251301 GeneID:99681 MGI:2177944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 48 ESTs, 2 Proteins product : trichohyalin transcript_id : XM_001000857.2

name	Tchhl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802435 GeneID:71325 MGI:1918575
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trichohyalin-like 1 transcript_id : NM_027762.2

name	S100a11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930755 GeneID:20195 MGI:1338798
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100 calcium binding protein A11 (calgizzarin) transcript_id : NM_016740.3

name	S100a10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930762 GeneID:20194 MGI:1339468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100 calcium binding protein A10 (calpactin) transcript_id : NM_009112.2

name	EG433623 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369758 GeneID:433623 MGI:3645005
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 14 Proteins product : predicted gene, EG433623 transcript_id : XM_485272.3

name	Tdpoz2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124126980 GeneID:399673 MGI:3027902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TD and POZ domain containing 2 transcript_id : NM_001007222.2

name	Tdpoz1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24233505 GeneID:207213 MGI:2449436
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TD and POZ domain containing 1 transcript_id : NM_148949.1

name	LOC545550 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251358 GeneID:545550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 21 Proteins product : similar to Tdpoz5 protein transcript_id : XM_001479894.1

name	EG436563 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82890378 GeneID:436563 MGI:3645792
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 Proteins product : predicted gene, EG436563 transcript_id : XM_489896.3

name	Tdpoz4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130492353 GeneID:399675 MGI:3027904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TD and POZ domain containing 4 transcript_id : NM_207272.2

name	Tdpoz3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402298 GeneID:399674 MGI:3027903
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TD and POZ domain containing 3 transcript_id : NM_207271.1

name	EG668341 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369760 GeneID:668341 MGI:3648183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG668341 transcript_id : XM_001001011.1

name	LOC668344 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251360 GeneID:668344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 20 Proteins product : similar to Tdpoz5 protein transcript_id : XM_001479907.1

name	EG668346 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369762 GeneID:668346 MGI:3704095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 9 ESTs, 22 Proteins product : predicted gene, EG668346 transcript_id : XM_001001033.1

name	Tdpoz5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402302 GeneID:399676 MGI:3027905
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TD and POZ domain containing 5 transcript_id : NM_207273.1

name	EG668353 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369764 GeneID:668353 MGI:3644976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 19 Proteins product : predicted gene, EG668353 transcript_id : XM_001001069.1

name	EG668356 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369766 GeneID:668356 MGI:3644979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG668356 transcript_id : XM_001001083.1

name	LOC668359 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94369768 GeneID:668359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 9 ESTs, 22 Proteins product : similar to TD and POZ domain containing 1 transcript_id : XM_001001094.1

name	LOC433624 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251368 GeneID:433624
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 20 Proteins product : similar to Tdpoz5 protein transcript_id : XM_001479931.1

name	LOC100043188 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251371 GeneID:100043188
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 21 Proteins product : similar to Tdpoz5 protein transcript_id : XM_001479934.1

name	EG383977 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82890390 GeneID:383977 MGI:3644284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG383977 transcript_id : XM_357358.3

name	EG245290 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38077895 GeneID:245290 MGI:3646925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 Proteins product : predicted gene, EG245290 transcript_id : XM_142982.3

name	EG212727 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51708306 GeneID:212727 MGI:3643869
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : predicted gene, EG212727 transcript_id : XM_143402.4

name	Them4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626049 GeneID:75778 MGI:1923028
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioesterase superfamily member 4 transcript_id : NM_029431.1

name	Them5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372271 GeneID:66198 MGI:1913448
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioesterase superfamily member 5 transcript_id : NM_025416.2

name	Gm659 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251306 GeneID:271944 MGI:2685505
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins product : gene model 659, (NCBI) transcript_id : XM_001001226.2

name	Rorc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755343 GeneID:19885 MGI:104856
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAR-related orphan receptor gamma transcript_id : NM_011281.1

name	Lingo4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343168 GeneID:320747 MGI:2444651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat and Ig domain containing 4 transcript_id : NM_177250.2

name	Tdrkh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625941 GeneID:72634 MGI:1919884
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tudor and KH domain containing protein transcript_id : NM_028307.1

name	Oaz3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8567381 GeneID:53814 MGI:1858170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ornithine decarboxylase antizyme 3 transcript_id : NM_016901.1

name	Mrpl9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130689 GeneID:78523 MGI:2137211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L9 transcript_id : NM_030116.2

name	2310007A19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115292447 GeneID:66353 MGI:1913603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310007A19 gene transcript_id : NM_025506.2

name	Tnrc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892434 GeneID:78784 MGI:1926034
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trinucleotide repeat containing 4 transcript_id : NM_172434.2

name	Snx27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126722909 GeneID:76742 MGI:1923992
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin family member 27 transcript_id : NM_029721.1

