MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-238C22
Chromosome	3 (Build37)
Map Location	90,076,297 - 90,267,116
singlet/doublet	doublet
Overlap gene	Dennd4b, Gatad2b, Slc27a3, Ints3, Npr1
Upstream gene	Efna1, Efna3, Efna4, Adam15, Dcst1, Dcst2, Zbtb7b, Lenep, Flad1, Cks1b, Shc1, Pygo2, Pbxip1, Pmvk, Kcnn3, LOC668078, Adar, Chrnb2, Ube2q1, LOC668087, She, Il6ra, Atp8b2, LOC668102, Hax1, Ubap2l, 4933434E20Rik, 1700094D03Rik, Tpm3, Nup210l, Rps27, Rab13, Jtb, Creb3l4, LOC100042397, Slc39a1, Crtc2
Downstream gene	LOC668141, Ilf2, Snapap, 2500003M10Rik, S100a1, S100a13, S100a14, S100a16, EG628324, S100a3, S100a4, S100a5, S100a6, S100a7a, S100a8, S100a9, LOC668165, LOC383949, Pglyrp4, LOC329706, EG545541, LOC635737, EG668174, LOC668179, LOC635756, 4930529C04Rik, 9130204L05Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Efna1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13636 MGI:103236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efna3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13638 MGI:106644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efna4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13639 MGI:106643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adam15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11490 MGI:1333882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Dcst1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77772 MGI:1925022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dcst2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329702 MGI:2685606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein

name	Zbtb7b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22724 MGI:102755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lenep (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57275 MGI:1930020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Flad1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319945 MGI:2443030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cks1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54124 MGI:1889208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20416 MGI:98296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pygo2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68911 MGI:1916161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pbxip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229534 MGI:2441670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pmvk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68603 MGI:1915853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140493 MGI:2153183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668078 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668078
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Adar (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56417 MGI:1889575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Chrnb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11444 MGI:87891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2q1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70093 MGI:1917343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668087 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668087
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	She (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214547 MGI:1099462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il6ra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16194 MGI:105304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp8b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54667 MGI:1859660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668102 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Hax1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23897 MGI:1346319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubap2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74383 MGI:1921633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4933434E20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99650 MGI:1914027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	1700094D03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73545 MGI:1920795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 2 Proteins

name	Tpm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59069 MGI:1890149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nup210l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77595 MGI:1924845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins

name	Rps27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57294 MGI:1888676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68328 MGI:1927232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jtb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23922 MGI:1346082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Creb3l4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78284 MGI:1916603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042397 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Slc39a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30791 MGI:1353474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crtc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74343 MGI:1921593
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dennd4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229541 MGI:2446201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gatad2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229542 MGI:2443225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc27a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26568 MGI:1347358
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ints3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229543 MGI:2140050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Npr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18160 MGI:97371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668141 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668141
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ilf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67781 MGI:1915031
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snapap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20615 MGI:1333745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2500003M10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66511 MGI:1913761
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	S100a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20193 MGI:1338917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	S100a13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20196 MGI:109581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	S100a14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66166 MGI:1913416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	S100a16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67860 MGI:1915110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628324 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628324 MGI:3646384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	S100a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20197 MGI:1338849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	S100a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20198 MGI:1330282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	S100a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20199 MGI:1338915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	S100a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20200 MGI:1339467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	S100a7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381493 MGI:2687194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	S100a8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20201 MGI:88244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	S100a9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20202 MGI:1338947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668165 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC383949 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	Pglyrp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384997 MGI:2686324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC329706 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:329706
definition	note : apoptosis inhibitor 5 pseudogene pseudo : _no_value

name	EG545541 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545541 MGI:3645655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	LOC635737 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG668174 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668174 MGI:3643780
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	LOC668179 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC635756 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635756
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	4930529C04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619677 MGI:1922392
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 53 ESTs, 3 Proteins

name	9130204L05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229550 MGI:2684973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	Efna1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374591 GeneID:13636 MGI:103236
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ephrin A1 transcript_id : NM_010107.3

name	Efna3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117935035 GeneID:13638 MGI:106644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ephrin A3 transcript_id : NM_010108.1

name	Efna4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110835738 GeneID:13639 MGI:106643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ephrin A4 transcript_id : NM_007910.2

name	Adam15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109148518 GeneID:11490 MGI:1333882
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 15 (metargidin) transcript_id : NM_009614.2

name	Adam15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109148516 GeneID:11490 MGI:1333882
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 15 (metargidin) transcript_id : NM_001037722.2

name	Dcst1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116812882 GeneID:77772 MGI:1925022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DC-STAMP domain containing 1 transcript_id : NM_029974.1

name	Dcst2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251259 GeneID:329702 MGI:2685606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : DC-STAMP domain containing 2 transcript_id : XM_283860.5

name	Zbtb7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61657926 GeneID:22724 MGI:102755
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 7B transcript_id : NM_009565.4

name	Lenep (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113866001 GeneID:57275 MGI:1930020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lens epithelial protein transcript_id : NM_020517.3

name	Flad1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89337261 GeneID:319945 MGI:2443030
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RFad1, flavin adenine dinucleotide synthetase, homolog (yeast) transcript_id : NM_177041.3

name	Cks1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8393134 GeneID:54124 MGI:1889208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC28 protein kinase 1b transcript_id : NM_016904.1

name	Shc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802610 GeneID:20416 MGI:98296
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : src homology 2 domain-containing transforming protein C1 transcript_id : NM_011368.4

name	Pygo2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351456 GeneID:68911 MGI:1916161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pygopus 2 transcript_id : NM_026869.2

name	Pbxip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122650 GeneID:229534 MGI:2441670
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pre-B-cell leukemia transcription factor interacting protein 1 transcript_id : NM_146131.1

