MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-289C14
Chromosome	3 (Build37)
Map Location	91,503,158 - 91,504,348
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC668165, LOC383949, Pglyrp4, LOC329706, EG545541, LOC635737, EG668174, LOC668179, LOC635756, 4930529C04Rik, 9130204L05Rik
Downstream gene	LOC100042463, Pglyrp3, EG619750, Lor, A030004J04Rik, Sprr2a, LOC100042999, LOC545543, LOC100043005, LOC545545, LOC100042514, LOC619984, Sprr2b, Sprr2c, Sprr2d, Sprr2e, Sprr2f, Sprr2g, Sprr2h, Sprr2i, Sprr2j, LOC100043022, Sprr2k, Sprr1b, Sprr3, LOC100042575, Sprr1a, Sprr4, LOC100042581, Ivl, Smcp, Lce1a1, Lce1b, LOC620325, Lce1a2, Lce1c, Lce1d, LOC100043062
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC668165 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC383949 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	Pglyrp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384997 MGI:2686324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC329706 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:329706
definition	note : apoptosis inhibitor 5 pseudogene pseudo : _no_value

name	EG545541 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545541 MGI:3645655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	LOC635737 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG668174 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668174 MGI:3643780
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	LOC668179 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC635756 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635756
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	4930529C04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619677 MGI:1922392
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 53 ESTs, 3 Proteins

name	9130204L05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229550 MGI:2684973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	LOC100042463 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Pglyrp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242100 MGI:2685266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG619750 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619750 MGI:3648400
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 224 ESTs, 5 Proteins

name	Lor (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16939 MGI:96816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A030004J04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109314 MGI:1925680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20755 MGI:1330350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042999 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042999
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 28 ESTs pseudo : _no_value

name	LOC545543 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 1087 ESTs, 4 Proteins pseudo : _no_value

name	LOC100043005 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043005
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 26 ESTs pseudo : _no_value

name	LOC545545 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 1131 ESTs, 4 Proteins pseudo : _no_value

name	LOC100042514 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042514
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 221 ESTs

name	LOC619984 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619984
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 7 Proteins pseudo : _no_value

name	Sprr2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20756 MGI:1330352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20757 MGI:1330351
definition	note : small proline-rich protein 2C pseudo : _no_value

name	Sprr2d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20758 MGI:1330347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr2e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20759 MGI:1330346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr2f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20760 MGI:1330349
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr2g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20761 MGI:1330348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Sprr2h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20762 MGI:1330343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr2i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20763 MGI:1330309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr2j (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20764 MGI:1330345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	LOC100043022 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043022
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 325 ESTs, 6 Proteins

name	Sprr2k (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20765 MGI:1330344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20754 MGI:106659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20766 MGI:1330237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042575 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	Sprr1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20753 MGI:106660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229562 MGI:2654508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042581 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042581
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Ivl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16447 MGI:96626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smcp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17235 MGI:96945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lce1a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67127 MGI:1914377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lce1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68720 MGI:1915970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620325 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Lce1a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73722 MGI:1920972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lce1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73719 MGI:1920969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lce1d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69611 MGI:1916861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043062 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043062
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 655 ESTs, 37 Proteins pseudo : _no_value

name	Pglyrp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402282 GeneID:384997 MGI:2686324
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidoglycan recognition protein 4 transcript_id : NM_207263.1

name	EG545541 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369712 GeneID:545541 MGI:3645655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : predicted gene, EG545541 transcript_id : XM_619923.3

name	LOC635737 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251268 GeneID:635737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to Protein S100-A9 (S100 calcium-binding protein A9) (Calgranulin-B) (Neutrophil cytosolic 23 kDa protein) (P23) (BEE22) transcript_id : XM_001478193.1

name	EG668174 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369713 GeneID:668174 MGI:3643780
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : predicted gene, EG668174 transcript_id : XM_994762.1

name	LOC635756 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251270 GeneID:635756
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to 60S acidic ribosomal protein P1 transcript_id : XM_001478213.1

name	9130204L05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251328 GeneID:229550 MGI:2684973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : RIKEN cDNA 9130204L05 gene transcript_id : XM_001479737.1

name	LOC100042463 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251272 GeneID:100042463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to S100 calcium-binding protein; S100RVP transcript_id : XM_001478263.1

name	Pglyrp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361343 GeneID:242100 MGI:2685266
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidoglycan recognition protein 3 transcript_id : NM_207247.2

name	EG619750 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251330 GeneID:619750 MGI:3648400
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 224 ESTs, 5 Proteins product : predicted gene, EG619750 transcript_id : XM_883948.3

name	Lor (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112293270 GeneID:16939 MGI:96816
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : loricrin transcript_id : NM_008508.2

name	A030004J04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125991229 GeneID:109314 MGI:1925680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A030004J04 gene transcript_id : NM_175424.3

name	Sprr2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85785857 GeneID:20755 MGI:1330350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2A transcript_id : NM_011468.4

name	LOC100042514 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251276 GeneID:100042514
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 221 ESTs product : hypothetical protein LOC100042514 transcript_id : XM_001478360.1

name	Sprr2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:128485450 GeneID:20756 MGI:1330352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2B transcript_id : NM_011469.3

name	Sprr2d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755631 GeneID:20758 MGI:1330347
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2D transcript_id : NM_011470.1

name	Sprr2e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981481 GeneID:20759 MGI:1330346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2E transcript_id : NM_011471.2

name	Sprr2f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49169822 GeneID:20760 MGI:1330349
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2F transcript_id : NM_011472.2

name	Sprr2h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352554 GeneID:20762 MGI:1330343
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2H transcript_id : NM_011474.3

name	Sprr2i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981478 GeneID:20763 MGI:1330309
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2I transcript_id : NM_011475.2

