MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-257K10
Chromosome	3 (Build37)
Map Location	87,074,172 - 87,197,359
singlet/doublet	doublet
Overlap gene	Cd5l, Fcrl1
Upstream gene	Lrba, Mab21l2, EG667024, LOC100042319, Dclk2, EG625055, Cd1d2, Cd1d1, LOC667897, Kirrel1, LOC100042355, Msr2
Downstream gene	Fcrl5, Etv3, EG546801, Arhgef11, EG625281, 3110045G13Rik, Ntrk1, Insrr, Sh2d2a, Prcc, Hdgf, Mrpl24, BC023814, Isg20l2, Crabp2, LOC100042242, Nes, Bcan, Hapln2, Gpatc4, Apoa1bp, Ttc24, Iqgap3, Mef2d, AI849053, LOC100042271, LOC100042277, Rhbg, 1700021C14Rik, Cct3, 0610031J06Rik, Tmem79, Smg5, Paqr6, Bglap-rs1, Bglap2, LOC627995, Bglap1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Lrba (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80877 MGI:1933162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Mab21l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23937 MGI:1346022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667024 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667024 MGI:3645910
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042319 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 742 ESTs

name	Dclk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70762 MGI:1918012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625055 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625055 MGI:3646785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 473 ESTs

name	Cd1d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12480 MGI:107675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd1d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12479 MGI:107674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667897 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Kirrel1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170643 MGI:1891396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042355 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 329 ESTs, 7 Proteins

name	Msr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80891 MGI:1933397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd5l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11801 MGI:1334419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcrl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229499 MGI:2442862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Fcrl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329693 MGI:3053558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Etv3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27049 MGI:1350926
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG546801 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546801 MGI:3646099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	Arhgef11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213498 MGI:2441869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625281 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625281 MGI:3644100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 561 ESTs, 5 Proteins

name	3110045G13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73182 MGI:1920432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Ntrk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18211 MGI:97383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 27 ESTs, 30 Proteins

name	Insrr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23920 MGI:1346037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh2d2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27371 MGI:1351596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Prcc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94315 MGI:2137738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdgf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15191 MGI:1194494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67707 MGI:1914957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC023814 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229503 MGI:2387197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Isg20l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229504 MGI:2140076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crabp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12904 MGI:88491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042242 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Nes (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18008 MGI:101784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcan (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12032 MGI:1096385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hapln2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73940 MGI:2137300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpatc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66614 MGI:1913864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apoa1bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246703 MGI:2180167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttc24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214191 MGI:2443841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iqgap3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404710 MGI:3028642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mef2d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17261 MGI:99533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	AI849053 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329697 MGI:2139818
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs

name	LOC100042271 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs

name	LOC100042277 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Rhbg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58176 MGI:1927379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700021C14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76927 MGI:1924177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cct3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12462 MGI:104708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610031J06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56700 MGI:1913318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem79 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71913 MGI:1919163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smg5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229512 MGI:2447364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Paqr6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68957 MGI:1916207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bglap-rs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12095 MGI:88155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bglap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12097 MGI:88157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627995 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 2 Proteins

name	Bglap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12096 MGI:88156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Lrba (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117956398 GeneID:80877 MGI:1933162
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LPS-responsive beige-like anchor transcript_id : NM_030695.2

name	Lrba (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117956396 GeneID:80877 MGI:1933162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LPS-responsive beige-like anchor transcript_id : NM_001077688.1

name	Lrba (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117956394 GeneID:80877 MGI:1933162
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LPS-responsive beige-like anchor transcript_id : NM_001077687.1

name	Mab21l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801523 GeneID:23937 MGI:1346022
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mab-21-like 2 (C. elegans) transcript_id : NM_011839.3

name	EG667024 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369608 GeneID:667024 MGI:3645910
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG667024 transcript_id : XM_994645.1

name	LOC100042319 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251257 GeneID:100042319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 742 ESTs product : hypothetical protein LOC100042319 transcript_id : XM_001477737.1

name	Dclk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254280 GeneID:70762 MGI:1918012
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : doublecortin-like kinase 2 transcript_id : NM_027539.3

name	EG625055 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369611 GeneID:625055 MGI:3646785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 473 ESTs product : predicted gene, EG625055, transcript variant 3 transcript_id : XM_899463.2

name	Cd1d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665732 GeneID:12480 MGI:107675
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD1d2 antigen transcript_id : NM_007640.2

name	Cd1d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227231 GeneID:12479 MGI:107674
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD1d1 antigen transcript_id : NM_007639.2

name	Kirrel1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70608145 GeneID:170643 MGI:1891396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kin of IRRE like 1 (Drosophila) transcript_id : NM_130867.2

name	LOC100042355 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251262 GeneID:100042355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 295 ESTs, 7 Proteins product : similar to ubiquitin-conjugating enzyme UbcH7, transcript variant 2 transcript_id : XM_001477899.1

name	LOC100042355 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251260 GeneID:100042355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 328 ESTs, 7 Proteins product : similar to ubiquitin-conjugating enzyme UbcH7, transcript variant 1 transcript_id : XM_001477887.1

name	Msr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802355 GeneID:80891 MGI:1933397
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage scavenger receptor 2 transcript_id : NM_030707.2

name	Cd5l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753091 GeneID:11801 MGI:1334419
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD5 antigen-like transcript_id : NM_009690.1

name	Fcrl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802130 GeneID:229499 MGI:2442862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor-like 1 transcript_id : NM_178165.3

name	Fcrl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346512 GeneID:229499 MGI:2442862
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor-like 1 transcript_id : NM_153090.1

name	Fcrl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51510888 GeneID:329693 MGI:3053558
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor-like 5 transcript_id : NM_183222.2

name	Etv3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031940 GeneID:27049 MGI:1350926
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ets variant gene 3 transcript_id : NM_001083318.1