name	Pmvk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350475 GeneID:68603 MGI:1915853
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphomevalonate kinase transcript_id : NM_026784.2

name	Kcnn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:17978283 GeneID:140493 MGI:2153183
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 transcript_id : NM_080466.1

name	LOC668078 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94369707 GeneID:668078
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical LOC668078 transcript_id : XM_994194.1

name	Adar (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388349 GeneID:56417 MGI:1889575
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine deaminase, RNA-specific transcript_id : NM_001038587.2

name	Adar (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981008 GeneID:56417 MGI:1889575
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine deaminase, RNA-specific transcript_id : NM_019655.2

name	Chrnb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789302 GeneID:11444 MGI:87891
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal) transcript_id : NM_009602.3

name	Ube2q1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352603 GeneID:70093 MGI:1917343
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2Q (putative) 1 transcript_id : NM_027315.3

name	She (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85662386 GeneID:214547 MGI:1099462
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : src homology 2 domain-containing transforming protein E transcript_id : NM_172530.2

name	Il6ra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110431355 GeneID:16194 MGI:105304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 6 receptor, alpha transcript_id : NM_010559.2

name	Atp8b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487146 GeneID:54667 MGI:1859660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Atpase, class I, type 8B, member 2 transcript_id : NM_001081182.1

name	Hax1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360300 GeneID:23897 MGI:1346319
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HCLS1 associated X-1 transcript_id : NM_011826.2

name	Ubap2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239420 GeneID:74383 MGI:1921633
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin associated protein 2-like transcript_id : NM_028475.1

name	Ubap2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23943917 GeneID:74383 MGI:1921633
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin associated protein 2-like transcript_id : NM_153489.1

name	4933434E20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387754 GeneID:99650 MGI:1914027
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933434E20 gene transcript_id : NM_027500.2

name	4933434E20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20270195 GeneID:99650 MGI:1914027
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933434E20 gene transcript_id : NM_025762.1

name	1700094D03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251316 GeneID:73545 MGI:1920795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 2 Proteins product : RIKEN cDNA 1700094D03 gene transcript_id : XM_892960.3

name	Tpm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254524 GeneID:59069 MGI:1890149
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tropomyosin 3, gamma transcript_id : NM_022314.2

name	Nup210l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251320 GeneID:77595 MGI:1924845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins product : nucleoporin 210-like transcript_id : XM_001479463.1

name	Rps27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365586 GeneID:57294 MGI:1888676
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S27 transcript_id : NM_027015.2

name	Rab13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802134 GeneID:68328 MGI:1927232
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB13, member RAS oncogene family transcript_id : NM_026677.2

name	Jtb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124377999 GeneID:23922 MGI:1346082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumping translocation breakpoint transcript_id : NM_206924.2

name	Creb3l4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368602 GeneID:78284 MGI:1916603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cAMP responsive element binding protein 3-like 4 transcript_id : NM_030080.2

name	LOC100042397 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251264 GeneID:100042397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100042397 transcript_id : XM_001478107.1

name	Slc39a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930336 GeneID:30791 MGI:1353474
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 39 (zinc transporter), member 1 transcript_id : NM_013901.1

name	Crtc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037360 GeneID:74343 MGI:1921593
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CREB regulated transcription coactivator 2 transcript_id : NM_028881.1

name	Dennd4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119372291 GeneID:229541 MGI:2446201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DENN/MADD domain containing 4B transcript_id : NM_201407.2

name	Gatad2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21314853 GeneID:229542 MGI:2443225
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GATA zinc finger domain containing 2B transcript_id : NM_139304.1

name	Slc27a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83715969 GeneID:26568 MGI:1347358
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 27 (fatty acid transporter), member 3 transcript_id : NM_011988.1

name	Ints3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31652267 GeneID:229543 MGI:2140050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrator complex subunit 3 transcript_id : NM_178876.2

name	Ints3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31652265 GeneID:229543 MGI:2140050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrator complex subunit 3 transcript_id : NM_145540.2

name	Npr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930717 GeneID:18160 MGI:97371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : natriuretic peptide receptor 1 transcript_id : NM_008727.5

name	Ilf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129818 GeneID:67781 MGI:1915031
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin enhancer binding factor 2 transcript_id : NM_026374.3

name	Snapap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981593 GeneID:20615 MGI:1333745
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SNAP-associated protein transcript_id : NM_133854.2

name	2500003M10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364263 GeneID:66511 MGI:1913761
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2500003M10 gene transcript_id : NM_023215.4

name	S100a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930760 GeneID:20193 MGI:1338917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100 calcium binding protein A1 transcript_id : NM_011309.3

name	S100a13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930756 GeneID:20196 MGI:109581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100 calcium binding protein A13 transcript_id : NM_009113.3

name	S100a14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372173 GeneID:66166 MGI:1913416
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100 calcium binding protein A14 transcript_id : NM_025393.2

name	S100a16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982650 GeneID:67860 MGI:1915110
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100 calcium binding protein A16 transcript_id : NM_026416.2

name	EG628324 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251266 GeneID:628324 MGI:3646384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG628324 transcript_id : XM_001478157.1

name	S100a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130205 GeneID:20197 MGI:1338849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100 calcium binding protein A3 transcript_id : NM_011310.2

name	S100a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859623 GeneID:20198 MGI:1330282
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100 calcium binding protein A4 transcript_id : NM_011311.1

name	S100a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930759 GeneID:20199 MGI:1338915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100 calcium binding protein A5 transcript_id : NM_011312.2

name	S100a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930761 GeneID:20200 MGI:1339467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100 calcium binding protein A6 (calcyclin) transcript_id : NM_011313.2