name	Snx27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723791 GeneID:76742 MGI:1923992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin family member 27 transcript_id : NM_001082484.1

name	Tuft1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130085 GeneID:22156 MGI:109572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tuftelin 1 transcript_id : NM_011656.2

name	LOC100042793 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251309 GeneID:100042793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100042793 transcript_id : XM_001478831.1

name	BC021767 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369775 GeneID:545551 MGI:3615512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 66 ESTs, 5 Proteins product : cDNA sequence BC021767 transcript_id : XM_619932.3

name	Selenbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130755 GeneID:20342 MGI:104859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : selenium binding protein 2 transcript_id : NM_019414.2

name	LOC100042801 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251311 GeneID:100042801
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to tuftelin transcript_id : XM_001478841.1

name	Cgn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251313 GeneID:70737 MGI:1927237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 103 ESTs, 5 Proteins product : cingulin transcript_id : XM_001001375.2

name	Pogz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142355637 GeneID:229584 MGI:2442117
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pogo transposable element with ZNF domain transcript_id : NM_172683.2

name	Psmb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803332 GeneID:19172 MGI:1098257
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, beta type 4 transcript_id : NM_008945.2

name	Selenbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130509 GeneID:20341 MGI:96825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : selenium binding protein 1 transcript_id : NM_009150.3

name	Rfx5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71037396 GeneID:53970 MGI:1858421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulatory factor X, 5 (influences HLA class II expression) transcript_id : NM_017395.2

name	2310001H18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251295 GeneID:69514 MGI:1916764
definition	codon_start : 1 product : hypothetical protein LOC69514 protein_id : XP_001478635.1

name	Lce3f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66267725 GeneID:69520 MGI:1916770
definition	codon_start : 1 note : late cornified envelope product : late cornified envelope protein protein_id : NP_001018089.1

name	Crct1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311957 CCDS:CCDS17578.1 GeneID:74175 MGI:1921425
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation product : cysteine-rich C-terminal 1 protein_id : NP_083074.1

name	Lce1m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536218 CCDS:CCDS17579.1 GeneID:66203 MGI:1913453
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : late cornified envelope 5A product : small proline rich-like 10 protein_id : NP_079696.1

name	EG229571 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702195 GeneID:229571 MGI:3645677
definition	codon_start : 1 product : hypothetical protein LOC229571 protein_id : NP_001030032.1

name	Crnn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487101 GeneID:381457 MGI:2685861
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : cornulin protein_id : NP_001074669.1

name	EG229574 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370015 GeneID:229574 MGI:3645678
definition	codon_start : 1 exception : unclassified translation discrepancy product : filaggrin 2 protein_id : NP_001013826.1

name	EG668300 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369748 GeneID:668300 MGI:3648599
definition	codon_start : 1 product : similar to Acidic ribosomal phosphoprotein P0 protein_id : XP_001000750.1

name	LOC668304 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94369750 GeneID:668304
definition	codon_start : 1 product : similar to filaggrin protein_id : XP_001000758.1

name	Flg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251299 GeneID:14246 MGI:95553
definition	codon_start : 1 product : filaggrin protein_id : XP_485270.5

name	Hrnr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369754 GeneID:68723 MGI:3046938
definition	codon_start : 1 product : hornerin protein_id : XP_001000796.1

name	Rptn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112421060 CCDS:CCDS17581.1 GeneID:20129 MGI:1099055
definition	GO_component : GO:0001533 - cornified envelope [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : repetin protein_id : NP_033126.2

name	EG383891 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38076713 GeneID:383891 MGI:3643701
definition	codon_start : 1 product : similar to ferritin light chain 2 protein_id : XP_357312.1

name	Tchh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251302 GeneID:99681 MGI:2177944
definition	codon_start : 1 product : trichohyalin protein_id : XP_001000857.2

name	Tchhl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313246 CCDS:CCDS17582.1 GeneID:71325 MGI:1918575
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : S100 calcium binding protein A17 product : trichohyalin-like 1 protein_id : NP_082038.1

name	S100a11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21886811 GeneID:20195 MGI:1338798
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : calizzarin; endothelial monocyte activating polypeptide 1; calgizzarin; S100 calcium binding protein A14 product : S100 calcium binding protein A11 (calizzarin) protein_id : NP_058020.1

name	S100a10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677833 GeneID:20194 MGI:1339468
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : calcium binding protein A11 (calgizzarin); S100 calcium binding protein A10 (calgizzarin) product : S100 calcium binding protein A10 protein_id : NP_033138.1

name	EG433623 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51708253 GeneID:433623 MGI:3645005
definition	codon_start : 1 product : similar to TD and POZ domain containing 4 protein_id : XP_485272.1

