MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-282B13
Chromosome	3 (Build37)
Map Location	108,038,249 - 108,159,153
singlet/doublet	doublet
Overlap gene	LOC668686, Psma5, Sort1
Upstream gene	Prok1, Hbxip, Slc16a4, Rbm15, LOC383901, Kcnc4, Slc6a17, Ubl4b, Alx3, 6330569M22Rik, Ahcyl1, Csf1, LOC280047, Eps8l3, Gstm5, LOC671031, Gstm7, Gstm6, LOC668674, Gstm3, LOC624701, Gstm2, Gstm1, LOC100043641, Gstm4, Ampd2, Gnat2, Gnai3, Gpr61, LOC100043654, Amigo1, Cyb561d1, Atxn7l2, Sypl2
Downstream gene	Mybphl, Psrc1, Celsr2, Sars, 5330417C22Rik, 1700013F07Rik, 2010200O16Rik, Taf13, Wdr47, LOC100043166, Clcc1, Gpsm2, 4921525H12Rik, Stxbp3a, Fndc7, Prpf38b, 4921515J06Rik, B430201A12Rik, 4930443G12Rik, Slc25a24, Vav3
Link	Open Mouse BAC browser

Click to get alignment info.

name	Prok1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246691 MGI:2180370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hbxip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68576 MGI:1915826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 179 ESTs, 3 Proteins

name	Slc16a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229699 MGI:2385183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229700 MGI:2443205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC383901 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins pseudo : _no_value

name	Kcnc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99738 MGI:96670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc6a17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229706 MGI:2442535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubl4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67591 MGI:1914841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11694 MGI:1277097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330569M22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229707 MGI:2443884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ahcyl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229709 MGI:2385184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12977 MGI:1339753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC280047 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:280047
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 268 ESTs, 4 Proteins pseudo : _no_value

name	Eps8l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99662 MGI:2139743
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gstm5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14866 MGI:1309466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671031 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671031
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Gstm7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68312 MGI:1915562
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gstm6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14867 MGI:1309467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668674 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	Gstm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14864 MGI:106026
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624701 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 35 ESTs, 2 Proteins

name	Gstm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14863 MGI:95861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gstm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14862 MGI:95860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043641 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 304 ESTs, 2 Proteins

name	Gstm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14865 MGI:95862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ampd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109674 MGI:88016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14686 MGI:95779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnai3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14679 MGI:95773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr61 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229714 MGI:2441719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043654 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043654
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 37 ESTs

name	Amigo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229715 MGI:2653612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cyb561d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72023 MGI:1919273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Atxn7l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72522 MGI:1919772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sypl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17306 MGI:1328311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668686 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668686
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 26 ESTs, 4 Proteins pseudo : _no_value

name	Psma5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26442 MGI:1347009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sort1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20661 MGI:1338015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mybphl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68753 MGI:1916003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psrc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56742 MGI:1913099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Celsr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53883 MGI:1858235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Sars (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20226 MGI:102809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5330417C22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229722 MGI:1923930
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700013F07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75504 MGI:1922754
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 24 ESTs, 2 Proteins

name	2010200O16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67495 MGI:1914745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99730 MGI:1913500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr47 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99512 MGI:2139593
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043166 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043166
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Clcc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229725 MGI:2385186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpsm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76123 MGI:1923373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921525H12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329738 MGI:3584453
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs

name	Stxbp3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20912 MGI:107362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fndc7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320181 MGI:2443535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prpf38b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66921 MGI:1914171
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921515J06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66715 MGI:1913965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	B430201A12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329739 MGI:3036259
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 130 ESTs, 7 Proteins

name	4930443G12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74686 MGI:1921936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 Proteins

name	Slc25a24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229731 MGI:1917160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vav3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57257 MGI:1888518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Prok1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676356 GeneID:246691 MGI:2180370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prokineticin 1 transcript_id : NM_001044382.1

name	Hbxip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251433 GeneID:68576 MGI:1915826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 177 ESTs, 3 Proteins product : hepatitis B virus x interacting protein transcript_id : XM_001480844.1

name	Hbxip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251435 GeneID:68576 MGI:1915826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs product : hepatitis B virus x interacting protein transcript_id : XM_001480846.1

name	Slc16a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122664 GeneID:229699 MGI:2385183
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 16 (monocarboxylic acid transporters), member 4 transcript_id : NM_146136.1

name	Rbm15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249065 GeneID:229700 MGI:2443205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 15 transcript_id : NM_001045807.1

name	Kcnc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130234 GeneID:99738 MGI:96670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage gated channel, Shaw-related subfamily, member 4 transcript_id : NM_145922.2

name	Slc6a17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370279 GeneID:229706 MGI:2442535
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 6 (neurotransmitter transporter), member 17 transcript_id : NM_172271.2

name	Ubl4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802043 GeneID:67591 MGI:1914841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-like 4B transcript_id : NM_026261.2

name	Alx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802244 GeneID:11694 MGI:1277097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aristaless 3 transcript_id : NM_007441.2

name	6330569M22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956343 GeneID:229707 MGI:2443884
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330569M22 gene transcript_id : NM_153563.1

name	Ahcyl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922632 GeneID:229709 MGI:2385184
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S-adenosylhomocysteine hydrolase-like 1 transcript_id : NM_145542.3

name	Csf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227199 GeneID:12977 MGI:1339753
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : colony stimulating factor 1 (macrophage) transcript_id : NM_007778.3

name	Eps8l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527081 GeneID:99662 MGI:2139743
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ESP8-like 3 transcript_id : NM_133867.1

name	Gstm5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892313 GeneID:14866 MGI:1309466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase, mu 5 transcript_id : NM_010360.2

name	Gstm7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113679873 GeneID:68312 MGI:1915562
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase, mu 7 transcript_id : NM_026672.2

name	Gstm6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680505 GeneID:14867 MGI:1309467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase, mu 6 transcript_id : NM_008184.3

name	Gstm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33468898 GeneID:14864 MGI:106026
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase, mu 3 transcript_id : NM_010359.1

name	LOC624701 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251438 GeneID:624701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 35 ESTs, 2 Proteins product : similar to chromosome 20 open reading frame 52 transcript_id : XM_001003038.2

name	Gstm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802539 GeneID:14863 MGI:95861
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase, mu 2 transcript_id : NM_008183.3

name	Gstm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803498 GeneID:14862 MGI:95860
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase, mu 1 transcript_id : NM_010358.4