name	S100a7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40786530 GeneID:381493 MGI:2687194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100 calcium binding protein A7A transcript_id : NM_199422.1

name	S100a8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930764 GeneID:20201 MGI:88244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100 calcium binding protein A8 (calgranulin A) transcript_id : NM_013650.2

name	S100a9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893069 GeneID:20202 MGI:1338947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100 calcium binding protein A9 (calgranulin B) transcript_id : NM_009114.2

name	Pglyrp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402282 GeneID:384997 MGI:2686324
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidoglycan recognition protein 4 transcript_id : NM_207263.1

name	EG545541 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369712 GeneID:545541 MGI:3645655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : predicted gene, EG545541 transcript_id : XM_619923.3

name	LOC635737 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251268 GeneID:635737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to Protein S100-A9 (S100 calcium-binding protein A9) (Calgranulin-B) (Neutrophil cytosolic 23 kDa protein) (P23) (BEE22) transcript_id : XM_001478193.1

name	EG668174 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369713 GeneID:668174 MGI:3643780
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : predicted gene, EG668174 transcript_id : XM_994762.1

name	LOC635756 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251270 GeneID:635756
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to 60S acidic ribosomal protein P1 transcript_id : XM_001478213.1

name	9130204L05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251328 GeneID:229550 MGI:2684973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : RIKEN cDNA 9130204L05 gene transcript_id : XM_001479737.1

name	Efna1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560598 CCDS:CCDS17501.1 GeneID:13636 MGI:103236
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0048013 - ephrin receptor signaling pathway [Evidence IDA]; GO:0030182 - neuron differentiation [Evidence IDA]; GO:0050770 - regulation of axonogenesis [Evidence IDA] codon_start : 1 exception : mismatches in translation product : ephrin A1 protein_id : NP_034237.2

name	Efna3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117935036 GeneID:13638 MGI:106644
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : ephrin A3 protein_id : NP_034238.1

name	Efna4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110835739 GeneID:13639 MGI:106643
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : ephrin A4 protein_id : NP_031936.2

name	Adam15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6752962 CCDS:CCDS17503.1 GeneID:11490 MGI:1333882
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; a disintegrin and metalloproteinase domain 15 (metargidin) product : a disintegrin and metalloprotease domain 15 (metargidin) isoform b protein_id : NP_033744.1

name	Adam15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109148517 CCDS:CCDS17502.1 GeneID:11490 MGI:1333882
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; a disintegrin and metalloproteinase domain 15 (metargidin) product : a disintegrin and metalloprotease domain 15 (metargidin) isoform a protein_id : NP_001032811.2

name	Dcst1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116812883 GeneID:77772 MGI:1925022
definition	codon_start : 1 product : DC-STAMP domain containing 1 protein_id : NP_084250.1

name	Dcst2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82890279 GeneID:329702 MGI:2685606
definition	codon_start : 1 product : similar to DC-STAMP domain containing 2 protein_id : XP_283860.4

name	Zbtb7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059087 CCDS:CCDS17504.1 GeneID:22724 MGI:102755
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 67; Vzinc finger and BTB domain containing 7B product : T helper-inducing POZ/Krueppel factor protein_id : NP_033591.2

name	Lenep (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048454 GeneID:57275 MGI:1930020
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] codon_start : 1 note : lens epithelial protein 503; lens epithelial cell protein product : lens epithelial protein protein_id : NP_065263.1

name	Flad1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89337262 GeneID:319945 MGI:2443030
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0006777 - Mo-molybdopterin cofactor biosynthesis [Evidence IEA] codon_start : 1 product : FAD-synthetase protein_id : NP_796015.2

name	Cks1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393135 GeneID:54124 MGI:1889208
definition	GO_function : GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA] codon_start : 1 note : cyclin-dependent kinase regulatory subunit 1 product : CDC28 protein kinase 1b protein_id : NP_058600.1

name	Shc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15778828 CCDS:CCDS17508.1 GeneID:20416 MGI:98296
definition	GO_component : GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005543 - phospholipid binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0005068 - transmembrane receptor protein tyrosine kinase adaptor protein activity [Evidence ISS] GO_process : GO:0000187 - activation of MAPK activity [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0008284 - positive regulation of cell proliferation [Evidence ISS]; GO:0045840 - positive regulation of mitosis [Evidence ISS]; GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 product : src homology 2 domain-containing transforming protein C protein_id : NP_035498.2

name	Pygo2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625705 GeneID:68911 MGI:1916161
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : pygopus 2 protein_id : NP_081145.1

name	Pbxip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122651 CCDS:CCDS17510.1 GeneID:229534 MGI:2441670
definition	codon_start : 1 product : pre-B-cell leukemia transcription factor interacting protein 1 protein_id : NP_666243.1

name	Pmvk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312068 CCDS:CCDS17511.1 GeneID:68603 MGI:1915853
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0004631 - phosphomevalonate kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006695 - cholesterol biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0016126 - sterol biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : phosphomevalonate kinase protein_id : NP_081060.1

name	Kcnn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17978284 GeneID:140493 MGI:2153183
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015269 - calcium-activated potassium channel activity [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0016286 - small conductance calcium-activated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : small conductance calcium-activated potassium channel 3 product : small conductance calcium-activated potassium channel protein 3 protein_id : NP_536714.1

name	LOC668078 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94369708 GeneID:668078
definition	codon_start : 1 product : hypothetical protein protein_id : XP_999288.1