name	Tdpoz2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124126981 GeneID:399673 MGI:3027902
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : TD and POZ domain containing gene 2 product : TD and POZ domain containing 2 protein_id : NP_001007223.2

name	Tdpoz1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24233506 GeneID:207213 MGI:2449436
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : POZ 56 protein; MATH- and POZ-encompassing protein 2 product : TD and POZ domain containing 1 protein_id : NP_683751.1

name	LOC545550 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251359 GeneID:545550
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479944.1

name	EG436563 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82890379 GeneID:436563 MGI:3645792
definition	codon_start : 1 product : similar to TDPOZ2 protein_id : XP_489896.3

name	Tdpoz4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130492354 GeneID:399675 MGI:3027904
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : TD and POZ domain containing 4 protein_id : NP_997155.2

name	Tdpoz3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402299 CCDS:CCDS17586.1 GeneID:399674 MGI:3027903
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : TD and POZ domain containing gene 3 product : TD and POZ domain containing 3 protein_id : NP_997154.1

name	EG668341 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369761 GeneID:668341 MGI:3648183
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001011.1

name	LOC668344 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251361 GeneID:668344
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479957.1

name	EG668346 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369763 GeneID:668346 MGI:3704095
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001033.1

name	Tdpoz5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402303 CCDS:CCDS17588.1 GeneID:399676 MGI:3027905
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : TD and POZ domain containing gene 5 product : TD and POZ domain containing 5 protein_id : NP_997156.1

name	EG668353 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369765 GeneID:668353 MGI:3644976
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001069.1

name	EG668356 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369767 GeneID:668356 MGI:3644979
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001083.1

name	LOC668359 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94369769 GeneID:668359
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001094.1

name	LOC433624 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251369 GeneID:433624
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479981.1

name	LOC100043188 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251372 GeneID:100043188
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479984.1

name	EG383977 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82890391 GeneID:383977 MGI:3644284
definition	codon_start : 1 product : hypothetical protein protein_id : XP_357358.3

name	EG245290 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38077896 GeneID:245290 MGI:3646925
definition	codon_start : 1 product : similar to TDPOZ3 protein_id : XP_142982.3

name	EG212727 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51708307 GeneID:212727 MGI:3643869
definition	codon_start : 1 product : hypothetical protein protein_id : XP_143402.4

name	Them4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626050 GeneID:75778 MGI:1923028
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA] codon_start : 1 note : carboxyl-terminal modulator protein product : thioesterase superfamily member 4 protein_id : NP_083707.1

name	Them5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539589 CCDS:CCDS17590.1 GeneID:66198 MGI:1913448
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA] codon_start : 1 product : thioesterase superfamily member 5 protein_id : NP_079692.1

name	Gm659 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251307 GeneID:271944 MGI:2685505
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001226.2

name	Rorc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755344 CCDS:CCDS17591.1 GeneID:19885 MGI:104856
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IMP]; GO:0048535 - lymph node development [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : thymus orphan receptor product : RAR-related orphan receptor gamma protein_id : NP_035411.1

name	Lingo4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789433 CCDS:CCDS17592.1 GeneID:320747 MGI:2444651
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat neuronal 6D protein_id : NP_796224.1

name	Tdrkh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625942 GeneID:72634 MGI:1919884
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : tudor and KH domain containing protein protein_id : NP_082583.1

name	Oaz3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567382 GeneID:53814 MGI:1858170
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0004857 - enzyme inhibitor activity [Evidence IEA]; GO:0008073 - ornithine decarboxylase inhibitor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006595 - polyamine metabolism [Evidence TAS] codon_start : 1 note : protein translation dependent on +1 ribosomal frameshift; ornithine decarboxylase antizyme 2; Oaz t; ornithine decarboxylase antizyme in testis; antizyme 3 product : ornithine decarboxylase antizyme 3 protein_id : NP_058597.1 ribosomal_slippage : _no_value

name	Mrpl9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789253 CCDS:CCDS17593.1 GeneID:78523 MGI:2137211
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein L9 protein_id : NP_084392.1

name	2310007A19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313514 GeneID:66353 MGI:1913603
definition	codon_start : 1 product : hypothetical protein LOC66353 protein_id : NP_079782.1

name	Tnrc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369577 GeneID:78784 MGI:1926034
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : CUG-BP and ETR-3 like factor 3 protein_id : NP_766022.1

name	Snx27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723792 GeneID:76742 MGI:1923992
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : sorting nexin family member 27 isoform 1 protein_id : NP_001075953.1

name	Snx27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126722910 GeneID:76742 MGI:1923992
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : sorting nexin family member 27 isoform 2 protein_id : NP_083997.1