name	Etv3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032020 GeneID:27049 MGI:1350926
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ets variant gene 3 transcript_id : NM_012051.3

name	EG546801 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369689 GeneID:546801 MGI:3646099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG546801 transcript_id : XM_621583.3

name	Arhgef11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491849 GeneID:213498 MGI:2441869
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho guanine nucleotide exchange factor (GEF) 11 transcript_id : NM_001003912.1

name	EG625281 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369626 GeneID:625281 MGI:3644100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 561 ESTs, 5 Proteins product : predicted gene, EG625281 transcript_id : XM_891806.2

name	3110045G13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74096454 GeneID:73182 MGI:1920432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110045G13 gene transcript_id : NM_001032414.1

name	3110045G13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74096452 GeneID:73182 MGI:1920432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110045G13 gene transcript_id : NM_001032413.1

name	3110045G13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74096450 GeneID:73182 MGI:1920432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110045G13 gene transcript_id : NM_152799.2

name	3110045G13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74096449 GeneID:73182 MGI:1920432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110045G13 gene transcript_id : NM_028460.2

name	Ntrk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369628 GeneID:18211 MGI:97383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 24 Proteins product : neurotrophic tyrosine kinase, receptor, type 1, transcript variant 4 transcript_id : XM_899803.2

name	Ntrk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369627 GeneID:18211 MGI:97383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 26 ESTs, 29 Proteins product : neurotrophic tyrosine kinase, receptor, type 1, transcript variant 1 transcript_id : XM_283871.3

name	Insrr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754361 GeneID:23920 MGI:1346037
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin receptor-related receptor transcript_id : NM_011832.1

name	Sh2d2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70980555 GeneID:27371 MGI:1351596
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH2 domain protein 2A transcript_id : NM_021309.2

name	Sh2d2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909333 GeneID:27371 MGI:1351596
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH2 domain protein 2A transcript_id : NM_001025571.1

name	Prcc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15809011 GeneID:94315 MGI:2137738
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : papillary renal cell carcinoma (translocation-associated) transcript_id : NM_033573.1

name	Hdgf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365231 GeneID:15191 MGI:1194494
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hepatoma-derived growth factor transcript_id : NM_008231.3

name	Mrpl24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802057 GeneID:67707 MGI:1914957
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L24 transcript_id : NM_026591.2

name	BC023814 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369717 GeneID:229503 MGI:2387197
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC023814 transcript_id : NM_153562.3

name	Isg20l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802183 GeneID:229504 MGI:2140076
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon stimulated exonuclease gene 20-like 2 transcript_id : NM_177663.3

name	Crabp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131164 GeneID:12904 MGI:88491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cellular retinoic acid binding protein II transcript_id : NM_007759.2

name	Nes (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50363231 GeneID:18008 MGI:101784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nestin transcript_id : NM_016701.3

name	Bcan (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6671617 GeneID:12032 MGI:1096385
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brevican transcript_id : NM_007529.1

name	Hapln2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15042970 GeneID:73940 MGI:2137300
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hyaluronan and proteoglycan link protein 2 transcript_id : NM_022031.1

name	Gpatc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754123 GeneID:66614 MGI:1913864
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G patch domain containing 4 transcript_id : NM_025663.2

name	Apoa1bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350977 GeneID:246703 MGI:2180167
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein A-I binding protein transcript_id : NM_144897.2

name	Ttc24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802766 GeneID:214191 MGI:2443841
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetratricopeptide repeat domain 24 transcript_id : NM_172526.2

name	Iqgap3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118344445 GeneID:404710 MGI:3028642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IQ motif containing GTPase activating protein 3 transcript_id : NM_001033484.1

name	Mef2d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430771 GeneID:17261 MGI:99533
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : myocyte enhancer factor 2D transcript_id : NM_133665.2

name	AI849053 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251247 GeneID:329697 MGI:2139818
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs product : expressed sequence AI849053 transcript_id : XM_001477832.1

name	LOC100042271 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251253 GeneID:100042271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs product : hypothetical protein LOC100042271 transcript_id : XM_001477849.1

name	LOC100042277 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251255 GeneID:100042277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100042277 transcript_id : XM_001477866.1

name	Rhbg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362534 GeneID:58176 MGI:1927379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rhesus blood group-associated B glycoprotein transcript_id : NM_021375.3

name	1700021C14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362413 GeneID:76927 MGI:1924177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700021C14 gene transcript_id : NM_029801.2

name	Cct3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753319 GeneID:12462 MGI:104708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chaperonin subunit 3 (gamma) transcript_id : NM_009836.1

name	0610031J06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910457 GeneID:56700 MGI:1913318
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610031J06 gene transcript_id : NM_020003.1

name	Tmem79 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343983 GeneID:71913 MGI:1919163
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 79 transcript_id : NM_024246.4

name	Smg5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807192 GeneID:229512 MGI:2447364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) transcript_id : NM_178246.3

name	Paqr6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354662 GeneID:68957 MGI:1916207
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : progestin and adipoQ receptor family member VI transcript_id : NM_198410.2

name	Bglap-rs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83776590 GeneID:12095 MGI:88155
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone gamma-carboxyglutamate protein, related sequence 1 transcript_id : NM_031368.3

name	Bglap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816951 GeneID:12097 MGI:88157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone gamma-carboxyglutamate protein 2 transcript_id : NM_001032298.2

name	LOC627995 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94369697 GeneID:627995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 2 Proteins product : similar to progestin and adipoQ receptor family member VI transcript_id : XM_892711.2

name	Bglap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816949 GeneID:12096 MGI:88156
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone gamma carboxyglutamate protein 1 transcript_id : NM_007541.2

name	Bglap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816946 GeneID:12096 MGI:88156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone gamma carboxyglutamate protein 1 transcript_id : NM_001037939.1