name	LOC100043641 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251439 GeneID:100043641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 304 ESTs, 2 Proteins product : similar to ubiquitin-conjugating enzyme E2 variant 1 transcript_id : XM_001480895.1

name	Gstm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30089695 GeneID:14865 MGI:95862
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase, mu 4 transcript_id : NM_026764.2

name	Ampd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893240 GeneID:109674 MGI:88016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine monophosphate deaminase 2 (isoform L) transcript_id : NM_028779.4

name	Gnat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982843 GeneID:14686 MGI:95779
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein, alpha transducing 2 transcript_id : NM_008141.2

name	Gnai3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892802 GeneID:14679 MGI:95773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein, alpha inhibiting 3 transcript_id : NM_010306.2

name	Gpr61 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357360 GeneID:229714 MGI:2441719
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 61 transcript_id : NM_175470.3

name	LOC100043654 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251441 GeneID:100043654
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 37 ESTs product : hypothetical protein LOC100043654 transcript_id : XM_001480906.1

name	Amigo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51988880 GeneID:229715 MGI:2653612
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adhesion molecule with Ig like domain 1 transcript_id : NM_146137.2

name	Amigo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51988878 GeneID:229715 MGI:2653612
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adhesion molecule with Ig like domain 1 transcript_id : NM_001004293.1

name	Cyb561d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948654 GeneID:72023 MGI:1919273
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b-561 domain containing 1 transcript_id : NM_028061.1

name	Cyb561d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139949164 GeneID:72023 MGI:1919273
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b-561 domain containing 1 transcript_id : NM_001081320.2

name	Atxn7l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377576 GeneID:72522 MGI:1919772
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ataxin 7-like 2 transcript_id : NM_175183.3

name	Sypl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678873 GeneID:17306 MGI:1328311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptophysin-like 2 transcript_id : NM_008596.1

name	Psma5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369571 GeneID:26442 MGI:1347009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, alpha type 5 transcript_id : NM_011967.3

name	Sort1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34610210 GeneID:20661 MGI:1338015
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sortilin 1 transcript_id : NM_019972.2

name	Mybphl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74316016 GeneID:68753 MGI:1916003
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin binding protein H-like transcript_id : NM_026831.1

name	Psrc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368259 GeneID:56742 MGI:1913099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline/serine-rich coiled-coil 1 transcript_id : NM_019976.2

name	Celsr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114050896 GeneID:53883 MGI:1858235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin EGF LAG seven-pass G-type receptor 2 transcript_id : NM_001004177.2

name	Celsr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114050894 GeneID:53883 MGI:1858235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin EGF LAG seven-pass G-type receptor 2 transcript_id : NM_017392.3

name	Sars (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801897 GeneID:20226 MGI:102809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seryl-aminoacyl-tRNA synthetase transcript_id : NM_011319.2

name	5330417C22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701809 GeneID:229722 MGI:1923930
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5330417C22 gene transcript_id : NM_001033304.1

name	1700013F07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369859 GeneID:75504 MGI:1922754
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 24 ESTs, 2 Proteins product : RIKEN cDNA 1700013F07 gene transcript_id : XM_131080.4

name	2010200O16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312927 GeneID:67495 MGI:1914745
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010200O16 gene transcript_id : NM_026198.1

name	Taf13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802143 GeneID:99730 MGI:1913500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_025444.2

name	Wdr47 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341022 GeneID:99512 MGI:2139593
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 47 transcript_id : NM_181400.2

name	Clcc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704069 GeneID:229725 MGI:2385186
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chloride channel CLIC-like 1 transcript_id : NM_145543.1

name	Gpsm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22758137 GeneID:76123 MGI:1923373
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein signalling modulator 2 (AGS3-like, C. elegans) transcript_id : NM_029522.1

name	4921525H12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251443 GeneID:329738 MGI:3584453
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs product : RIKEN cDNA 4921525H12 gene transcript_id : XM_001052095.2

name	Stxbp3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755689 GeneID:20912 MGI:107362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin binding protein 3A transcript_id : NM_011504.1

name	Fndc7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366636 GeneID:320181 MGI:2443535
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibronectin type III domain containing 7 transcript_id : NM_177091.3

name	Prpf38b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130261 GeneID:66921 MGI:1914171
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PRP38 pre-mRNA processing factor 38 (yeast) domain containing B transcript_id : NM_025845.2

name	4921515J06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118403307 GeneID:66715 MGI:1913965
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921515J06 gene transcript_id : NM_025723.2

name	4921515J06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118403305 GeneID:66715 MGI:1913965
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921515J06 gene transcript_id : NM_001078646.1

name	B430201A12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251362 GeneID:329739 MGI:3036259
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 130 ESTs, 7 Proteins product : RIKEN cDNA B430201A12 gene transcript_id : XM_283903.6

name	4930443G12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369864 GeneID:74686 MGI:1921936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 Proteins product : RIKEN cDNA 4930443G12 gene transcript_id : XM_131087.4

name	Slc25a24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376525 GeneID:229731 MGI:1917160
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 24 transcript_id : NM_172685.2

name	Vav3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:69724857 GeneID:57257 MGI:1888518
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vav 3 oncogene transcript_id : NM_020505.2

name	Prok1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117676357 GeneID:246691 MGI:2180370
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0007623 - circadian rhythm [Evidence TAS]; GO:0008284 - positive regulation of cell proliferation [Evidence IDA]; GO:0045765 - regulation of angiogenesis [Evidence IDA] codon_start : 1 product : prokineticin 1 protein_id : NP_001037847.1

name	Hbxip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251436 GeneID:68576 MGI:1915826
definition	codon_start : 1 product : hepatitis B virus x interacting protein protein_id : XP_001480896.1

name	Hbxip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251434 GeneID:68576 MGI:1915826
definition	codon_start : 1 product : hepatitis B virus x interacting protein protein_id : XP_001480894.1

name	Slc16a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122665 CCDS:CCDS17736.1 GeneID:229699 MGI:2385183
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 16, member 4 protein_id : NP_666248.1

name	Rbm15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249066 GeneID:229700 MGI:2443205
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004182 - carboxypeptidase A activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : RNA binding motif protein 15 protein_id : NP_001039272.1

name	Kcnc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122333 CCDS:CCDS17738.1 GeneID:99738 MGI:96670
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : potassium voltage gated channel, Shaw-related subfamily, member 4 protein_id : NP_666034.1