name	Tuft1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755903 CCDS:CCDS17595.1 GeneID:22156 MGI:109572
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030345 - structural constituent of tooth enamel [Evidence ISS] GO_process : GO:0030282 - bone mineralization [Evidence ISS]; GO:0042476 - odontogenesis [Evidence ISS]; GO:0001503 - ossification [Evidence IEA] codon_start : 1 product : tuftelin 1 protein_id : NP_035786.1

name	LOC100042793 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251310 GeneID:100042793
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478881.1

name	BC021767 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369776 GeneID:545551 MGI:3615512
definition	codon_start : 1 product : similar to Cgn protein protein_id : XP_619932.3

name	Selenbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507079 GeneID:20342 MGI:104859
definition	GO_function : GO:0008430 - selenium binding [Evidence IEA] codon_start : 1 note : acetaminophen-binding protein product : selenium binding protein 2 protein_id : NP_062287.1

name	LOC100042801 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251312 GeneID:100042801
definition	codon_start : 1 product : similar to tuftelin protein_id : XP_001478891.1

name	Cgn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251314 GeneID:70737 MGI:1927237
definition	codon_start : 1 product : cingulin protein_id : XP_001001375.2

name	Pogz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369994 CCDS:CCDS17596.1 GeneID:229584 MGI:2442117
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA] codon_start : 1 exception : mismatches in translation product : pogo transposable element with ZNF domain protein_id : NP_766271.1

name	Psmb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45592932 CCDS:CCDS17597.1 GeneID:19172 MGI:1098257
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : proteasome beta 4 subunit protein_id : NP_032971.1

name	Selenbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22164798 GeneID:20341 MGI:96825
definition	GO_function : GO:0008430 - selenium binding [Evidence TAS] codon_start : 1 product : selenium binding protein 1 protein_id : NP_033176.2

name	Rfx5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71037397 CCDS:CCDS17598.1 GeneID:53970 MGI:1858421
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : regulatory factor X, 5 protein_id : NP_059091.2

name	LOC100042701 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042701
definition	number : 1 pseudo : _no_value

name	LOC100042701 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042701
definition	number : 2 pseudo : _no_value

name	LOC100042701 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042701
definition	number : 3 pseudo : _no_value

name	EG668385 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668385
definition	number : 2 pseudo : _no_value

name	EG668385 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668385
definition	number : 1 pseudo : _no_value

name	LOC668325 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251303 GeneID:668325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 Proteins product : similar to Tdpoz5 protein pseudo : _no_value transcript_id : XR_002165.2

name	LOC100042761 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251304 GeneID:100042761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 18 Proteins product : similar to Tdpoz5 protein pseudo : _no_value transcript_id : XR_033875.1

name	LOC668367 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251370 GeneID:668367
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 21 Proteins product : similar to Tdpoz5 protein pseudo : _no_value transcript_id : XR_034457.1

name	LOC433625 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251305 GeneID:433625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 19 Proteins product : similar to Tdpoz5 protein pseudo : _no_value transcript_id : XR_033885.1

name	LOC668403 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251308 GeneID:668403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 6 Proteins product : similar to ribosomal protein S2 pseudo : _no_value transcript_id : XR_033918.1

name	LOC100043228 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251375 GeneID:100043228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 2 Proteins product : similar to coiled-coil domain containing 72 pseudo : _no_value transcript_id : XR_034479.1

name	EG668409 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94369774 GeneID:668409 MGI:3646595
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 596 ESTs, 5 Proteins product : predicted gene, EG668409 pseudo : _no_value transcript_id : XR_002179.1