name	Lrba (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117956399 GeneID:80877 MGI:1933162
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0051018 - protein kinase A binding [Evidence ISS] GO_process : GO:0016197 - endosome transport [Evidence TAS]; GO:0008104 - protein localization [Evidence ISS]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 note : isoform alpha is encoded by transcript variant 1 product : LPS-responsive beige-like anchor isoform alpha protein_id : NP_109620.2

name	Lrba (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117956397 GeneID:80877 MGI:1933162
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0051018 - protein kinase A binding [Evidence ISS] GO_process : GO:0016197 - endosome transport [Evidence TAS]; GO:0008104 - protein localization [Evidence ISS]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 note : isoform beta is encoded by transcript variant 2 product : LPS-responsive beige-like anchor isoform beta protein_id : NP_001071156.1

name	Lrba (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117956395 GeneID:80877 MGI:1933162
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0051018 - protein kinase A binding [Evidence ISS] GO_process : GO:0016197 - endosome transport [Evidence TAS]; GO:0008104 - protein localization [Evidence ISS]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 note : isoform gamma is encoded by transcript variant 3 product : LPS-responsive beige-like anchor isoform gamma protein_id : NP_001071155.1

name	Mab21l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560522 CCDS:CCDS17447.1 GeneID:23937 MGI:1346022
definition	GO_process : GO:0010172 - embryonic body morphogenesis [Evidence IMP]; GO:0001747 - eye development (sensu Mammalia) [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP] codon_start : 1 product : mab-21-like 2 protein_id : NP_035969.2

name	EG667024 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369609 GeneID:667024 MGI:3645910
definition	codon_start : 1 product : hypothetical protein protein_id : XP_999739.1

name	LOC100042319 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251258 GeneID:100042319
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477787.1

name	Dclk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254281 CCDS:CCDS17448.1 GeneID:70762 MGI:1918012
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : doublecortin and CaM kinase-like 2 product : doublecortin-like kinase 2 protein_id : NP_081815.3

name	EG625055 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82890069 GeneID:625055 MGI:3646785
definition	codon_start : 1 product : similar to hCG2016250, isoform 3 protein_id : XP_904556.1

name	Cd1d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110665733 GeneID:12480 MGI:107675
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003823 - antigen binding [Evidence IEA]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0048006 - antigen processing and presentation, endogenous lipid antigen via MHC class Ib [Evidence ISS]; GO:0016045 - detection of bacterium [Evidence ISS]; GO:0045089 - positive regulation of innate immune response [Evidence ISS]; GO:0045086 - positive regulation of interleukin-2 biosynthesis [Evidence IDA]; GO:0045404 - positive regulation of interleukin-4 biosynthesis [Evidence IDA]; GO:0051135 - positive regulation of NK T cell activation [Evidence IDA]; GO:0001916 - positive regulation of T cell mediated cytotoxicity [Evidence IDA]; GO:0045058 - T cell selection [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy note : T-cell surface glycoprotein CD1d2 product : CD1d2 antigen protein_id : NP_031666.2

name	Cd1d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671706 CCDS:CCDS17449.1 GeneID:12479 MGI:107674
definition	GO_component : GO:0005769 - early endosome [Evidence IDA]; GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0005770 - late endosome [Evidence IDA]; GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003823 - antigen binding [Evidence IEA]; GO:0030883 - endogenous lipid antigen binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS] GO_process : GO:0019882 - antigen processing and presentation [Evidence IDA]; GO:0048006 - antigen processing and presentation, endogenous lipid antigen via MHC class Ib [Evidence ISS]; GO:0048007 - antigen processing and presentation, exogenous lipid antigen via MHC class Ib [Evidence IDA]; GO:0016045 - detection of bacterium [Evidence ISS]; GO:0045089 - positive regulation of innate immune response [Evidence ISS]; GO:0045078 - positive regulation of interferon-gamma biosynthesis [Evidence IMP]; GO:0045086 - positive regulation of interleukin-2 biosynthesis [Evidence IDA]; GO:0045404 - positive regulation of interleukin-4 biosynthesis [Evidence IMP] [Evidence IDA]; GO:0051135 - positive regulation of NK T cell activation [Evidence IDA]; GO:0051138 - positive regulation of NK T cell differentiation [Evidence IMP]; GO:0001916 - positive regulation of T cell mediated cytotoxicity [Evidence IDA]; GO:0045059 - positive thymic T cell selection [Evidence IMP]; GO:0050776 - regulation of immune response [Evidence IMP]; GO:0045058 - T cell selection [Evidence ISS] codon_start : 1 exception : mismatches in translation product : CD1d1 antigen protein_id : NP_031665.1

name	Kirrel1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608146 CCDS:CCDS17450.1 GeneID:170643 MGI:1891396
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007588 - excretion [Evidence IMP] codon_start : 1 note : nephrin 1 product : X kin of IRRE like 1 protein_id : NP_570937.2

name	LOC100042355 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251261 GeneID:100042355
definition	codon_start : 1 product : similar to ubiquitin-conjugating enzyme UbcH7 isoform 1 protein_id : XP_001477937.1

name	LOC100042355 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251263 GeneID:100042355
definition	codon_start : 1 product : similar to ubiquitin-conjugating enzyme UbcH7 isoform 2 protein_id : XP_001477949.1

name	Msr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13540505 GeneID:80891 MGI:1933397
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : immunoglobulin scavenger receptor product : macrophage scavenger receptor 2 protein_id : NP_109632.1

name	Cd5l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753092 CCDS:CCDS17451.1 GeneID:11801 MGI:1334419
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005044 - scavenger receptor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : apoptosis inhibitory 6; AIM/Spalpha; apoptosis inhibitor 6 product : CD5 antigen-like protein_id : NP_033820.1

name	Fcrl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346513 CCDS:CCDS17452.1 GeneID:229499 MGI:2442862
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : BXMAS1-like protein 1; BXMAS1-like protein 1b product : Fc receptor-like protein 1 protein_id : NP_694730.1