name	Adar (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981009 CCDS:CCDS17513.1 GeneID:56417 MGI:1889575
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003726 - double-stranded RNA adenosine deaminase activity [Evidence ISS] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003692 - left-handed Z-DNA binding [Evidence TAS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016553 - base conversion or substitution editing [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; double-stranded RNA-specific adenosine deaminase; RNA-specific adenosine deaminase p150 form; RNA-specific adenosine deaminase p110 form product : adenosine deaminase, RNA-specific isoform 1 protein_id : NP_062629.2

name	Adar (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370216 CCDS:CCDS17514.1 GeneID:56417 MGI:1889575
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003726 - double-stranded RNA adenosine deaminase activity [Evidence ISS] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003692 - left-handed Z-DNA binding [Evidence TAS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016553 - base conversion or substitution editing [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 1; double-stranded RNA-specific adenosine deaminase; RNA-specific adenosine deaminase p150 form; RNA-specific adenosine deaminase p110 form product : adenosine deaminase, RNA-specific isoform 2 protein_id : NP_001033676.1

name	Chrnb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542397 CCDS:CCDS17515.1 GeneID:11444 MGI:87891
definition	GO_component : GO:0005624 - membrane fraction [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004889 - nicotinic acetylcholine-activated cation-selective channel activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007613 - memory [Evidence IMP]; GO:0007600 - sensory perception [Evidence IMP]; GO:0007271 - synaptic transmission, cholinergic [Evidence IEA] codon_start : 1 note : acetylcholine receptor beta 2 neural product : neuronal nicotinic acetylcholine receptor beta 2 protein_id : NP_033732.2

name	Ube2q1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541872 CCDS:CCDS17517.1 GeneID:70093 MGI:1917343
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : galactosyl transferase-associated protein product : ubiquitin-conjugating enzyme E2Q protein_id : NP_081591.2

name	She (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85662387 CCDS:CCDS17518.1 GeneID:214547 MGI:1099462
definition	GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Src homology 2 domain containing E protein_id : NP_766118.2

name	Il6ra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110431356 GeneID:16194 MGI:105304
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 note : IL-6 receptor alpha chain product : interleukin 6 receptor, alpha protein_id : NP_034689.2

name	Atp8b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487147 GeneID:54667 MGI:1859660
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004012 - phospholipid-translocating ATPase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : Atpase 8B2, p type product : Atpase, class I, type 8B, member 2 protein_id : NP_001074651.1

name	Hax1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754160 CCDS:CCDS17519.1 GeneID:23897 MGI:1346319
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence TAS] codon_start : 1 note : HS1 binding protein product : HCLS1 associated X-1 protein_id : NP_035956.1

name	Ubap2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943918 GeneID:74383 MGI:1921633
definition	codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : Nice-4 protein homolog isoform 2 protein_id : NP_705693.1

name	Ubap2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239421 GeneID:74383 MGI:1921633
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : Nice-4 protein homolog isoform 1 protein_id : NP_082751.1

name	4933434E20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270196 CCDS:CCDS17520.1 GeneID:99650 MGI:1914027
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC99650 isoform 1 protein_id : NP_080038.1

name	4933434E20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229108 GeneID:99650 MGI:1914027
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC99650 isoform 2 protein_id : NP_081776.1

name	1700094D03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82890281 GeneID:73545 MGI:1920795
definition	codon_start : 1 product : hypothetical protein LOC73545 protein_id : XP_898053.1

name	Tpm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254525 GeneID:59069 MGI:1890149
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 note : tropomyosin 5; skalphaTM.2 product : tropomyosin 3, gamma protein_id : NP_071709.2

name	Nup210l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251321 GeneID:77595 MGI:1924845
definition	codon_start : 1 product : nucleoporin 210-like protein_id : XP_001479513.1

name	Rps27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26024336 GeneID:57294 MGI:1888676
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : snoRNA MBI-112 product : ribosomal protein S27 protein_id : NP_081291.1

name	Rab13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311975 CCDS:CCDS17522.1 GeneID:68328 MGI:1927232
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence TAS]; GO:0019897 - extrinsic to plasma membrane [Evidence TAS]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005911 - intercellular junction [Evidence IDA]; GO:0005923 - tight junction [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAS-associated protein RAB13 protein_id : NP_080953.1

name	Jtb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46049047 CCDS:CCDS17523.1 GeneID:23922 MGI:1346082
definition	codon_start : 1 product : jumping translocation breakpoint protein_id : NP_996807.1

name	Creb3l4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313434 CCDS:CCDS17524.1 GeneID:78284 MGI:1916603
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : (attaching to CRE-like 1 product : androgen-induced basic leucine zipper protein_id : NP_084356.1

name	LOC100042397 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251265 GeneID:100042397
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478157.1

name	Slc39a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930337 CCDS:CCDS17525.1 GeneID:30791 MGI:1353474
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046873 - metal ion transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA]; GO:0005385 - zinc ion transporter activity [Evidence IDA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0030001 - metal ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006829 - zinc ion transport [Evidence IDA] codon_start : 1 exception : mismatches in translation note : Zrt/Irt-like protein 1; zinc-iron transporter-like product : solute carrier family 39 (zinc transporter), member 1 protein_id : NP_038929.1

name	Crtc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037361 GeneID:74343 MGI:1921593
definition	codon_start : 1 product : transducer of regulated cAMP response element-binding protein (CREB) 2 protein_id : NP_083157.1

name	Dennd4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119372292 GeneID:229541 MGI:2446201
definition	codon_start : 1 product : DENN/MADD domain containing 4B protein_id : NP_958809.2

name	Gatad2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314854 CCDS:CCDS17526.1 GeneID:229542 MGI:2443225
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : transcription repressor p66; transcription repressor p66 beta component of the MeCP1 complex product : transcription repressor p66 component of the MeCP1 complex protein_id : NP_647465.1