name	Slc6a17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986569 GeneID:229706 MGI:2442535
definition	GO_function : GO:0015293 - symporter activity [Evidence IEA] codon_start : 1 note : sodium-dependent orphan neurotramsmitter transporter NTT4 product : solute carrier family 6 (neurotransmitter transporter), member 17 protein_id : NP_758475.1

name	Ubl4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385770 GeneID:67591 MGI:1914841
definition	GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : ubiquitin-like 4B protein_id : NP_080537.1

name	Alx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106250 CCDS:CCDS17739.1 GeneID:11694 MGI:1277097
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] [Evidence ISS] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : possible role in patterning of mesoderm during development product : aristaless 3 protein_id : NP_031467.1

name	6330569M22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956344 GeneID:229707 MGI:2443884
definition	codon_start : 1 product : hypothetical protein LOC229707 protein_id : NP_705791.1

name	Ahcyl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734986 GeneID:229709 MGI:2385184
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 note : IP3R binding protein released with inositol 1,4,5-trisphosphate; S-adenosylhomocysteine hydrolase, related sequence 3 product : S-adenosylhomocysteine hydrolase-like 1 protein_id : NP_663517.2

name	Csf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677416 CCDS:CCDS17740.1 GeneID:12977 MGI:1339753
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] [Evidence ISS]; GO:0008083 - growth factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0040018 - positive regulation of body size [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence ISS]; GO:0042488 - positive regulation of odontogenesis (sensu Vertebrata) [Evidence IMP]; GO:0045672 - positive regulation of osteoclast differentiation [Evidence IDA]; GO:0030278 - regulation of ossification [Evidence IMP] codon_start : 1 exception : mismatches in translation note : colony-stimulating factor-1; osteopetrosis product : colony stimulating factor 1 protein_id : NP_031804.2

name	Eps8l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527082 GeneID:99662 MGI:2139743
definition	GO_function : GO:0005515 - protein binding [Evidence ISS] codon_start : 1 note : epidermal growth factor receptor pathway substrate 8 related protein 3 product : epidermal growth factor receptor pathway substrate 8-like protein 3 protein_id : NP_598628.1

name	Gstm5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754086 CCDS:CCDS17741.1 GeneID:14866 MGI:1309466
definition	GO_function : GO:0004364 - glutathione transferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : glutathione-S-transferase, mu 5 product : glutathione S-transferase, mu 5 protein_id : NP_034490.1

name	Gstm7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113679874 GeneID:68312 MGI:1915562
definition	GO_function : GO:0004364 - glutathione transferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : glutathione S-transferase, mu 7 protein_id : NP_080948.2

name	Gstm6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680506 GeneID:14867 MGI:1309467
definition	GO_function : GO:0004364 - glutathione transferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : glutathione-S-transferase, mu 6 product : glutathione S-transferase, mu 6 protein_id : NP_032210.3

name	Gstm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468899 CCDS:CCDS17744.1 GeneID:14864 MGI:106026
definition	GO_function : GO:0004364 - glutathione transferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : glutathione-S-transferase, mu 3 product : glutathione S-transferase, mu 3 protein_id : NP_034489.1

name	LOC624701 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94369848 GeneID:624701
definition	codon_start : 1 product : similar to chromosome 20 open reading frame 52 protein_id : XP_001003038.1

name	Gstm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680121 CCDS:CCDS17746.1 GeneID:14863 MGI:95861
definition	GO_function : GO:0004364 - glutathione transferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : glutathione-S-transferase, mu 2 product : glutathione S-transferase, mu 2 protein_id : NP_032209.1

name	Gstm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754084 CCDS:CCDS17747.1 GeneID:14862 MGI:95860
definition	GO_function : GO:0004364 - glutathione transferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : glutathione-S-transferase, mu 1 product : glutathione S-transferase, mu 1 protein_id : NP_034488.1

name	LOC100043641 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251440 GeneID:100043641
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480945.1

name	Gstm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076911 CCDS:CCDS17748.1 GeneID:14865 MGI:95862
definition	EC_number : 2.5.1.18 GO_component : GO:0005829 - cytosol [Evidence TAS] GO_function : GO:0004364 - glutathione transferase activity [Evidence IDA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0018916 - nitrobenzene metabolism [Evidence IDA]; GO:0042178 - xenobiotic catabolism [Evidence IDA] codon_start : 1 note : glutathione-S-transferase, mu 4 product : glutathione S-transferase, mu 4 protein_id : NP_081040.1

name	Ampd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311925 CCDS:CCDS17749.1 GeneID:109674 MGI:88016
definition	GO_function : GO:0003876 - AMP deaminase activity [Evidence IEA]; GO:0019239 - deaminase activity [Evidence IEA] GO_process : GO:0009117 - nucleotide metabolism [Evidence IEA]; GO:0006144 - purine base metabolism [Evidence IEA]; GO:0009168 - purine ribonucleoside monophosphate biosynthesis [Evidence IEA] codon_start : 1 note : AMP deaminase 2 product : adenosine monophosphate deaminase 2 (isoform L) protein_id : NP_083055.1

name	Gnat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680043 CCDS:CCDS17750.1 GeneID:14686 MGI:95779
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence TAS]; GO:0005624 - membrane fraction [Evidence TAS] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007199 - G-protein signaling, coupled to cGMP nucleotide second messenger [Evidence TAS]; GO:0007602 - phototransduction [Evidence TAS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007601 - visual perception [Evidence TAS] codon_start : 1 product : guanine nucleotide binding protein, alpha transducing 2 protein_id : NP_032167.1

name	Gnai3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563256 CCDS:CCDS17751.1 GeneID:14679 MGI:95773
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005834 - heterotrimeric G-protein complex [Evidence TAS] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0008016 - regulation of heart contraction [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein, alpha inhibiting 3 protein_id : NP_034436.1

name	LOC100043654 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251442 GeneID:100043654
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480956.1

name	Gpr61 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202043 CCDS:CCDS17752.1 GeneID:229714 MGI:2441719
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : G protein-coupled receptor 61 protein_id : NP_780679.1

name	Amigo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51988879 CCDS:CCDS17753.1 GeneID:229715 MGI:2653612
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007413 - axonal fasciculation [Evidence ISS]; GO:0007409 - axonogenesis [Evidence ISS]; GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007157 - heterophilic cell adhesion [Evidence ISS]; GO:0007156 - homophilic cell adhesion [Evidence ISS]; GO:0042552 - myelination [Evidence ISS]; GO:0007399 - nervous system development [Evidence IEA]; GO:0050772 - positive regulation of axonogenesis [Evidence ISS] codon_start : 1 note : alivin 2; amphoterin induced gene and ORF (Amigo) product : amphoterin induced gene and ORF protein_id : NP_001004293.1