clone name	MSMg01-483E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265J14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-297L12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-161I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-132M12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-382H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-496I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418K06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-051A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332B04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-095G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329H01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-106P07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-166C12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-166E12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-410N22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-261H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185I21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-411M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437D11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-095G02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-091B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-277D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298I09
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-095K18.b	B6Ng01-095K18.g
ACC	DH906546	DH906547
length	1,122	1,205
definition	DH906546\|Mus musculus domesticus DNA, BAC clone: B6Ng01-095K18, 5' end.	DH906547\|Mus musculus domesticus DNA, BAC clone: B6Ng01-095K18, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattccctgttcacagactgctgcctgttggtagctggccatgaattca gggctcacaaggccatcctagcagctcgctctccagttttcagagccatg tttgaacatgaaatggaggagagactaggaaaccccactgagatccatga cctggatcccaaagtctttaaggagatgatgggcttcatttacactggga aggcgccacacctccaaagccactccatggccactgatgtgctgacagct gctgacaagtatggtctggagggcctgaaggtcctgtgtgaggatgccct ctgcaggaacctctctgtggagaatgctgcacaaactctcatcctggctg acctccacaaaagagagcagctgaagactcaggccctgtatttcattgca cttcatgcttctgtggtctctgagacctcagagtggaagtcaatgatgga gacccatccccacttggttggctgaagcattccacttcctgggtcctgca cgcagtgttgagccctcactcaaacacgtaaaatgagtttaggggatgga cagctatgaccaacatctgtcttccaatagcaataaccagtgttgttacc actgatttctggttagagtacagtattgctggaacatttatagtgaacct gggaaaaagcagcatggtggctcagcatgtaaaacagctgttatatgtta aaatgctgggtgggggatgggcagcactggagtctgggacagtctccttg acttctactctgttaatgttctagtatgatttttgtctgatatttaggaa actgggatttaatttagtgctgtccctaaaggacagacaaacctgagttt cttcagagaaaccttttctgcattggactatgtagagagatgactggggc ccagagcaaagataatcagcacgaatgttaactcattgggatggaagaca tgaagactttatttttaagattcagtttgtgggaactcagctgcagagca gtacagttcactcaaagaactcttgttcagttctcagcatacagagaagt tttcagccacccctttacttgtgatcagaagaatctgaagcctactttgt ttcaatgctcaaacagctctgt	gaattctatgcatctcgacctttcgctgatgaaaggcttctccacctgga tttcctctgcattttcctactttaaggagagggtgggggtaggcttgatt gcaatgatcctatgcggtggagtgttgcttttgctctggatggtctgtaa actcaaagcccaaacaaaaagggacaagatggtaatagcccaagcacttg cagcattagaacatggtacctcccctgatatatggttatctatacttaag caataagtcgctggccactcagttcttgcactgcaataggctcgtctcat tgcacaggatagagtgagtgtgcttcagcagcccaatagagttgcatggc taagcactgcagtagaaaggctctgcggcataatatgagcctgttcgagg gagacatgtcatcttgtatgaagattgagtgtccaagtgtcctttccaca ggaaaaacgacatgggagcggaccaagacccctccgcgtgacgagcctgg gagaaggttttgtgtaatgcccctatttttgcacactggggatttgacct ctatctccactctcagtactgggtggcctgttgccttttaaataaaagaa aagggggagatgtgaggagctgcccttgcaatcgccattacaagatggcg ctgacatccggtgttctaactggtaaacaagtagtctgcgcatttgctgg ggtatttttccattccttgtgccctgcctgtcccgtggcatcatctgggc tgatggtgagcaaccagtcagggtgaaacacgtctccaaccgctctttcg tggcctatttaaggaccgagtttcctgtgttctgggtcctctccccagaa gctgatcatcttctctcgagatgcattaaagctttgctgcagaggatccg agtgtgtcctgtgtgtgtgtcctcgccggcgagactctttatcacacagg acacccctagttgagtttctgtaatgtccctatagtctgctttaaacata tatgctaaattgacctcatatgaatacctcactttcttatctgattggat ggaagtttgtctgaatgtatagctgggctgcatctgaagtcttttagagt tatagccatggtgcctgactcattggacctaaactctccaacctgggagt gcagtttacccaccattagtagtcatcgttctcagtagagattccgagtg tcaca
quality values	Open. Hide. 19 24 13 30 47 47 47 47 53 61 46 47 31 11 47 20 38 53 53 53 61 50 61 61 16 21 14 22 28 26 19 10 22 19 41 47 55 55 47 41 47 27 55 52 52 49 55 55 41 38 41 55 55 49 55 52 43 52 41 52 52 61 52 49 49 59 59 59 59 39 30 43 36 31 43 59 59 49 52 59 61 61 59 59 59 52 59 61 59 59 59 37 36 59 59 59 59 52 59 61 59 59 59 59 59 52 59 49 59 59 59 52 59 59 61 59 59 52 59 61 43 59 52 59 59 59 43 36 52 59 59 59 59 59 59 61 52 59 59 61 59 52 61 61 59 59 49 59 59 59 59 59 59 59 49 61 61 59 61 59 59 59 59 59 59 61 61 59 59 52 59 49 61 61 59 59 59 59 61 59 59 61 59 59 59 59 52 39 59 59 59 52 59 49 59 59 59 59 59 61 59 59 61 59 52 59 59 43 59 52 59 55 59 59 59 43 59 59 59 59 55 52 55 55 52 47 41 55 55 52 49 52 52 52 52 47 40 52 52 52 52 52 55 52 52 52 43 52 52 55 55 52 52 52 55 55 49 52 52 52 49 55 52 55 52 52 55 55 55 55 50 55 61 55 55 55 55 55 52 49 55 55 55 55 55 61 55 55 55 55 61 50 55 55 55 55 55 55 55 61 55 55 55 55 50 41 55 61 55 61 55 