name	Slc27a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83715970 CCDS:CCDS17527.1 GeneID:26568 MGI:1347358
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004321 - fatty-acyl-CoA synthase activity [Evidence IMP]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004467 - long-chain-fatty-acid-CoA ligase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006637 - acyl-CoA metabolism [Evidence IC]; GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0015908 - fatty acid transport [Evidence IMP]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0001676 - long-chain fatty acid metabolism [Evidence TAS] codon_start : 1 exception : mismatches in translation note : fatty acid transport protein 3; very long-chain acyl-CoA synthetase homolog 3; mFLJ00207 protein product : solute carrier family 27 member 3 protein_id : NP_036118.1

name	Ints3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31652266 CCDS:CCDS17528.1 GeneID:229543 MGI:2140050
definition	GO_component : GO:0032039 - integrator complex [Evidence ISS] GO_process : GO:0016180 - snRNA processing [Evidence ISS] codon_start : 1 product : integrator complex subunit 3 protein_id : NP_663515.2

name	Ints3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31652268 CCDS:CCDS17528.1 GeneID:229543 MGI:2140050
definition	GO_component : GO:0032039 - integrator complex [Evidence ISS] GO_process : GO:0016180 - snRNA processing [Evidence ISS] codon_start : 1 product : integrator complex subunit 3 protein_id : NP_849207.2

name	Npr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930718 CCDS:CCDS17529.1 GeneID:18160 MGI:97371
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004383 - guanylate cyclase activity [Evidence IMP] [Evidence IDA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0008528 - peptide receptor activity, G-protein coupled [Evidence IEA]; GO:0016849 - phosphorus-oxygen lyase activity [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008217 - blood pressure regulation [Evidence IMP]; GO:0006182 - cGMP biosynthesis [Evidence IEA]; GO:0009190 - cyclic nucleotide biosynthesis [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : Nppa receptor; guanylyl cyclase-A; guanylate cyclase A product : natriuretic peptide receptor 1 protein_id : NP_032753.5

name	Ilf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385872 CCDS:CCDS17530.1 GeneID:67781 MGI:1915031
definition	GO_component : GO:0005730 - nucleolus [Evidence ISS] [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0003725 - double-stranded RNA binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : testis expressed gene 267 product : interleukin enhancer binding factor 2 protein_id : NP_080650.1

name	Snapap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19923056 CCDS:CCDS17531.1 GeneID:20615 MGI:1333745
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0045202 - synapse [Evidence IEA]; GO:0019717 - synaptosome [Evidence IEA] [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0000149 - SNARE binding [Evidence ISS] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0016079 - synaptic vesicle exocytosis [Evidence ISS] codon_start : 1 note : Snapin; synaptosomal-associated protein, 25 kDa, binding protein; synaptosomal-associated protein, binding protein; synaptosomal-associated protein 25 binding protein product : SNAP-associated protein protein_id : NP_598615.1

name	2500003M10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981251 CCDS:CCDS17532.1 GeneID:66511 MGI:1913761
definition	codon_start : 1 product : hypothetical protein LOC66511 protein_id : NP_075704.2

name	S100a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755386 GeneID:20193 MGI:1338917
definition	GO_component : GO:0016529 - sarcoplasmic reticulum [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : S100 calcium binding protein A1 protein_id : NP_035439.1

name	S100a13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677835 GeneID:20196 MGI:109581
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : S100 calcium-binding protein A13 product : S100 calcium binding protein A13 protein_id : NP_033139.1

name	S100a14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384776 CCDS:CCDS17535.1 GeneID:66166 MGI:1913416
definition	codon_start : 1 exception : mismatches in translation note : S100 calcium binding protein A15 product : S100 calcium binding protein A14 protein_id : NP_079669.1

name	S100a16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312760 CCDS:CCDS17536.1 GeneID:67860 MGI:1915110
definition	codon_start : 1 product : S100 calcium binding protein A16 protein_id : NP_080692.1

name	EG628324 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251267 GeneID:628324 MGI:3646384
definition	codon_start : 1 product : similar to Protein S100-A2 (S100 calcium-binding protein A2) (Protein S-100L) protein_id : XP_001478207.1

name	S100a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755388 CCDS:CCDS17537.1 GeneID:20197 MGI:1338849
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : S100 calcium binding protein A3 protein_id : NP_035440.1

name	S100a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859624 CCDS:CCDS17538.1 GeneID:20198 MGI:1330282
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IDA] codon_start : 1 function : calsium binding protein note : calvasculin; S100 calcium-binding protein A4 product : S100 calcium binding protein A4 protein_id : NP_035441.1

name	S100a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755390 GeneID:20199 MGI:1338915
definition	GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : S100 calcium binding protein A5 protein_id : NP_035442.1

name	S100a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755392 GeneID:20200 MGI:1339467
definition	GO_component : GO:0005635 - nuclear envelope [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] [Evidence ISS] [Evidence IDA]; GO:0008083 - growth factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IDA] GO_process : GO:0007409 - axonogenesis [Evidence ISS]; GO:0007049 - cell cycle [Evidence IEA]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0048146 - positive regulation of fibroblast proliferation [Evidence ISS]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : calcium binding protein A6 (calcyclin) product : S100 calcium binding protein A6 (calcyclin) protein_id : NP_035443.1

name	S100a7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40786531 CCDS:CCDS17541.1 GeneID:381493 MGI:2687194
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : S100 calcium-binding protein A15; S100 calcium binding protein A7-like 1 product : S100 calcium binding protein A15 protein_id : NP_955454.1

name	S100a8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305453 GeneID:20201 MGI:88244
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] codon_start : 1 note : chemotactic S100 protein product : S100 calcium binding protein A8 (calgranulin A) protein_id : NP_038678.1