name	Fcrl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30039686 CCDS:CCDS17452.1 GeneID:229499 MGI:2442862
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : BXMAS1-like protein 1; BXMAS1-like protein 1b product : Fc receptor-like protein 1 protein_id : NP_835459.1

name	Fcrl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51510889 GeneID:329693 MGI:3053558
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : BXMAS1-like protein 2; Fc receptor-like protein 3 product : Fc receptor-like protein 5 protein_id : NP_899045.2

name	Etv3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134031941 GeneID:27049 MGI:1350926
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0017053 - transcriptional repressor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : ETS-domain transcriptional repressor; mitogenic Ets transcriptional suppressor METS; ETS-domain protein product : ets variant gene 3 protein_id : NP_001076787.1

name	Etv3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134032021 CCDS:CCDS17453.1 GeneID:27049 MGI:1350926
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0017053 - transcriptional repressor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : ETS-domain transcriptional repressor; mitogenic Ets transcriptional suppressor METS; ETS-domain protein product : ets variant gene 3 protein_id : NP_036181.3

name	EG546801 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369690 GeneID:546801 MGI:3646099
definition	codon_start : 1 product : hypothetical protein protein_id : XP_621583.3

name	Arhgef11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51491850 GeneID:213498 MGI:2441869
definition	GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 product : Rho guanine nucleotide exchange factor (GEF) 11 protein_id : NP_001003912.1

name	EG625281 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82890078 GeneID:625281 MGI:3644100
definition	codon_start : 1 product : similar to ribosomal protein L30 protein_id : XP_896899.1

name	3110045G13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74096453 GeneID:73182 MGI:1920432
definition	codon_start : 1 note : Jedi product : platelet endothelial aggregation receptor 1 protein_id : NP_001027585.1

name	3110045G13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74096455 GeneID:73182 MGI:1920432
definition	codon_start : 1 note : Jedi product : platelet endothelial aggregation receptor 1 protein_id : NP_001027586.1

name	3110045G13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22779881 GeneID:73182 MGI:1920432
definition	codon_start : 1 note : Jedi product : platelet endothelial aggregation receptor 1 protein_id : NP_082736.1

name	3110045G13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74096451 GeneID:73182 MGI:1920432
definition	codon_start : 1 note : Jedi product : platelet endothelial aggregation receptor 1 protein_id : NP_690012.2

name	Ntrk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82890086 GeneID:18211 MGI:97383
definition	codon_start : 1 product : neurotrophic tyrosine kinase, receptor, type 1 isoform 4 protein_id : XP_904896.1

name	Ntrk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28491899 GeneID:18211 MGI:97383
definition	codon_start : 1 product : neurotrophic tyrosine kinase, receptor, type 1 isoform 1 protein_id : XP_283871.1

name	Insrr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754362 CCDS:CCDS17454.1 GeneID:23920 MGI:1346037
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005006 - epidermal growth factor receptor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0030238 - male sex determination [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation product : insulin receptor-related receptor protein_id : NP_035962.1

name	Sh2d2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11496243 GeneID:27371 MGI:1351596
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005070 - SH3/SH2 adaptor activity [Evidence ISS] GO_process : GO:0008283 - cell proliferation [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Lck-associated adapter protein; Rlk/Itk-binding protein product : SH2 domain protein 2A isoform 1 protein_id : NP_067284.1

name	Sh2d2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70909334 CCDS:CCDS17455.1 GeneID:27371 MGI:1351596
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005070 - SH3/SH2 adaptor activity [Evidence ISS] GO_process : GO:0008283 - cell proliferation [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Lck-associated adapter protein; Rlk/Itk-binding protein product : SH2 domain protein 2A isoform 2 protein_id : NP_001020742.1

name	Prcc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15809012 CCDS:CCDS17456.1 GeneID:94315 MGI:2137738
definition	codon_start : 1 product : papillary renal cell carcinoma translocation-associated gene product protein_id : NP_291051.1

name	Hdgf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560691 CCDS:CCDS17457.1 GeneID:15191 MGI:1194494
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0008083 - growth factor activity [Evidence IEA] [Evidence ISS]; GO:0008201 - heparin binding [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IDA] codon_start : 1 exception : mismatches in translation product : hepatoma-derived growth factor protein_id : NP_032257.2

name	Mrpl24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311903 GeneID:67707 MGI:1914957
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mitochondrial ribosomal protein L24 protein_id : NP_080867.1

name	BC023814 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559899 CCDS:CCDS17458.1 GeneID:229503 MGI:2387197
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC229503 protein_id : NP_705790.2

name	Isg20l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244084 CCDS:CCDS17459.1 GeneID:229504 MGI:2140076
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA] codon_start : 1 product : interferon stimulated exonuclease gene 20-like 2 protein_id : NP_808331.1

name	Crabp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469075 CCDS:CCDS17460.1 GeneID:12904 MGI:88491
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0030332 - cyclin binding [Evidence ISS]; GO:0008289 - lipid binding [Evidence IEA]; GO:0016918 - retinal binding [Evidence IEA]; GO:0001972 - retinoic acid binding [Evidence IDA] GO_process : GO:0035115 - embryonic forelimb morphogenesis [Evidence IMP]; GO:0042573 - retinoic acid metabolism [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : cellular retinoic acid binding protein II protein_id : NP_031785.1

name	Nes (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50363232 CCDS:CCDS17461.1 GeneID:18008 MGI:101784
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005882 - intermediate filament [Evidence IEA] GO_process : GO:0007399 - nervous system development [Evidence IDA] codon_start : 1 note : intermediate filament protein product : nestin protein_id : NP_057910.3

name	Bcan (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671618 CCDS:CCDS17462.1 GeneID:12032 MGI:1096385
definition	GO_function : GO:0005540 - hyaluronic acid binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation product : brevican protein_id : NP_031555.1