name	Amigo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51988881 CCDS:CCDS17753.1 GeneID:229715 MGI:2653612
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007413 - axonal fasciculation [Evidence ISS]; GO:0007409 - axonogenesis [Evidence ISS]; GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007157 - heterophilic cell adhesion [Evidence ISS]; GO:0007156 - homophilic cell adhesion [Evidence ISS]; GO:0042552 - myelination [Evidence ISS]; GO:0007399 - nervous system development [Evidence IEA]; GO:0050772 - positive regulation of axonogenesis [Evidence ISS] codon_start : 1 note : alivin 2; amphoterin induced gene and ORF (Amigo) product : amphoterin induced gene and ORF protein_id : NP_666249.2

name	Cyb561d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139949165 GeneID:72023 MGI:1919273
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : cytochrome b-561 domain containing 1 isoform 1 protein_id : NP_001074789.2

name	Cyb561d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948655 GeneID:72023 MGI:1919273
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : cytochrome b-561 domain containing 1 isoform 2 protein_id : NP_082337.1

name	Atxn7l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424788 CCDS:CCDS17754.1 GeneID:72522 MGI:1919772
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : mFLJ00381 protein product : ataxin 7-like 2 protein_id : NP_780392.1

name	Sypl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678874 GeneID:17306 MGI:1328311
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : mitsugumin 29 product : synaptophysin-like 2 protein_id : NP_032622.1

name	Psma5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106387 CCDS:CCDS17755.1 GeneID:26442 MGI:1347009
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : proteasome (prosome, macropain) subunit, alpha type 5 protein_id : NP_036097.1

name	Sort1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34610211 CCDS:CCDS17756.1 GeneID:20661 MGI:1338015
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005764 - lysosome [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0030140 - trans-Golgi network transport vesicle [Evidence IDA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0001503 - ossification [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : neurotensin receptor 3 product : sortilin 1 protein_id : NP_064356.2

name	Mybphl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74316017 CCDS:CCDS17757.1 GeneID:68753 MGI:1916003
definition	codon_start : 1 product : myosin binding protein H-like protein_id : NP_081107.1

name	Psrc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910192 CCDS:CCDS17758.1 GeneID:56742 MGI:1913099
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_process : GO:0050875 - cellular physiological process [Evidence IDA] codon_start : 1 note : p53-regulated DDA3 product : differential display and activated by p53 protein_id : NP_064360.1

name	Celsr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114050897 GeneID:53883 MGI:1858235
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence ISS] [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : cadherin EGF LAG seven-pass G-type receptor 2 isoform 2 protein_id : NP_001004177.2

name	Celsr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114050895 CCDS:CCDS17759.1 GeneID:53883 MGI:1858235
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence ISS] [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : cadherin EGF LAG seven-pass G-type receptor 2 isoform 1 protein_id : NP_059088.2

name	Sars (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468931 CCDS:CCDS17760.1 GeneID:20226 MGI:102809
definition	GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004828 - serine-tRNA ligase activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006434 - seryl-tRNA aminoacylation [Evidence IEA]; GO:0006418 - tRNA aminoacylation for protein translation [Evidence IEA] codon_start : 1 product : seryl-aminoacyl-tRNA synthetase 1 protein_id : NP_035449.1

name	5330417C22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701810 CCDS:CCDS17761.1 GeneID:229722 MGI:1923930
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC229722 protein_id : NP_001028476.1

name	1700013F07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20875277 GeneID:75504 MGI:1922754
definition	codon_start : 1 product : hypothetical protein LOC75504 protein_id : XP_131080.1

name	2010200O16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312928 GeneID:67495 MGI:1914745
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67495 protein_id : NP_080474.1

name	Taf13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270192 CCDS:CCDS17764.1 GeneID:99730 MGI:1913500
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : TBP-associated factor, RNA polymerase II, K, 18kD; TAF13 RNA polymerase II, TATA box-binding protein-associated factor product : TATA box-binding protein-associated factor, RNA polymerase II, K, 18kD protein_id : NP_079720.1

name	Wdr47 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31088910 CCDS:CCDS17765.1 GeneID:99512 MGI:2139593
definition	codon_start : 1 exception : mismatches in translation product : WD repeat domain 47 protein_id : NP_852065.1

name	Clcc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704070 CCDS:CCDS17766.1 GeneID:229725 MGI:2385186
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0005792 - microsome [Evidence ISS]; GO:0005739 - mitochondrion [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005254 - chloride channel activity [Evidence ISS] GO_process : GO:0006821 - chloride transport [Evidence ISS] codon_start : 1 note : Mid-1-related chloride channel 1 product : chloride channel CLIC-like 1 protein_id : NP_663518.1

name	Gpsm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22758138 GeneID:76123 MGI:1923373
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : pins homolog (Drosophia) product : Pins protein_id : NP_083798.1

name	4921525H12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251444 GeneID:329738 MGI:3584453
definition	codon_start : 1 product : hypothetical protein LOC329738 protein_id : XP_001052095.2

name	Stxbp3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755690 CCDS:CCDS17768.1 GeneID:20912 MGI:107362
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0019905 - syntaxin binding [Evidence IDA] GO_process : GO:0015758 - glucose transport [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006904 - vesicle docking during exocytosis [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 product : syntaxin binding protein 3 protein_id : NP_035634.1

name	Fndc7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893015 CCDS:CCDS17769.1 GeneID:320181 MGI:2443535
definition	codon_start : 1 exception : mismatches in translation product : fibronectin type III domain containing 7 protein_id : NP_796065.1

name	Prpf38b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794464 CCDS:CCDS17770.1 GeneID:66921 MGI:1914171
definition	codon_start : 1 product : PRP38 pre-mRNA processing factor 38 (yeast) domain containing B protein_id : NP_080121.1

name	4921515J06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118403306 GeneID:66715 MGI:1913965
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66715 protein_id : NP_001072114.1

name	4921515J06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118403308 GeneID:66715 MGI:1913965
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66715 protein_id : NP_079999.2

name	B430201A12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251363 GeneID:329739 MGI:3036259
definition	codon_start : 1 product : hypothetical protein LOC329739 protein_id : XP_283903.6