name	S100a9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677837 CCDS:CCDS17543.1 GeneID:20202 MGI:1338947
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0031532 - actin cytoskeleton reorganization [Evidence IMP]; GO:0030595 - leukocyte chemotaxis [Evidence IMP]; GO:0045113 - regulation of integrin biosynthesis [Evidence IMP] codon_start : 1 note : S100 calcium-binding protein A9 (calgranulin B) product : S100 calcium binding protein A9 (calgranulin B) protein_id : NP_033140.1

name	Pglyrp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402283 CCDS:CCDS17544.1 GeneID:384997 MGI:2686324
definition	GO_function : GO:0008745 - N-acetylmuramoyl-L-alanine amidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0009253 - peptidoglycan catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : peptidoglycan recognition protein 4 protein_id : NP_997146.1

name	EG545541 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63501191 GeneID:545541 MGI:3645655
definition	codon_start : 1 product : similar to Protein S100-A9 (S100 calcium-binding protein A9) (Calgranulin-B) (Neutrophil cytosolic 23 kDa protein) (P23) (BEE22) protein_id : XP_619923.1

name	LOC635737 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251269 GeneID:635737
definition	codon_start : 1 product : similar to Protein S100-A9 (S100 calcium-binding protein A9) (Calgranulin-B) (Neutrophil cytosolic 23 kDa protein) (P23) (BEE22) protein_id : XP_001478243.1

name	EG668174 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369714 GeneID:668174 MGI:3643780
definition	codon_start : 1 product : similar to Protein S100-A9 (S100 calcium-binding protein A9) (Calgranulin-B) (Neutrophil cytosolic 23 kDa protein) (P23) (BEE22) protein_id : XP_999856.1

name	LOC635756 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251271 GeneID:635756
definition	codon_start : 1 product : similar to 60S acidic ribosomal protein P1 protein_id : XP_001478263.1

name	9130204L05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251329 GeneID:229550 MGI:2684973
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479787.1

name	LOC668087 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668087
definition	number : 1 pseudo : _no_value

name	LOC668102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668102
definition	number : 8 pseudo : _no_value

name	LOC668102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668102
definition	number : 7 pseudo : _no_value

name	LOC668102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668102
definition	number : 6 pseudo : _no_value

name	LOC668102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668102
definition	number : 5 pseudo : _no_value

name	LOC668102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668102
definition	number : 4 pseudo : _no_value

name	LOC668102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668102
definition	number : 3 pseudo : _no_value

name	LOC668102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668102
definition	number : 2 pseudo : _no_value

name	LOC668102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668102
definition	number : 1 pseudo : _no_value

name	LOC668141 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668141
definition	number : 5 pseudo : _no_value

name	LOC668141 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668141
definition	number : 4 pseudo : _no_value

name	LOC668141 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668141
definition	number : 3 pseudo : _no_value

name	LOC668141 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668141
definition	number : 2 pseudo : _no_value

name	LOC668141 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668141
definition	number : 1 pseudo : _no_value

name	LOC668165 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668165
definition	number : 2 pseudo : _no_value

name	LOC668165 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668165
definition	number : 1 pseudo : _no_value

name	LOC383949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383949
definition	number : 1 pseudo : _no_value

name	LOC668179 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668179
definition	number : 3 pseudo : _no_value

name	LOC668179 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668179
definition	number : 2 pseudo : _no_value

name	LOC668179 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668179
definition	number : 1 pseudo : _no_value

name	4930529C04Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149251327 GeneID:619677 MGI:1922392
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 53 ESTs, 3 Proteins product : RIKEN cDNA 4930529C04 gene transcript_id : XR_034353.1