name	Hapln2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15042971 CCDS:CCDS17463.1 GeneID:73940 MGI:2137300
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005540 - hyaluronic acid binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : hyaluronan and proteoglycan link protein 2 protein_id : NP_071314.1

name	Gpatc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754124 GeneID:66614 MGI:1913864
definition	codon_start : 1 exception : mismatches in translation product : G patch domain containing 4 protein_id : NP_079939.2

name	Apoa1bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553309 CCDS:CCDS17464.1 GeneID:246703 MGI:2180167
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 function : apoA-I interacting protein note : apolipoprotein A-I interacting protein; apoA-I binding protein product : apolipoprotein A-I binding protein protein_id : NP_659146.1

name	Ttc24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369736 CCDS:CCDS17465.1 GeneID:214191 MGI:2443841
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : tetratricopeptide repeat domain 24 protein_id : NP_766114.1

name	Iqgap3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118344446 GeneID:404710 MGI:3028642
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005099 - Ras GTPase activator activity [Evidence IEA] GO_process : GO:0046580 - negative regulation of Ras protein signal transduction [Evidence IEA]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : IQ motif containing GTPase activating protein 3 protein_id : NP_001028656.1

name	Mef2d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526812 GeneID:17261 MGI:99533
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : myocyte enhancer factor 2D protein_id : NP_598426.1

name	AI849053 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251248 GeneID:329697 MGI:2139818
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477882.1

name	LOC100042271 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251254 GeneID:100042271
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477899.1

name	LOC100042277 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251256 GeneID:100042277
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477916.1

name	Rhbg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981136 CCDS:CCDS17466.1 GeneID:58176 MGI:1927379
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] codon_start : 1 note : Rh type B glycoprotein product : Rhesus blood group-associated B glycoprotein protein_id : NP_067350.2

name	1700021C14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113199759 CCDS:CCDS17467.1 GeneID:76927 MGI:1924177
definition	codon_start : 1 product : SSTK-interacting protein protein_id : NP_084077.1

name	Cct3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753320 CCDS:CCDS17468.1 GeneID:12462 MGI:104708
definition	GO_component : GO:0005832 - chaperonin-containing T-complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0044267 - cellular protein metabolism [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 function : CCT is a molecular chaperone which assists the folding of proteins in eukaryotic cytosol product : chaperonin subunit 3 (gamma) protein_id : NP_033966.1

name	0610031J06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910458 CCDS:CCDS17469.1 GeneID:56700 MGI:1913318
definition	codon_start : 1 product : kidney predominant protein NCU-G1 protein_id : NP_064387.1

name	Tmem79 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17511437 CCDS:CCDS17470.1 GeneID:71913 MGI:1919163
definition	codon_start : 1 product : hypothetical protein LOC71913 protein_id : NP_077208.1

name	Smg5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112807193 GeneID:229512 MGI:2447364
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0051721 - protein phosphatase 2A binding [Evidence ISS] GO_process : GO:0000184 - mRNA catabolism, nonsense-mediated decay [Evidence IEA] [Evidence ISS]; GO:0006406 - mRNA export from nucleus [Evidence ISS]; GO:0035303 - regulation of dephosphorylation [Evidence ISS]; GO:0006445 - regulation of translation [Evidence ISS] codon_start : 1 product : Est1p-like protein B protein_id : NP_839977.2

name	Paqr6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38259190 CCDS:CCDS17471.1 GeneID:68957 MGI:1916207
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : progestin and adipoQ receptor family member VI protein_id : NP_940802.1

name	Bglap-rs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42475948 CCDS:CCDS17472.1 GeneID:12095 MGI:88155
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0001503 - ossification [Evidence IEA]; GO:0030500 - regulation of bone mineralization [Evidence IEA] codon_start : 1 exception : mismatches in translation product : bone gamma-carboxyglutamate protein, related sequence 1 protein_id : NP_112736.2

name	Bglap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83816952 CCDS:CCDS17473.1 GeneID:12097 MGI:88157
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0001503 - ossification [Evidence IEA]; GO:0030500 - regulation of bone mineralization [Evidence IEA] codon_start : 1 note : osteocalcin; bone Gla protein product : bone gamma-carboxyglutamate protein 2 protein_id : NP_001027469.2

name	LOC627995 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82890264 GeneID:627995
definition	codon_start : 1 product : similar to progestin and adipoQ receptor family member VI protein_id : XP_897804.1

name	Bglap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671634 CCDS:CCDS17474.1 GeneID:12096 MGI:88156
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0001503 - ossification [Evidence IEA]; GO:0030500 - regulation of bone mineralization [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; osteocalcin; bone Gla protein product : bone gamma carboxyglutamate protein 1 isoform 1 protein_id : NP_031567.1

name	Bglap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83816947 GeneID:12096 MGI:88156
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0001503 - ossification [Evidence IEA]; GO:0030500 - regulation of bone mineralization [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; osteocalcin; bone Gla protein product : bone gamma carboxyglutamate protein 1 isoform 2 protein_id : NP_001033028.1

name	LOC667897 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667897
definition	number : 1 pseudo : _no_value

name	LOC100042242 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042242
definition	number : 1 pseudo : _no_value

name	LOC100042242 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042242
definition	number : 2 pseudo : _no_value