name	4930443G12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38076956 GeneID:74686 MGI:1921936
definition	codon_start : 1 product : RIKEN cDNA 4930443G12 protein_id : XP_131087.2

name	Slc25a24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369998 CCDS:CCDS17772.1 GeneID:229731 MGI:1917160
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_process : GO:0006839 - mitochondrial transport [Evidence IEA] codon_start : 1 product : calcium-binding transporter protein_id : NP_766273.1

name	Vav3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:69724858 CCDS:CCDS17773.1 GeneID:57257 MGI:1888518
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0005154 - epidermal growth factor receptor binding [Evidence IPI]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IMP]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0030676 - Rac guanyl-nucleotide exchange factor activity [Evidence IGI]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IGI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016477 - cell migration [Evidence IGI]; GO:0030031 - cell projection biogenesis [Evidence IGI]; GO:0007229 - integrin-mediated signaling pathway [Evidence IGI]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0030032 - lamellipodium biogenesis [Evidence IGI]; GO:0045785 - positive regulation of cell adhesion [Evidence IGI]; GO:0043552 - positive regulation of phosphoinositide 3-kinase activity [Evidence IGI]; GO:0043087 - regulation of GTPase activity [Evidence IGI]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IMP]; GO:0006906 - vesicle fusion [Evidence IGI] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : vav 3 oncogene isoform 1 protein_id : NP_065251.2

name	LOC671031 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671031
definition	number : 9 pseudo : _no_value

name	LOC671031 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671031
definition	number : 8 pseudo : _no_value

name	LOC671031 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671031
definition	number : 7 pseudo : _no_value

name	LOC671031 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671031
definition	number : 6 pseudo : _no_value

name	LOC671031 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671031
definition	number : 5 pseudo : _no_value

name	LOC671031 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671031
definition	number : 4 pseudo : _no_value

name	LOC671031 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671031
definition	number : 3 pseudo : _no_value

name	LOC671031 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671031
definition	number : 2 pseudo : _no_value

name	LOC671031 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671031
definition	number : 1 pseudo : _no_value

name	LOC668674 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668674
definition	number : 7 pseudo : _no_value

name	LOC668674 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668674
definition	number : 6 pseudo : _no_value

name	LOC668674 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668674
definition	number : 5 pseudo : _no_value

name	LOC668674 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668674
definition	number : 4 pseudo : _no_value

name	LOC668674 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668674
definition	number : 3 pseudo : _no_value

name	LOC668674 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668674
definition	number : 2 pseudo : _no_value

name	LOC668674 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668674
definition	number : 1 pseudo : _no_value

name	LOC100043166 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043166
definition	number : 2 pseudo : _no_value

name	LOC100043166 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043166
definition	number : 1 pseudo : _no_value

name	LOC383901 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251355 GeneID:383901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : similar to stratifin pseudo : _no_value transcript_id : XR_034292.1

name	LOC280047 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251437 GeneID:280047
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 268 ESTs, 4 Proteins product : similar to 60S ribosomal protein pseudo : _no_value transcript_id : XR_034877.1

name	LOC668686 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251357 GeneID:668686
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 26 ESTs, 4 Proteins product : similar to Siva1 protein pseudo : _no_value transcript_id : XR_034306.1