clone name	MSMg01-125I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502N17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-301E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-538C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194B10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-497E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132P10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-529O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424M14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-124B19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-058F19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-061I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358H13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-387B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298O04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-475H22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-349A02
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-019B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165A23
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-238C22.b	B6Ng01-238C22.g
ACC	GA048944	GA048945
length	993	228
definition	B6Ng01-238C22.b	B6Ng01-238C22.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(90,076,297 - 90,077,290)	(90,266,889 - 90,267,116)
sequence	gaattctttgactcttgtgttgacaaggtaatgggcaatatcccctctgt gagtgccaactgaccagtgagttcctcctacttgtctctgttaccctcag gccactaactgtgtatgtcagtggtgacagcattggctggaatcaggcac agtacaacctgtgcagccatacatggttcgtttacgtttactttcattcc tgactctgcacctccagatagatctctaggactcctttcctatgactgtg tgtctctgggagaagccatcttctgggcaccctggctccctaccttgctc atcatcttaactcttattcttaccgtctgtcctggtccaggttcacccag agcaggagaagcccgaaccaacacccttagtggagctggaggaactatca ggaagtgagctcactgtctttatcacacccccagaggaaccaccagtact ggaaggcagtgagtctactcctcagtactggtaagagggtcttctatcat cctgccccaatgtccaacgcttagctctgtgctaactgtctgcacggtct ctgtccctccagttatgatgggtttccagagctaaaggctgagctatttg agtctcctcaggaacaacagggggccctccctgtgccaggcccatcccgg agtgctcccagcagtcctgcacctcgccgaaccaaacaggtaaccggtgg tgggccttggaggagaacctgacacaagggcggttgcttcatggtcagat caggataaccatggtgcttatcccataaagctgctgggagcttggcacat tacattaaaataaataaattaaaataaaataaataaataaatactgaaca accaggtggttggtggcacatgcctttaatcccagcactcgggaggcaga ggcaggaggatcctctatgagcagccctgatcctacagagtgagttccag gactgccagagctacgtagtgagtccctgtcctcaaaaccaaa	ctgaagcagctaaaactcttggctgacaagaaattcaacttcaccatgga ggatggcctggtaggggggtgggagggcagagggagggtcctatgctcct ccagtgcgcctctccaaaccctaattcatggctctctgatactctagcct gctctctcaggcatcccagcatccagtctcccctttctccctgcctatta tctgtatctctcctgacggtggaggggg
quality values	Open. Hide. 58 26 27 26 58 51 58 58 58 58 25 35 58 58 58 58 58 58 58 58 62 62 41 33 42 54 62 62 54 62 62 47 56 41 19 24 26 26 38 39 54 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 54 62 62 62 62 59 59 62 59 47 62 59 59 44 62 62 62 62 62 62 59 62 35 38 46 62 62 62 59 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 59 59 35 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 59 62 62 59 62 62 59 59 49 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 49 49 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 44 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 56 54 62 62 62 43 62 47 47 62 62 62 62 62 62 56 62 62 62 54 47 62 62 56 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 56 62 62 56 62 56 62 62 62 62 62 56 49 47 42 62 62 62 62 62 48 62 62 52 43 45 62 62 62 62 62 62 62 42 49 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 58 58 49 52 58 54 54 58 58 43 52 58 58 54 58 39 58 58 51 58 58 58 54 41 58 54 49 52 58 58 58 58 58 58 58 58 52 52 54 54 58 52 58 42 54 58 54 54 58 58 42 54 52 58 58 54 58 52 58 58 58 41 54 52 54 58 58 58 58 58 54 52 52 54 52 58 45 54 54 58 58 58 58 49 58 58 58 53 41 39 46 53 45 52 42 49 49 37 58 58 58 51 58 54 58 49 32 50 58 24 58 53 50 58 58 51 58 46 51 50 58 32 58 42 42 50 58 53 50 58 32 51 53 53 52 58 52 52 49 25 58 50 49 52 31 54 52 46 37 19 14 41 49 54 36 33 51 53 58 53 52 58 42 53 41 49 31 31 44 32 58 50 35 50 49 54 49 40 40 39 14 41 51 34 45 34 58 51 50 39 52 53 39 43 52 40 35 51 52 33 50 33 54 50 38 53 58 28 49 21 26 41 35 51 52 35 34 16 49 32 35 42 32 44 31 42 22 52 53 39 47 54 41 32 28 28 24 40 32 27 8 49 54 19 51 41 28 52 39 35 32 22 24 39 37 40 12 54 32 40 26 39 32 37 39 37 37 41 34 24 32 34 37 26 34 34 31 45 37 31 20 25 15 31 29 34 37 26 28 31 40 26 54 37 37 33 42 18 25 33 29 54 34 31 42 31 52 35 31 31 40 37 35 39 29 51 33 34 20 32 32 28 31 53 40 23 40 23 33 23 49 33 12 21 32 32 52 51 31 51 51 40 40 36 26 36 28 24 31 31 37 45 31 46 20 40 45 30 51 31 51 46 51 31 45 25 25 23 41 33 13 12 44 31 43 20 25 31 24 30 27 21 21 35 31 31 10 20 23 33 35 31 22 25 44 21 25 25 23 31 31 31 26 30 42 31 25 29 31 13 46 13 15 11 16 18 29 29 26 17 35 31 22 9 41 30 32 14 41 11 27 16 13 13 21 16 7 13 8 6 10 18 16 21 9 14 30 16 9 8 6 23 20 23 39 24 18 22 20 27 9 23 26 31 16 10 6 31 16 28 33 19 12 31 30 27 13 12 5 6 21 18 21 33 18 18 11 8 30 10 30 11 24 17 6 8 9 5 9 16 28 18 18 19 41 25 27 11 6 10 7 18 21 18 38 29 19 10 7 11 6 8	Open. Hide. 62 59 59 62 43 24 49 39 19 46 49 34 50 46 56 59 59 62 62 62 62 59 62 62 62 59 41 62 59 62 62 62 59 49 62 59 59 62 62 62 62 59 59 62 59 59 62 62 62 59 59 62 54 17 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 51 62 62 42 46 62 17 10 12 19 13 13 10 26 16 23 34 39 36 43 34 11 12 13 14 13 11 23 31 30 13 12 13 18 18 8 38 27 21 23 13 27 11 13 18 34 15 11 26 27 14 24 24 13 28 18 25 10 17 14 18 11 17 13 10 13 23 23 27 35 19 16 12 11 20 13 14 10 13 27 11 16 10 16 23 22 23 12 23 10 17 20 10 13 13 16 16 12 13 11 10 18 13 18 23 23 17 20 18 27 10 21 13 27 14 11 13 18 16 11 18 16 12 10 13 14 12 20 13 18 19 18 19 18 17 11 10 27 16 18 12 22 13 18 8 9 10

Alignment Information

BAC End 1

BAC End 2

seq1: chr3_90076297_90077290
seq2: B6Ng01-238C22.b_46_1038

seq1  GAATTCTTTGACTCTTGTGTTGACAAGGTAATGGGCAATATCCCCTCTGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTGACTCTTGTGTTGACAAGGTAATGGGCAATATCCCCTCTGT  50

seq1  GAGTGCCAACTGACCAGTGAGTTCCTCCTACTTGTCTCTGTTACCCTCAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGCCAACTGACCAGTGAGTTCCTCCTACTTGTCTCTGTTACCCTCAG  100

seq1  GCCACTAACTGTGTATGTCAGTGGTGACAGCATTGGCTGGAATCAGGCAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCACTAACTGTGTATGTCAGTGGTGACAGCATTGGCTGGAATCAGGCAC  150