61 61 61 55 55 55 50 55 50 55 50 55 55 55 61 55 55 55 55 50 55 50 55 55 61 61 50 50 50 43 50 50 50 50 55 49 49 55 55 61 55 55 61 61 61 55 61 55 55 55 53 50 61 50 61 50 53 53 50 61 61 53 61 50 43 61 53 53 53 50 35 61 53 61 61 61 61 61 61 61 61 61 53 53 61 61 61 61 61 61 53 50 47 47 53 61 61 61 61 61 61 61 61 61 43 53 61 61 61 61 61 61 37 43 61 61 61 61 50 39 61 45 53 61 53 61 61 46 53 53 50 47 46 53 53 46 47 47 47 42 61 53 53 47 39 61 53 61 61 53 50 61 61 61 61 57 53 53 57 53 52 53 57 57 47 39 53 45 53 53 53 53 50 53 47 47 57 53 53 57 47 57 53 57 57 53 57 53 50 53 45 53 45 43 47 57 53 53 53 53 47 53 47 46 53 53 45 52 53 53 30 53 53 52 42 53 47 47 50 50 53 53 53 57 57 50 53 47 47 50 41 57 47 47 41 28 57 57 21 38 57 53 57 52 45 53 53 41 38 52 39 57 53 50 57 57 53 52 43 53 53 53 57 39 32 47 53 38 45 45 53 52 53 50 57 53 53 38 42 45 53 50 52 47 32 57 42 57 43 42 57 52 44 25 27 41 43 53 53 57 44 32 53 42 38 53 37 53 27 57 38 53 52 50 57 52 50 30 46 38 46 34 34 40 32 52 57 53 40 42 50 31 37 50 52 27 23 57 50 53 53 52 43 53 46 53 53 29 37 40 31 40 31 34 57 36 42 57 33 31 53 30 30 31 52 36 35 40 33 35 57 57 52 33 29 28 43 48 40 23 57 33 42 40 40 29 21 23 33 57 39 34 30 38 34 29 14 57 57 30 44 57 57 39 29 31 16 28 57 30 28 33 29 39 35 40 41 41 57 44 30 36 40 36 30 45 33 18 21 29 30 35 48 39 38 33 22 30 30 31 35 24 27 45 19 30 34 35 43 27 28 23 31 25 33 27 46 25 28 32 17 33 33 28 21 21 30 25 8 13 25 47 30 30 19 47 23 28 28 16 9 17 24 34 36 25 24 29 51 29 31 29 34 47 29 34 22 51 37 29 34 28 51 24 7 8 15 19 22 31 33 34 39 51 33 17 14 43 5 27 35 28 28 28 16 30 17 14 31 15 6 15 26 29 30 14 19 46 29 22 10 32 8 9 8 43 8 33 41 21 17 16 15 6 5 5 11 29 20 22 16 29 32 10 26 23 20 29 29 25 26 33 27 9 46 5 32 14 16 12 19 34 28 30 33 51 36 29 22 46 25 8 5 19 14 23 15 41 13 11 10 16 51 22 28 24 27 9 19 17 24 22 27 21 16 9 6 22 7 17 34 26 28 15 34 16 24 38 38 21 22 20 13 25 23 5 19 19 24 27 26 29 25 9 31 22 33 51 30 19 29 51 44 39 28 25 34 11 23 12 12 30 23 22 30 44 10 15 17 11 31 24 9 18 10 6 13 23 15 20 25 31 28 18 10 28 9 33 25 11 35 19 7 5 19 13 26 8 5 5 8 20 4 3 10 8 20 20 9 9 18 13 11 22 6 7 18 11 5 11 8 20 15 13 16 11 29 17 15 7 13 9 26 5 6 8 15 5 14 30 22 29 10 14 6 17 22 8 16 28 30 15 4 26 6 27 14 20 9 16 9 14 14 14 27 6 8 22 9 25 11 6 4 5 13 20 15 19 14 11 10 9 3 2 3 4 3 4 6 5 4 8 3 5 10 12 11 12 4 4 12 10 3 3 8 10 9 8 7 3 5	Open. Hide. 61 47 49 47 31 31 21 15 18 21 18 21 29 32 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 49 61 61 61 61 61 59 49 61 61 61 61 61 59 49 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 61 61 61 61 61 61 55 50 61 47 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 53 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 53 61 50 61 61 61 61 61 53 61 53 61 61 61 39 43 43 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 53 61 61 61 61 61 61 53 45 61 47 53 57 57 57 57 57 53 53 50 57 53 52 57 57 57 57 57 53 57 57 57 53 47 53 43 53 47 42 53 47 47 53 53 47 47 50 53 53 47 57 52 52 47 57 53 53 47 53 53 47 57 53 28 57 47 32 57 34 57 57 57 53 50 57 53 50 50 47 52 41 41 47 53 53 50 50 57 33 33 57 53 52 34 52 50 57 53 52 43 51 57 41 30 52 57 53 50 36 57 53 52 40 47 50 53 53 53 38 30 53 53 53 53 50 35 45 52 45 52 53 53 47 52 42 53 52 30 52 47 57 39 53 47 38 41 53 52 57 52 31 57 53 45 44 57 41 53 20 52 34 20 38 17 57 42 42 47 53 27 47 24 47 47 50 52 25 53 53 34 53 52 42 33 41 38 37 40 44 42 16 34 42 42 29 22 34 29 42 53 30 29 24 36 28 33 27 57 53 36 33 52 47 36 36 26 27 44 33 39 37 46 17 41 33 40 37 37 42 38 37 24 46 52 29 37 57 53 34 29 33 25 37 37 33 37 37 33 37 30 19 37 28 30 57 31 32 24 33 26 44 47 46 37 27 21 57 57 57 40 26 29 21 17 37 19 25 30 36 47 32 24 10 30 39 30 40 14 25 17 34 27 29 47 25 21 17 33 27 29 33 35 29 27 33 29 30 39 51 38 30 28 38 39 24 27 33 24 29 29 18 29 20 29 28 30 28 34 28 34 19 5 46 30 12 25 33 48 34 28 24 29 28 33 29 26 19 24 17 20 20 27 19 22 23 28 14 51 9 7 21 21 30 20 29 21 28 29 29 51 29 35 20 15 17 24 14 27 13 32 13 31 46 29 18 21 20 40 25 26 26 14 11 20 40 51 17 20 14 5 7 21 11 10 31 24 20 17 22 28 31 17 28 28 29 28 25 20 19 29 13 36 11 17 31 33 33 29 13 19 14 24 17 27 31 28 21 26 23 46 36 15 28 25 51 28 11 10 16 11 21 14 7 15 6 9 18 22 13 29 12 33 10 8 8 7 11 19 23 22 20 33 15 12 13 24 26 22 22 28 13 8 27 26 28 10 9 19 19 5 7 5 11 7 27 15 24 18 19 51 19 12 23 13 14 11 6 6 8 5 17 6 15 10 17 33 21 11 30 11 17 6 12 28 18 12 28 35 13 22 8 4 8 23 14 8 25 8 26 30 9 7 6 6 15 31 11 8 6 17 29 17 37 13 9 6 5 8 29 10 29 10 7 26 9 9 29 7 30 21 19 18 4 7 8 10 13 6 5 4 4 6 7 28 27 13 13 14 15 23 9 5 11 18 25 8 8 3 9 6 11 18 8 4 2 5 22 8 6 7 17 7 4 6 18 6 17 7 5 9 4 7 6 26 5 11 5 8 4 18 5 7 6 3 3 12 26 15 7 8 9 17 12 12 12 4 6 12 19 3 3 5 3 20 16 8 3 1 7 7 20 11 6 4 18 6 7 4 12 5 13 6 4 9 12 8 4 4 3 3 8 12 7 20 20 8 4 10 4 6 2 4 1 13 4 8 4 9 9 4 4 10 4 12 20 6 12 6 20 9 4 5 13 5 11 1 3 7 4 19 22 12 5 4 7 6 4 18 4 3 3 1 5 4 6 6 4 6 5 9 10 3 4 3 7 4 7 4 7 3 4 4 9 4 6 21 5 6 3 1 1 4 5 4 3 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr3_93763551_93764688
seq2: B6Ng01-095K18.b_46_1167 (reverse)