clone name	MSMg01-306J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435G22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-299G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337J22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-323E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143A16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-060B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434P18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-368A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402M07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-351J21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-315F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364N01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-147P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348G21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-460F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435I02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-425P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264L18
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-257K10.b	B6Ng01-257K10.g
ACC	GA063295	GA063296
length	835	1,087
definition	B6Ng01-257K10.b	B6Ng01-257K10.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(87,074,172 - 87,075,006)	(87,196,270 - 87,197,359)
sequence	gaattctctttcttcttaaggctgaataatgttctgctgtgtgtaggtat acacgtatgtgccatgttttatccattcatgacttgctaaatactttggt tgcatcttcccccttaatgagaacaacaaataccaagaacaatggcgatg acctataatgctgtgggtttatgaggccccagtggctaacagctgcaaag gaggcaactcattcctggcacgtgactcttggtagggatagggtatccct acatattctcctacggtggagttataaggtaactccatttaagctacttt tgtatgtatatattttagaaagatactgagaacctatctcaaagacccta gggaagaacttactattattttgctaagtggacataatattaaactgatt tctaatgacttatcaccatgcccataggccagtctatctcttaaccctca tctgagaagtttcttttagcagtagatgatcaacacagaaactcacaact ggtcaatgtacagagagtaagagactgagaagtgtttagttctggtgtat atcatctatctatatcacacccttccttctgagggttaggggacagaaag aatataaaagccagaggtggcagatgactatggtgagatagggtttcctg gacacagcagagcagttaacacctgtgaacttgtagtagctgtaacaaaa tatgccagacttgtgcaagccaatcagacaaaaaatgagcatggataggg caggtgcgcaaaaagtcccatccctagctgaggggcactgccaattgata gcctctgtgagaggaagagttaattttatttaaag	gaattcctgctgcctcctgagagaacccaatattggacccctccaagcta gctctggcctcaaagaaagagtgtcagctaaactagcacaggtggggatc tctcccagtgtctcttgtttcctaaacttcttcagtggaagatcccaaag cgtctctatttgatgtatcacctcggacagacgactctaaccactggcta agaggatgttcatactgaagccatgcaacaattagtccaggttcatcaac aaataaattcaccaaataagcacctatacttccaggtaccaaagacatga aacgtctccaaaagagggatggcaagactttacacgtgtcaggaggacct aagtctcaacttcttttaatcctggtaaatattacaggctggataaaggc tttttcatgtaaaatgtgaaagactccaggcaggaggactgggctagagt aatcccagacatgaaagatagcttccagggtcttactgaaggctgtgtag aaggagatactatcaatgtgaagaatacatttttgtttgtttttgagaca gggtttctctgcatagccctggctatgctggaactcactctatagaccag actggcctggaatctggagatccccctgcctctgcctctgagtgctggaa cgaaaggggtgtgccaccactgcctgatgaatacttttgttttcaatgtg atgcatccatgacatattgttcttcttgcctcactgaagtccatactagc agatcaagacttggtaaaaaaattcatcctgcatttggatgtttgatatt taaaagtaatatatgcagtggcttagacagatactgtttctgtaaatcag gaagatgggcaagtactttagctctctgggttttgcttatttttgttttg tagatcaaactgaggcattgaacctgctgaacaagttcaatttcagagcc aaattcccaaaccctctgatttattctataagtctttactgttgttgttt tttaatctaaaagacaaaatttgcatctttgaaaataaaataaaaaatga aaaggcaagactttatgtaagaaactagtataataaa
quality values	Open. Hide. 46 47 28 37 62 62 62 62 62 62 62 62 62 62 62 62 54 56 59 62 59 59 62 62 62 62 62 62 62 59 59 62 51 56 29 32 30 43 49 50 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 54 49 42 49 54 54 59 59 62 62 59 59 62 62 54 62 62 62 62 62 59 62 49 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 59 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 42 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 54 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 38 58 58 49 58 58 54 49 58 58 54 52 58 54 58 58 58 54 58 49 42 54 58 52 58 58 58 58 58 53 47 58 58 41 58 52 58 58 50 58 50 54 49 58 51 34 58 49 53 51 49 41 58 58 42 58 39 53 52 58 46 46 58 48 51 58 54 58 49 51 52 50 50 49 52 58 58 52 58 30 51 54 46 58 36 32 58 50 50 58 58 51 58 53 58 58 50 50 51 51 52 42 53 32 50 53 34 58 51 58 50 50 58 40 23 58 58 39 52 52 41 58 50 52 32 50 58 21 54 54 53 53 53 53 52 50 40 52 45 34 33 53 53 45 35 39 34 29 54 54 54 54 35 35 53 54 37 49 29 31 46 26 21 33 53 54 54 51 35 37 17 46 33 52 52 45 53 42 54 54 54 49 33 42 52 54 54 31 45 40 49 33 39 35 25 52 32 33 33 13 49 49 40 31 31 32 32 39 35 53 33 52 45 45 40 32 32 32 29 38 45 41 42 31 45 32 33 38 25 38 23 27 30 42 31 38 18 38 31 30 34 18 46 51 30 29 31 51 28 23 46 24 25	Open. Hide. 62 47 51 47 62 62 62 62 62 62 62 59 51 46 45 50 50 45 28 35 44 59 62 62 62 59 62 59 62 56 62 62 62 62 62 54 59 62 62 62 62 62 62 59 51 62 62 62 59 62 62 59 62 54 54 54 62 62 62 62 62 56 56 59 59 62 62 62 49 54 59 62 62 59 59 51 59 62 54 62 62 62 62 59 59 62 62 62 62 62 62 62 54 54 62 62 62 54 62 62 62 62 62 62 62 62 62 59 59 59 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 54 54 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 47 47 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 48 62 58 58 58 58 58 58 54 58 58 54 58 58 58 54 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 52 58 50 54 54 58 58 58 58 58 54 58 58 58 58 58 54 54 52 52 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 58 58 50 54 58 58 58 51 51 54 49 58 47 53 49 51 58 49 58 58 58 50 58 58 51 40 58 50 58 51 58 58 58 53 45 49 52 51 58 58 58 58 58 52 58 51 51 54 54 53 51 58 51 51 51 51 58 31 50 52 53 54 58 50 58 41 43 50 58 58 42 51 58 58 58 50 58 52 52 49 53 32 28 58 50 44 46 54 51 39 49 58 58 41 51 58 51 38 52 52 53 58 58 53 53 41 58 58 51 41 42 42 40 58 40 53 53 49 51 45 37 53 45 49 28 50 54 33 37 39 52 53 45 39 54 40 42 53 45 41 50 51 37 50 35 51 37 42 39 40 41 51 52 53 37 42 41 40 32 45 39 51 47 53 37 53 41 33 35 24 33 20 52 40 52 33 36 33 51 54 30 38 54 54 54 54 54 40 52 45 39 32 52 41 53 31 45 35 40 37 53 52 45 31 31 25 39 29 53 46 36 42 28 32 32 53 34 32 52 53 52 28 32 45 39 31 30 30 24 33 51 31 31 37 31 33 19 23 51 21 30 13 42 33 36 30 30 33 26 31 32 51 18 51 31 32 29 42 33 32 51 24 30 32 21 15 42 18 25 16 29 17 31 46 43 31 27 31 24 27 20 28 31 48 31 31 30 42 32 30 31 38 32 42 48 43 17 48 41 30 24 29 30 22 30 39 46 46 39 27 29 20 38 23 25 31 25 38 22 30 21 34 32 48 31 25 31 36 32 17 41 26 31 21 36 29 18 21 17 38 33 38 34 28 33 26 7 10 19 28 9 23 21 26 21 21 35 48 31 32 24 11 38 17 21 20 30 37 25 17 30 34 48 20 18 36 12 13 34 24 11 23 14 17 34 21 48 22 20 26 6 20 10 15 14 13 33 14 9 7 20 37 19 7 21 21 33 12 7 30 32 14 11 26 43 43 43 48 34 10 21 6 15 15 25 34 31 7 6 14 6 6 29 21 9 22 34 28 22 14 3 3 5 11 16 23 11 27 19 32 15 6 9 21 47 4 5 5 29 34 30 28 9 7 10 16 40 47 18 15 9 4 9 6 7 6 18 10 29 8 27 5 7 5 4 4 13 16 30 8 14 14 8 6 3 3 6 7 15 10 7 17 20