clone name	MSMg01-072P14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-062C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262K14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-543M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339C18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-291I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-213N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316A06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-435O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135M05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-428I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072J21
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-282B13.b	B6Ng01-282B13.g
ACC	GA081404	GA081405
length	1,154	1,112
definition	B6Ng01-282B13.b	B6Ng01-282B13.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(108,157,997 - 108,159,153)	(108,038,249 - 108,039,344)
sequence	gaattcttgataaattaaaacaaacagaacaggagttaggcgtgcagagt ctatggttgcgctcatatggtccaacacacttagccagggtacatctcca ccccccagatgacggggctagcacaccagcataggggaatctgaacacca gcctggaagctgtagtgcagggccttcaatgtcaaagtcacagtggaagc cttggccactgcctcaaagcaggcatgtccaaccttttcacattgcaacg tgatgctgtcatctataaagttcatgcttgagaactgctcaattgagtta cgggaaaaaaaatcgcatgaagaattcatgttttaaataagtgtacaaat ttgtgtcagtccgcctttatagctattcttggttgtatgtaggcctgggg cgacaggttggacatgcctagaagatcgctttggtcacctgttccctgtc cctcatttacaactcctagaggttatgggtggagcaggaggaggctgaga gaatggggtgttgaatgggtctattactagactaccctctttgaagacgt gtgccgatgctgttccaggaaggccactatatgacacgaagatctcagtt gttactaccttttggcatgtttttacagataagccttatcagatcattgt tttcgtgtaacctacctgcttctgggtaggagataggaagtgtgtgtttt cagtgtatccaagaggaggcggagctggattctgggacaagctgtgtccc tgtgggcgggagtcctgtgcaatcatacacacacaaacactctgaggaca gccaccagcagtccagggcaggggtgcagagaagggggaactgcctcccc ttaccaatacacacacccacacactcttccctcattgccttcagggtccc tcccctgtcagtgtctcctcccttgaacagcaagggatgaggtgctggac tgtcaggcattaggaagatgggccctcaagttatctcccaaggtcattgc tgggccctgcgatgcttaatgagagtctcccctaacagtaacctcatctg tagagctccaccagacagatggccaccactcttctatgattgacgtgaga acgttcatatgatcatagctcagctttgttctagccacactggccatgca tcag	gaattcatatatttgtaacctctcccctggaaaaaaaaaattagtacagt atgaaaactgcaatagaagtatcaccagagggggaaaatatttatatttc tgtgagccaggaaagggaacagaagtagaggcaggagcatgtcccaggag agaggcaagaaacagaagagatacaaactctgggcatccctggagaatag aggaaggaggtgatgaatgactgtggtgattggaaagaaaatggccccat agccgagcagtggtggcacacgcctttaatcccagcacttgggaggtaga agcaggcggatttctgagtttgaggccagtctcgtctacagaatgagttc caggacagccagggctacacagagaaaccctgtctcgaaaaaccaaaaga aaaaaggaaaaggaaaaaagaaaatggccccttagcctcagagggagtgg cactgttaggaggtgtggccttgttagaggaagtgtgtcactgggggtgg gctttgagagttcaaatgctcaagccaccagtgtggcaatctttcttctt tgatgcctgtggaagtagaactctcagctccttctccagtaatatgtttg cctgcataccgccatgctcctgccatgatgataatggactaaacctcaga aactgtaagccagccccagttaaatgttgtcctttttaagagttgtcata gtcatggtgtctcttcacagcaatagaaaccctaactaagacaatagatg attccgttagaaatggtttgcatactgtggaaagagaggtctctttttgc ataacatgcaaagacaggggtccctcacaaaacaattttatgtaaagaac aaatataaacagacatcagtcagaatgctattaaattgcagcagtggtgg ggggttcagggatagagcaccaaagtagtccaagggaagtgatcataact gagctgagtgggagattgtgggaaatggagagggagatggctagaaaaaa tttgagaaggttaaacaagcagagctttagttaggtgcaagctcacgtcc atgtgagttcccattcctgtatcccagtaagtggctatttgttaaggtca cgcccatgctgt
quality values	Open. Hide. 58 33 22 32 58 54 62 62 62 23 35 52 62 56 47 54 56 62 62 62 47 39 62 62 62 44 62 62 62 56 47 59 62 59 29 38 50 43 40 43 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 59 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 56 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 49 47 62 49 54 62 62 62 62 62 42 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 49 54 58 58 58 58 58 58 54 58 49 58 58 58 58 54 58 52 58 52 44 41 58 58 42 58 42 58 54 54 54 54 54 54 58 58 58 52 54 54 54 58 58 46 46 41 50 58 58 51 54 58 58 58 58 45 50 51 58 54 58 58 58 58 58 58 58 58 50 41 51 58 51 58 58 58 50 50 58 41 51 46 53 53 58 50 58 58 58 41 53 53 51 51 50 58 47 51 50 49 58 58 51 58 58 49 41 53 50 58 51 51 42 42 58 49 50 43 58 54 58 58 58 51 42 53 58 58 58 50 52 28 58 58 37 39 32 53 41 58 58 54 39 50 49 40 58 41 41 40 58 54 41 32 42 40 50 49 41 49 49 52 44 25 39 39 54 24 46 29 8 54 36 44 37 54 16 51 45 54 51 32 40 52 42 40 54 46 53 41 23 38 33 42 51 49 51 41 46 38 23 44 42 35 46 33 32 18 38 35 35 54 53 51 32 45 30 28 47 54 41 53 32 28 28 32 52 31 47 32 47 52 51 32 47 45 53 47 40 51 47 32 40 53 52 36 33 31 35 53 32 24 34 35 36 40 40 32 40 31 33 51 42 31 42 31 37 26 31 46 46 29 19 15 33 45 31 26 30 30 30 27 46 15 51 43 19 46 37 46 31 38 42 31 31 31 32 28 18 18 46 46 31 31 42 25 24 32 18 27 30 30 30 30 32 31 38 31 42 42 41 32 37 25 32 22 32 31 26 31 26 25 46 19 10 21 25 33 26 38 31 26 32 25 31 7 9 29 10 21 34 46 30 26 20 37 31 29 32 30 25 31 34 25 25 31 24 29 20 27 37 30 24 41 31 14 13 15 25 23 32 25 32 19 9 11 33 44 25 13 22 20 25 15 11 13 33 35 21 28 11 7 17 32 33 31 32 14 16 11 19 22 20 24 31 25 19 29 33 19 29 17 30 40 33 20 43 25 19 23 12 9 28 5 16 21 21 8 8 18 24 10 7 33 13 12 21 21 27 17 19 14 20 27 11 29 11 11 22 27 18 16 11 5 21 17 28 18 11 21 24 18 19 17 28 23 5 5 3 7 12 9 33 28 13 15 13 15 28 19 4 4 4 9 27 20 22 15 15 12 18 10 23 17 27 7 9 6 26 24 13 18 10 17 12 18 16 22 6 6 16 23 20 23 18 3 5 6 12 18 14 17 14 9 8 9 12 8 14 10 8 23 15 23 11 8 7 4 15 16 23 6 4 9 6 24 3 4 22 9 10 4 9 12 14 14 8 10 13 23 4 8 11 11 15 4 5 3 14 11 12 6 5 10 8 18 5 6 11 8 4 5 8 14 3 5 3 4 11 16 14 12 6 3 3 5 2	Open. Hide. 62 47 42 47 62 47 47 62 62 62 62 51 50 32 34 28 28 38 38 56 62 62 62 62 62 62 59 59 59 62 59 62 62 62 62 62 62 62 54 62 59 62 59 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 54 62 62 62 62 62 54 62 62 54 62 62 62 62 62 59 62 59 62 62 62 62 54 54 54 59 59 62 62 62 62 62 42 42 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 54 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 58 58 58 52 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 54 40 58 48 47 58 58 54 54 58 58 58 52 58 58 52 58 52 58 58 58 58 54 54 52 58 58 54 58 54 58 54 49 54 58 50 58 54 58 58 58 48 54 58 58 58 58 54 49 58 58 58 58 49 58 50 58 58 51 58 45 39 54 58 58 54 51 58 51 54 49 49 50 51 58 51 51 58 49 40 58 58 42 58 54 49 40 48 49 54 49 50 54 54 53 51 32 58 58 50 50 51 58 50 52 51 46 58 58 39 46 52 58 46 46 46 50 58 52 40 58 42 40 54 40 49 51 50 48 43 48 58 38 36 37 35 53 39 58 37 53 50 51 52 50 34 52 50 29 31 50 38 52 58 54 40 54 52 50 50 52 50 41 42 24 42 35 33 49 50 52 52 49 32 54 50 50 38 42 44 46 52 43 41 37 40 41 35 40 35 39 54 49 35 36 42 37 42 39 24 50 35 50 40 33 24 37 37 51 54 54 31 38 39 31 54 40 47 37 37 53 32 38 39 53 32 44 36 33 54 49 37 51 31 45 32 53 37 37 43 34 32 54 54 54 46 29 36 24 40 27 47 36 33 33 38 32 53 52 36 45 33 27 30 32 52 49 36 32 30 36 24 31 35 31 32 32 40 40 40 27 26 25 52 53 49 23 30 33 30 32 22 41 33 23 28 29 31 28 51 31 30 26 37 24 51 33 38 31 31 37 26 23 31 32 34 28 41 30 28 23 33 27 21 37 32 31 31 29 25 21 48 31 26 29 31 35 35 25 30 31 26 18 42 31 25 31 46 46 46 46 25 9 22 25 18 26 47 27 11 18 23 22 30 23 23 16 23 38 31 46 29 26 31 25 23 14 25 41 13 25 13 46 20 31 30 22 32 30 31 34 31 33 31 22 21 23 29 31 31 16 24 31 31 13 5 7 9 47 7 28 15 22 14 15 21 11 25 38 33 9 32 12 12 6 25 21 6 7 9 32 16 31 9 30 24 33 27 31 26 19 6 5 25 11 19 19 24 24 29 33 23 9 14 18 19 13 32 11 7 8 4 4 7 5 21 27 20 8 6 8 5 4 6 31 7 7 7 13 15 9 6 11 12 26 28 6 15 7 11 9 9 16 6 5 10 7 11 6 5 7 6 8 11 6 9 18 8 6 7 18 11 11 4 5 9 6 4 6 7 6 14 6 6 4 3 5 12 4 3 5 11 7 7 7 14 14 7 5 8 7 9 5 11 10 9 4 13 4 9 22 14 6 6 4 5 4 4 4 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr3_108157997_108159153
seq2: B6Ng01-282B13.b_45_1198 (reverse)