seq1  ACAGAGCTGTTTGTAGCAATGGAGACCAGATGAGGGCCTCAGATCCTCTG  50
      ||||||||||||| ||| || || ||   | |  ||| |||||| ||   
seq2  ACAGAGCTGTTTG-AGC-ATTGAAAC--AAAGTAGGCTTCAGATTCTTCT  46

seq1  GATCACAAGTTAAGGGGTGGCTGAAAAACTCTCCTGTATGCTGAGAACTG  100
      |||||||||| ||||||||||||||||  ||| |||||||||||||||||
seq2  GATCACAAGTAAAGGGGTGGCTGAAAACTTCT-CTGTATGCTGAGAACTG  95

seq1  AACCAGAGTTCTCTGAGTGAACTGTAACTGCTTCTGCAGCTGAGTTCCCA  150
      ||| |||||||| |||||||||||| ||||| ||||||||||||||||||
seq2  AACAAGAGTTCTTTGAGTGAACTGT-ACTGC-TCTGCAGCTGAGTTCCCA  143

seq1  CAAACTGAATCTTTAAAAAATAAAAGTCTTCATTGTCTTTTCCATCCCAA  200
      |||||||||||||  |||||| |||||||||| ||||  |||||||||||
seq2  CAAACTGAATCTT--AAAAAT-AAAGTCTTCA-TGTC--TTCCATCCCAA  187