seq1  AGTACAACCTGTGCAGCCATACATGGTTCGTTTACGTTTACTTTCATTCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTACAACCTGTGCAGCCATACATGGTTCGTTTACGTTTACTTTCATTCC  200

seq1  TGACTCTGCACCTCCAGATAGATCTCTAGGACTCCTTTCCTATGACTGTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTCTGCACCTCCAGATAGATCTCTAGGACTCCTTTCCTATGACTGTG  250

seq1  TGTCTCTGGGAGAAGCCATCTTCTGGGCACCCTGGCTCCCTACCTTGCTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTCTGGGAGAAGCCATCTTCTGGGCACCCTGGCTCCCTACCTTGCTC  300

seq1  ATCATCTTAACTCTTATTCTTACCGTCTGTCCTGGTCCAGGTTCACCCAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCATCTTAACTCTTATTCTTACCGTCTGTCCTGGTCCAGGTTCACCCAG  350

seq1  AGCAGGAGAAGCCCGAACCAACACCCTTAGTGGAGCTGGAGGAACTATCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGGAGAAGCCCGAACCAACACCCTTAGTGGAGCTGGAGGAACTATCA  400

seq1  GGAAGTGAGCTCACTGTCTTTATCACACCCCCAGAGGAACCACCAGTACT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGTGAGCTCACTGTCTTTATCACACCCCCAGAGGAACCACCAGTACT  450

seq1  GGAAGGCAGTGAGTCTACTCCTCAGTACTGGTAAGAGGGTCTTCTATCAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGGCAGTGAGTCTACTCCTCAGTACTGGTAAGAGGGTCTTCTATCAT  500

seq1  CCTGCCCCAATGTCCAACGCTTAGCTCTGTGCTAACTGTCTGCACGGTCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCCCCAATGTCCAACGCTTAGCTCTGTGCTAACTGTCTGCACGGTCT  550

seq1  CTGTCCCTCCAGTTATGATGGGTTTCCAGAGCTAAAGGCTGAGCTATTTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCCCTCCAGTTATGATGGGTTTCCAGAGCTAAAGGCTGAGCTATTTG  600

seq1  AGTCTCCTCAGGAACAACAGGGGGCCCTCCCTGTGCCAGGCCCATCCCGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCTCCTCAGGAACAACAGGGGGCCCTCCCTGTGCCAGGCCCATCCCGG  650

seq1  AGTGCTCCCAGCAGTCCTGCACCTCGCCGAACCAAACAGGTAACCGGTGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGCTCCCAGCAGTCCTGCACCTCGCCGAACCAAACAGGTAACCGGTGG  700

seq1  TGGGCCTTGGAGGAGAACCTGACACAAGGGCGGTTGCTTCATGGTCAGAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCCTTGGAGGAGAACCTGACACAAGGGCGGTTGCTTCATGGTCAGAT  750

seq1  CAGGATAACCATGGTGCTTATCCCATAAAGCTGCTGGGAGCTTGGCACAT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGATAACCATGGTGCTTATCCCATAAAGCTGCTGGGAGCTTGGCACAT  800

seq1  TAACAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATACT  850
      | ||| |||||| ||||||| ||||||||||| |||||||   |||||||
seq2  T-ACATTAAAAT-AAATAAATTAAAATAAAAT-AAATAAA--TAAATACT  845

seq1  GAACAACCAGGT-GTTGGTGGCACATGCCTTTAATCCCAGCACTCGGGAG  899
      |||||||||||| |||||||||||||||||||||||||||||||||||||
seq2  GAACAACCAGGTGGTTGGTGGCACATGCCTTTAATCCCAGCACTCGGGAG  895

seq1  GCAGAGGCAGGAGGAT-CTCTATGAGGCAG-CCTGAT-CTACAGAGTGAG  946
      |||||||||||||||| |||||||| |||| |||||| ||||||||||||
seq2  GCAGAGGCAGGAGGATCCTCTATGA-GCAGCCCTGATCCTACAGAGTGAG  944

seq1  TTCCAAGACTGCCAGAGCTACGTAGTGAGTCCCTGT-CTCAAAAACAAA  994
      ||||| |||||||||||||||||||||||||||||| ||||||| ||||
seq2  TTCCAGGACTGCCAGAGCTACGTAGTGAGTCCCTGTCCTCAAAACCAAA  993

seq1: chr3_90266889_90267116
seq2: B6Ng01-238C22.g_71_298 (reverse)

seq1  CCCCCTCCACCGTCAGGAGAGATACAGATAATAGGCAGGGAGAAAGGGGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCCTCCACCGTCAGGAGAGATACAGATAATAGGCAGGGAGAAAGGGGA  50

seq1  GACTGGATGCTGGGATGCCTGAGAGAGCAGGCTAGAGTAACAGAGAGCCA  100
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  GACTGGATGCTGGGATGCCTGAGAGAGCAGGCTAGAGTATCAGAGAGCCA  100

seq1  TGAATTAGGGTCTGGAGAGGCGCACTGGAGGAGCCTAGGACCCTCCCTCT  150
      ||||||||||| |||||||||||||||||||||| |||||||||||||||
seq2  TGAATTAGGGTTTGGAGAGGCGCACTGGAGGAGCATAGGACCCTCCCTCT  150

seq1  GCCCTCCCACCCCCCTACCAGGCCATCCTCCATGGTGAAGTTGAATTTCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCTCCCACCCCCCTACCAGGCCATCCTCCATGGTGAAGTTGAATTTCT  200

seq1  TGTCAGCCAAGAGTTTTAGCTGCTTCAG  228
      ||||||||||||||||||||||||||||
seq2  TGTCAGCCAAGAGTTTTAGCTGCTTCAG  228

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information