seq1  CTGATGCATGCCAAGTGT-GCTAGAACAAAAGCTGAGCTATGATCATAAT  49
      |||||||||| | ||||| |||||||| ||||||||||||||||||| ||
seq2  CTGATGCATGGCCAGTGTGGCTAGAAC-AAAGCTGAGCTATGATCAT-AT  48

seq1  GGACCGTCTCACGTCAAATCATAGGAAGAGTGGTGCCCATCTGTCTGGTG  99
      | ||  ||||||||| ||||||| ||||||||||| ||||||||||||||
seq2  GAACGTTCTCACGTC-AATCATA-GAAGAGTGGTGGCCATCTGTCTGGTG  96

seq1  GAGCTCTACAGATGAGGTAACTGTTA-GGGAGACCTCCTCATTAAGCATC  148
      |||||||||||||||||| ||||||| |||||||   |||||||||||||
seq2  GAGCTCTACAGATGAGGTTACTGTTAGGGGAGAC--TCTCATTAAGCATC  144

seq1  GCAGGG-CCAGCAATGA-CTTGGGAGATAACCTGAGGGCCCATCTTCCTA  196
      |||||| |||||||||| ||||||||||||| ||||||||||||||||||
seq2  GCAGGGCCCAGCAATGACCTTGGGAGATAACTTGAGGGCCCATCTTCCTA  194

seq1  ATGCCTGACAGTCCCAGCACCTCATCCC-TGCTGTTCAAAGGGAGGAGAC  245
      |||||||||||| ||||||||||||||| |||||||| ||||||||||||
seq2  ATGCCTGACAGT-CCAGCACCTCATCCCTTGCTGTTC-AAGGGAGGAGAC  242

seq1  ACTGACAGGGGAGGGACCCTGAAGGCAATGAGGGAAGAGTGTGTGGGTGT  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGACAGGGGAGGGACCCTGAAGGCAATGAGGGAAGAGTGTGTGGGTGT  292

seq1  GTGTATTGGTAAGGGGAGGCAGTTCCCCCTTCTCTGCACCCCTGCCCTGG  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTATTGGTAAGGGGAGGCAGTTCCCCCTTCTCTGCACCCCTGCCCTGG  342

seq1  ACTGCTGGTGGCTGTCCTCAGAGTGTTTGTGTGTGTATGATTGCACAGGA  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGCTGGTGGCTGTCCTCAGAGTGTTTGTGTGTGTATGATTGCACAGGA  392

seq1  CTCCCGCCCACAGGGACACAGCTTGTCCCAGAATCCAGCTCCGCCTCCTC  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCCGCCCACAGGGACACAGCTTGTCCCAGAATCCAGCTCCGCCTCCTC  442

seq1  TTGGATACACTGAAAACACACACTTCCTATCTCCTACCCAGAAGCAGGTA  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGATACACTGAAAACACACACTTCCTATCTCCTACCCAGAAGCAGGTA  492

seq1  GGTTACACGAAAACAATGATCTGATAAGGCTTATCTGTAAAAACATGCCA  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTACACGAAAACAATGATCTGATAAGGCTTATCTGTAAAAACATGCCA  542

seq1  AAAGGTAGTAACAACTGAGATCTTCGTGTCATATAGTGGCCTTCCTGGAA  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGTAGTAACAACTGAGATCTTCGTGTCATATAGTGGCCTTCCTGGAA  592

seq1  CAGCATCGGCACACGTCTTCAAAGAGGGTAGTCTAGTAATAGACCCATTC  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCATCGGCACACGTCTTCAAAGAGGGTAGTCTAGTAATAGACCCATTC  642

seq1  AACACCCCATTCTCTCAGCCTCCTCCTGCTCCACCCATAACCTCTAGGAG  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACCCCATTCTCTCAGCCTCCTCCTGCTCCACCCATAACCTCTAGGAG  692

seq1  TTGTAAATGAGGGACAGGGAACAGGTGACCAAAGCGATCTTCTAGGCATG  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTAAATGAGGGACAGGGAACAGGTGACCAAAGCGATCTTCTAGGCATG  742

seq1  TCCAACCTGTCGCCCCAGGCCTACATACAACCAAGAATAGCTATAAAGGC  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAACCTGTCGCCCCAGGCCTACATACAACCAAGAATAGCTATAAAGGC  792

seq1  GGACTGACACAAATTTGTACACTTATTTAAAACATGAATTCTTCATGCGA  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACTGACACAAATTTGTACACTTATTTAAAACATGAATTCTTCATGCGA  842

seq1  TTTTTTTTCCCGTAACTCAATTGAGCAGTTCTCAAGCATGAACTTTATAG  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTTCCCGTAACTCAATTGAGCAGTTCTCAAGCATGAACTTTATAG  892

seq1  ATGACAGCATCACGTTGCAATGTGAAAAGGTTGGACATGCCTGCTTTGAG  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGACAGCATCACGTTGCAATGTGAAAAGGTTGGACATGCCTGCTTTGAG  942

seq1  GCAGTGGCCAAGGCTTCCACTGTGACTTTGACATTGAAGGCCCTGCACTA  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGTGGCCAAGGCTTCCACTGTGACTTTGACATTGAAGGCCCTGCACTA  992