seq1  TGAGTTAACATTCGTGCTTGATTTATCCTTTGCTCTGGGCCCCAGTCATC  250
      ||||||||||||||||| ||| |||| |||||||||||||||||||||||
seq2  TGAGTTAACATTCGTGC-TGA-TTAT-CTTTGCTCTGGGCCCCAGTCATC  234

seq1  TCTTCTACATAGTCCAATGCAG-ACAGGTTTCTCTGAAGAAACTCAGGTT  299
      || ||||||||||||||||||| | |||||||||||||||||||||||||
seq2  TC-TCTACATAGTCCAATGCAGAAAAGGTTTCTCTGAAGAAACTCAGGTT  283

seq1  TGTCTGTCC-TTAGGGACAGCACCTAAATTAAATCCCAGTTTCCTAAATA  348
      ||||||||| |||||||||||| |||||||||||||||||||||||||||
seq2  TGTCTGTCCTTTAGGGACAGCA-CTAAATTAAATCCCAGTTTCCTAAATA  332

seq1  TCAGACAAAAATCATACTAGAACATTAACAGAGTAGAAGTCAAGGAGACT  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGACAAAAATCATACTAGAACATTAACAGAGTAGAAGTCAAGGAGACT  382

seq1  GTCCCAGACTCCAGTGCTGCCCATCCCCCACCCAGCATTTTAACATATAA  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCCAGACTCCAGTGCTGCCCATCCCCCACCCAGCATTTTAACATATAA  432

seq1  CAGCTGTTTTACATGCTGAGCCACCATGCTGCTTTTTCCCAGGTTCACTA  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTGTTTTACATGCTGAGCCACCATGCTGCTTTTTCCCAGGTTCACTA  482

seq1  TAAATGTTCCAGCAATACTGTACTCTAACCAGAAATCAGTGGTAACAACA  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATGTTCCAGCAATACTGTACTCTAACCAGAAATCAGTGGTAACAACA  532

seq1  CTGGTTATTGCTATTGGAAGACAGATGTTGGTCATAGCTGTCCATCCCCT  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTTATTGCTATTGGAAGACAGATGTTGGTCATAGCTGTCCATCCCCT  582

seq1  AAACTCATTTTACGTGTTTGAGTGAGGGCTCAACACTGCGTGCAGGACCC  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTCATTTTACGTGTTTGAGTGAGGGCTCAACACTGCGTGCAGGACCC  632

seq1  AGGAAGTGGAATGCTTCAGCCAACCAAGTGGGGATGGGTCTCCATCATTG  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAGTGGAATGCTTCAGCCAACCAAGTGGGGATGGGTCTCCATCATTG  682

seq1  ACTTCCACTCTGAGGTCTCAGAGACCACAGAAGCATGAAGTGCAATGAAA  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTCCACTCTGAGGTCTCAGAGACCACAGAAGCATGAAGTGCAATGAAA  732

seq1  TACAGGGCCTGAGTCTTCAGCTGCTCTCTTTTGTGGAGGTCAGCCAGGAT  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGGGCCTGAGTCTTCAGCTGCTCTCTTTTGTGGAGGTCAGCCAGGAT  782

seq1  GAGAGTTTGTGCAGCATTCTCCACAGAGAGGTTCCTGCAGAGGGCATCCT  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGTTTGTGCAGCATTCTCCACAGAGAGGTTCCTGCAGAGGGCATCCT  832

seq1  CACACAGGACCTTCAGGCCCTCCAGACCATACTTGTCAGCAGCTGTCAGC  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACAGGACCTTCAGGCCCTCCAGACCATACTTGTCAGCAGCTGTCAGC  882

seq1  ACATCAGTGGCCATGGAGTGGCTTTGGAGGTGTGGCGCCTTCCCAGTGTA  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCAGTGGCCATGGAGTGGCTTTGGAGGTGTGGCGCCTTCCCAGTGTA  932

seq1  AATGAAGCCCATCATCTCCTTAAAGACTTTGGGATCCAGGTCATGGATCT  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGAAGCCCATCATCTCCTTAAAGACTTTGGGATCCAGGTCATGGATCT  982

seq1  CAGTGGGGTTTCCTAGTCTCTCCTCCATTTCATGTTCAAACATGGCTCTG  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGGGGTTTCCTAGTCTCTCCTCCATTTCATGTTCAAACATGGCTCTG  1032

seq1  AAAACTGGAGAGCGAGCTGCTAGGATGGCCTTGTGAGCCCTGAATTCATG  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACTGGAGAGCGAGCTGCTAGGATGGCCTTGTGAGCCCTGAATTCATG  1082

seq1  GCCAGCTACCAACAGGCAGCAGTCTGTGAACAGGGAATTC  1138
      ||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGCTACCAACAGGCAGCAGTCTGTGAACAGGGAATTC  1122

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information