Alignment Information

BAC End 1

BAC End 2

seq1: chr3_87074172_87075006
seq2: B6Ng01-257K10.b_45_879

seq1  GAATTCTCTTTCTTCTTAAGGCTGAATAATGTTCTGCTGTGTGTAGGTAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTTTCTTCTTAAGGCTGAATAATGTTCTGCTGTGTGTAGGTAT  50

seq1  ACACGTATGTGCCATGTTTTATCCATTCATGACTTGCTAAATACTTTGGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACGTATGTGCCATGTTTTATCCATTCATGACTTGCTAAATACTTTGGT  100

seq1  TGCATCTTCCCCCTTAATGAGAACAACAAATACCAAGAACAATGGCGATG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCATCTTCCCCCTTAATGAGAACAACAAATACCAAGAACAATGGCGATG  150

seq1  ACCTATAATGCTGTGGGTTTATGAGGCCCCAGTGGCTAACAGCTGCAAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTATAATGCTGTGGGTTTATGAGGCCCCAGTGGCTAACAGCTGCAAAG  200

seq1  GAGGCAACTCATTCCTGGCACGTGACTCTTGGTAGGGATAGGGTATCCCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGCAACTCATTCCTGGCACGTGACTCTTGGTAGGGATAGGGTATCCCT  250

seq1  ACATATTCTCCTACGGTGGAGTTATAAGGTAACTCCATTTAAGCTACTTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATATTCTCCTACGGTGGAGTTATAAGGTAACTCCATTTAAGCTACTTT  300

seq1  TGTATGTATATATTTTAGAAAGATACTGAGAACCTATCTCAAAGACCCTA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATGTATATATTTTAGAAAGATACTGAGAACCTATCTCAAAGACCCTA  350

seq1  GGGAAGAACTTACTATTATTTTGCTAAGTGGACATAATATTAAACTGATT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAAGAACTTACTATTATTTTGCTAAGTGGACATAATATTAAACTGATT  400

seq1  TCTAATGACTTATCACCATGCCCATAGGCCAGTCTATCTCTTAACCCTCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAATGACTTATCACCATGCCCATAGGCCAGTCTATCTCTTAACCCTCA  450

seq1  TCTGAGAAGTTTCTTTTAGCAGTAGATGATCAACACAGAAACTCACAACT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGAGAAGTTTCTTTTAGCAGTAGATGATCAACACAGAAACTCACAACT  500

seq1  GGTCAATGTACAGAGAGTAAGAGACTGAGAAGTGTTTAGTTCTGGTGTAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCAATGTACAGAGAGTAAGAGACTGAGAAGTGTTTAGTTCTGGTGTAT  550

seq1  ATCATCTATCTATATCACACCCTTCCTTCTGAGGGTTAGGGGACAGAAAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCATCTATCTATATCACACCCTTCCTTCTGAGGGTTAGGGGACAGAAAG  600

seq1  AATATAAAAGCCAGAGGTGGCAGATGACTATGGTGAGATAGGGTTTCCTG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATATAAAAGCCAGAGGTGGCAGATGACTATGGTGAGATAGGGTTTCCTG  650

seq1  GACACAGCAGAGCAGTTAACACCTGTGAACTTGTAGTAGCTGTAACAAAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACACAGCAGAGCAGTTAACACCTGTGAACTTGTAGTAGCTGTAACAAAA  700

seq1  TATGCCAGACTTGTGCAAGCCAATCAGACAAAAAATGAGCATGGATAGGG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGCCAGACTTGTGCAAGCCAATCAGACAAAAAATGAGCATGGATAGGG  750

seq1  CAGGTGCGCAAAAAGTCCCATCCCTAGCTGAGGGGCACTGCCAATTGATA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGTGCGCAAAAAGTCCCATCCCTAGCTGAGGGGCACTGCCAATTGATA  800