seq1  CAGCTTCCAGGCTGGTGTTCAGATTCCCCTATGCTGGTGTGCTAGCCCCG  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTTCCAGGCTGGTGTTCAGATTCCCCTATGCTGGTGTGCTAGCCCCG  1042

seq1  TCATCTGGGGGGTGGAGATGTACCCTGGCTAAGTGTGTTGGACCATATGA  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATCTGGGGGGTGGAGATGTACCCTGGCTAAGTGTGTTGGACCATATGA  1092

seq1  GCGCAACCATAGACTCTGCACGCCTAACTCCTGTTCTGTTTGTTTTAATT  1145
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGCAACCATAGACTCTGCACGCCTAACTCCTGTTCTGTTTGTTTTAATT  1142

seq1  TATCAAGAATTC  1157
      ||||||||||||
seq2  TATCAAGAATTC  1154

seq1: chr3_108038249_108039344
seq2: B6Ng01-282B13.g_67_1178

seq1  GAATTCATATATTTGTAACCTCTCCCCTGGAAAAAAAAAATTAGTACAGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATATATTTGTAACCTCTCCCCTGGAAAAAAAAAATTAGTACAGT  50

seq1  ATGAAAACTGCAATAGAAGTATCACCAGAGGGGGAAAATATTTATATTTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAAAACTGCAATAGAAGTATCACCAGAGGGGGAAAATATTTATATTTC  100

seq1  TGTGAGCCAGGAAAGGGAACAGAAGTAGAGGCAGGAGCATGTCCCAGGAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGAGCCAGGAAAGGGAACAGAAGTAGAGGCAGGAGCATGTCCCAGGAG  150

seq1  AGAGGCAAGAAACAGAAGAGATACAAACTCTGGGCATCCCTGGAGAATAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGCAAGAAACAGAAGAGATACAAACTCTGGGCATCCCTGGAGAATAG  200

seq1  AGGAAGGAGGTGATGAATGACTGTGGTGATTGGAAAGAAAATGGCCCCAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAGGAGGTGATGAATGACTGTGGTGATTGGAAAGAAAATGGCCCCAT  250

seq1  AGCCGAGCAGTGGTGGCACACGCCTTTAATCCCAGCACTTGGGAGGTAGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCGAGCAGTGGTGGCACACGCCTTTAATCCCAGCACTTGGGAGGTAGA  300

seq1  AGCAGGCGGATTTCTGAGTTTGAGGCCAGTCTCGTCTACAGAATGAGTTC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGGCGGATTTCTGAGTTTGAGGCCAGTCTCGTCTACAGAATGAGTTC  350

seq1  CAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGAAAAACCAAAAGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGAAAAACCAAAAGA  400

seq1  AAAAAGGAAAAGGAAAAAAGAAAATGGCCCCTTAGCCTCAGAGGGAGTGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAGGAAAAGGAAAAAAGAAAATGGCCCCTTAGCCTCAGAGGGAGTGG  450

seq1  CACTGTTAGGAGGTGTGGCCTTGTTAGAGGAAGTGTGTCACTGGGGGTGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGTTAGGAGGTGTGGCCTTGTTAGAGGAAGTGTGTCACTGGGGGTGG  500

seq1  GCTTTGAGAGTTCAAATGCTCAAGCCACCAGTGTGGCAATCTTTCTTCTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTTGAGAGTTCAAATGCTCAAGCCACCAGTGTGGCAATCTTTCTTCTT  550

seq1  TGATGCCTGTGGAAGTAGAACTCTCAGCTCCTTCTCCAGTAATATGTTTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATGCCTGTGGAAGTAGAACTCTCAGCTCCTTCTCCAGTAATATGTTTG  600

seq1  CCTGCATACCGCCATGCTCCTGCCATGATGATAATGGACTAAACCTCAGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCATACCGCCATGCTCCTGCCATGATGATAATGGACTAAACCTCAGA  650

seq1  AACTGTAAGCCAGCCCCAGTTAAATGTTGTCCTTTTTAAGAGTTGTCATA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTGTAAGCCAGCCCCAGTTAAATGTTGTCCTTTTTAAGAGTTGTCATA  700

seq1  GTCATGGTGTCTCTTCACAGCAATAGAAACCCTAACTAAGACAATAGATG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCATGGTGTCTCTTCACAGCAATAGAAACCCTAACTAAGACAATAGATG  750

seq1  ATTCCGTTAGAAATGGTTTGCATACTGTGGAAAGAGAGGTCTCTTTTTGC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCCGTTAGAAATGGTTTGCATACTGTGGAAAGAGAGGTCTCTTTTTGC  800

seq1  ATAACATGCAAAGACAGGGGTCCCTCACAAAACAATTTTATGTAAAGAAC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAACATGCAAAGACAGGGGTCCCTCACAAAACAATTTTATGTAAAGAAC  850

seq1  AAATATAAACAGACATCAGTCAGAATGCTATTAAATTGCAGCAGTGGT-G  899
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  AAATATAAACAGACATCAGTCAGAATGCTATTAAATTGCAGCAGTGGTGG  900

seq1  GGGGTTCAGGGATAGAGCACCAAAGTAGTCCAA-GGAAGTGATCATAACT  948
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  GGGGTTCAGGGATAGAGCACCAAAGTAGTCCAAGGGAAGTGATCATAACT  950

seq1  GAGCTGAGGTGGAGATTGTGGG-AATGGAGA-GGAGATGGCTAAGAAAAA  996
      ||||||||  |||||||||||| |||||||| |||||||||||  |||||
seq2  GAGCTGAGTGGGAGATTGTGGGAAATGGAGAGGGAGATGGCTAGAAAAAA  1000

seq1  TTTGAG-AGGTAGAGCAAGCAGAGC-TTAGTTATGTGC-AGCTCACTTCT  1043
      |||||| ||||  | |||||||||| ||||||| |||| ||||||| || 
seq2  TTTGAGAAGGTTAAACAAGCAGAGCTTTAGTTAGGTGCAAGCTCACGTCC  1050

seq1  A-GT-AG-TCACA-TCCTGTAT-CCAGTAAGTGCATAT---GTAAGGT-A  1084
      | || || || || |||||||| ||||||||||  |||    |||||| |
seq2  ATGTGAGTTCCCATTCCTGTATCCCAGTAAGTGGCTATTTGTTAAGGTCA  1100

seq1  AGCCCATGCTGT  1096
       |||||||||||
seq2  CGCCCATGCTGT  1112

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information