seq1  GCCTCTGTGAGAGGAAGAGTTAATTTTATTTAAAG  835
      |||||||||||||||||||||||||||||||||||
seq2  GCCTCTGTGAGAGGAAGAGTTAATTTTATTTAAAG  835

seq1: chr3_87196270_87197359
seq2: B6Ng01-257K10.g_68_1154 (reverse)

seq1  TTTATTATACTAGTTTCCTACATTAAGTCTTTGCCTTTTCA-TTTTTATT  49
      ||||||||||||||||| ||||| ||||| ||||||||||| ||||||||
seq2  TTTATTATACTAGTTTCTTACATAAAGTC-TTGCCTTTTCATTTTTTATT  49

seq1  TTATTTTTCAAAGATGCAAATTTTGTCTTTTAGATTAAAAAAACAACAAC  99
      ||| |||||||||||||||||||||||||||||||| |||||||||||||
seq2  TTA-TTTTCAAAGATGCAAATTTTGTCTTTTAGATT-AAAAAACAACAAC  97

seq1  AGTAAAAGACTTATAAGAATAAATCAGAGGGTTTGGGAATTTGGCTCTGA  149
      ||| |||||||||| |||||||||||||||||||||||||||||||||||
seq2  AGT-AAAGACTTAT-AGAATAAATCAGAGGGTTTGGGAATTTGGCTCTGA  145

seq1  AATTGAACTTG-TCAGCAGGTTCAATGCCTCAGTTTGATCTACAAAACAA  198
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  AATTGAACTTGTTCAGCAGGTTCAATGCCTCAGTTTGATCTACAAAACAA  195

seq1  AAATAAGCAAAACCCAGAGAGCTAAAGTACTTGCCCATCTTCCTGATTTA  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAAGCAAAACCCAGAGAGCTAAAGTACTTGCCCATCTTCCTGATTTA  245

seq1  CAGAAACAGTATCTGTCTAAGCCACTGCATATATTACTTTTAAATATCAA  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAACAGTATCTGTCTAAGCCACTGCATATATTACTTTTAAATATCAA  295

seq1  ACATCCAAATGCAGGATGAATTTTTTTACCAAGTCTTGATCTGCTAGTAT  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCCAAATGCAGGATGAATTTTTTTACCAAGTCTTGATCTGCTAGTAT  345

seq1  GGACTTCAGTGAGGCAAGAAGAACAATATGTCATGGATGCATCACATTGA  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACTTCAGTGAGGCAAGAAGAACAATATGTCATGGATGCATCACATTGA  395

seq1  AAACAAAAGTATTCATCAGGCAGTGGTGGCACACCCCTTTCGTTCCAGCA  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAAAAGTATTCATCAGGCAGTGGTGGCACACCCCTTTCGTTCCAGCA  445

seq1  CTCAGAGGCAGAGGCAGGGGGATCTCCAGATTCCAGGCCAGTCTGGTCTA  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGAGGCAGAGGCAGGGGGATCTCCAGATTCCAGGCCAGTCTGGTCTA  495

seq1  TAGAGTGAGTTCCAGCATAGCCAGGGCTATGCAGAGAAACCCTGTCTCAA  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAGTGAGTTCCAGCATAGCCAGGGCTATGCAGAGAAACCCTGTCTCAA  545

seq1  AAACAAACAAAAATGTATTCTTCACATTGATAGTATCTCCTTCTACACAG  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAAACAAAAATGTATTCTTCACATTGATAGTATCTCCTTCTACACAG  595

seq1  CCTTCAGTAAGACCCTGGAAGCTATCTTTCATGTCTGGGATTACTCTAGC  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCAGTAAGACCCTGGAAGCTATCTTTCATGTCTGGGATTACTCTAGC  645

seq1  CCAGTCCTCCTGCCTGGAGTCTTTCACATTTTACATGAAAAAGCCTTTAT  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGTCCTCCTGCCTGGAGTCTTTCACATTTTACATGAAAAAGCCTTTAT  695

seq1  CCAGCCTGTAATATTTACCAGGATTAAAAGAAGTTGAGACTTAGGTCCTC  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCCTGTAATATTTACCAGGATTAAAAGAAGTTGAGACTTAGGTCCTC  745

seq1  CTGACACGTGTAAAGTCTTGCCATCCCTCTTTTGGAGACGTTTCATGTCT  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACACGTGTAAAGTCTTGCCATCCCTCTTTTGGAGACGTTTCATGTCT  795

seq1  TTGGTACCTGGAAGTATAGGTGCTTATTTGGTGAATTTATTTGTTGATGA  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTACCTGGAAGTATAGGTGCTTATTTGGTGAATTTATTTGTTGATGA  845

seq1  ACCTGGACTAATTGTTGCATGGCTTCAGTATGAACATCCTCTTAGCCAGT  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTGGACTAATTGTTGCATGGCTTCAGTATGAACATCCTCTTAGCCAGT  895

seq1  GGTTAGAGTCGTCTGTCCGAGGTGATACATCAAATAGAGACGCTTTGGGA  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTAGAGTCGTCTGTCCGAGGTGATACATCAAATAGAGACGCTTTGGGA  945

seq1  TCTTCCACTGAAGAAGTTTAGGAAACAAGAGACACTGGGAGAGATCCCCA  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCCACTGAAGAAGTTTAGGAAACAAGAGACACTGGGAGAGATCCCCA  995

seq1  CCTGTGCTAGTTTAGCTGACACTCTTTCTTTGAGGCCAGAGCTAGCTTGG  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTGCTAGTTTAGCTGACACTCTTTCTTTGAGGCCAGAGCTAGCTTGG  1045

seq1  AGGGGTCCAATATTGGGTTCTCTCAGGAGGCAGCAGGAATTC  1090
      ||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGGTCCAATATTGGGTTCTCTCAGGAGGCAGCAGGAATTC  1087

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information