name	LOC100043022 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251338 GeneID:100043022
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 244 ESTs, 1 Protein product : similar to Adhesion regulating molecule 1, transcript variant 2 transcript_id : XM_001479765.1

name	LOC100043022 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251336 GeneID:100043022
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 323 ESTs, 6 Proteins product : similar to Adhesion regulating molecule 1, transcript variant 1 transcript_id : XM_001479759.1

name	Sprr2k (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778909 GeneID:20765 MGI:1330344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2K transcript_id : NM_011477.3

name	Sprr1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801970 GeneID:20754 MGI:106659
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 1B transcript_id : NM_009265.3

name	Sprr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755647 GeneID:20766 MGI:1330237
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 3 transcript_id : NM_011478.1

name	LOC100042575 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251279 GeneID:100042575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to hCG1782414 transcript_id : XM_001478452.1

name	Sprr1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61675694 GeneID:20753 MGI:106660
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 1A transcript_id : NM_009264.2

name	Sprr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27414498 GeneID:229562 MGI:2654508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 4 transcript_id : NM_173070.1

name	LOC100042581 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251281 GeneID:100042581
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : similar to CG4877-PA transcript_id : XM_001478461.1

name	Ivl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83627714 GeneID:16447 MGI:96626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : involucrin transcript_id : NM_008412.2

name	Smcp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110832841 GeneID:17235 MGI:96945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm mitochondria-associated cysteine-rich protein transcript_id : NM_008574.3

name	Lce1a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842380 GeneID:67127 MGI:1914377
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 1A1 transcript_id : NM_025984.2

name	Lce1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13386169 GeneID:68720 MGI:1915970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 1B transcript_id : NM_026822.1

name	Lce1a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270956 GeneID:73722 MGI:1920972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 1A2 transcript_id : NM_028625.2

name	Lce1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353719 GeneID:73719 MGI:1920969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 1C transcript_id : NM_028622.2

name	Lce1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802815 GeneID:69611 MGI:1916861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : late cornified envelope 1D transcript_id : NM_027137.2

name	Pglyrp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402283 CCDS:CCDS17544.1 GeneID:384997 MGI:2686324
definition	GO_function : GO:0008745 - N-acetylmuramoyl-L-alanine amidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0009253 - peptidoglycan catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : peptidoglycan recognition protein 4 protein_id : NP_997146.1

name	EG545541 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63501191 GeneID:545541 MGI:3645655
definition	codon_start : 1 product : similar to Protein S100-A9 (S100 calcium-binding protein A9) (Calgranulin-B) (Neutrophil cytosolic 23 kDa protein) (P23) (BEE22) protein_id : XP_619923.1

name	LOC635737 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251269 GeneID:635737
definition	codon_start : 1 product : similar to Protein S100-A9 (S100 calcium-binding protein A9) (Calgranulin-B) (Neutrophil cytosolic 23 kDa protein) (P23) (BEE22) protein_id : XP_001478243.1

name	EG668174 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369714 GeneID:668174 MGI:3643780
definition	codon_start : 1 product : similar to Protein S100-A9 (S100 calcium-binding protein A9) (Calgranulin-B) (Neutrophil cytosolic 23 kDa protein) (P23) (BEE22) protein_id : XP_999856.1

name	LOC635756 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251271 GeneID:635756
definition	codon_start : 1 product : similar to 60S acidic ribosomal protein P1 protein_id : XP_001478263.1

name	9130204L05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251329 GeneID:229550 MGI:2684973
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479787.1

name	LOC100042463 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251273 GeneID:100042463
definition	codon_start : 1 product : similar to S100 calcium-binding protein; S100RVP protein_id : XP_001478313.1

name	Pglyrp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402249 CCDS:CCDS17545.1 GeneID:242100 MGI:2685266
definition	GO_function : GO:0008745 - N-acetylmuramoyl-L-alanine amidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0009253 - peptidoglycan catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : peptidoglycan recognition protein 3 protein_id : NP_997130.1

name	EG619750 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82890314 GeneID:619750 MGI:3648400
definition	codon_start : 1 product : similar to macrophage migration inhibitory factor protein_id : XP_889041.1

name	Lor (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112293271 CCDS:CCDS17546.1 GeneID:16939 MGI:96816
definition	GO_component : GO:0001533 - cornified envelope [Evidence IDA]; GO:0009898 - internal side of plasma membrane [Evidence IDA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IDA]; GO:0030280 - structural constituent of epidermis [Evidence IDA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0031424 - keratinization [Evidence IEA] codon_start : 1 product : loricrin protein_id : NP_032534.2

name	A030004J04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425138 GeneID:109314 MGI:1925680
definition	codon_start : 1 product : proline rich 9 protein_id : NP_780633.1

name	Sprr2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560549 CCDS:CCDS17548.1 GeneID:20755 MGI:1330350
definition	GO_component : GO:0001533 - cornified envelope [Evidence TAS] [Evidence NAS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence TAS]; GO:0003735 - structural constituent of ribosome [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007566 - embryo implantation [Evidence TAS]; GO:0008544 - epidermis development [Evidence NAS]; GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence NAS]; GO:0042698 - menstrual cycle [Evidence TAS]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence TAS] codon_start : 1 product : small proline-rich protein 2A protein_id : NP_035598.2

name	LOC100042514 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251277 GeneID:100042514
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478410.1

name	Sprr2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:128485451 GeneID:20756 MGI:1330352
definition	GO_component : GO:0001533 - cornified envelope [Evidence NAS] GO_function : GO:0005198 - structural molecule activity [Evidence TAS] [Evidence IEA] GO_process : GO:0007566 - embryo implantation [Evidence TAS]; GO:0008544 - epidermis development [Evidence NAS]; GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence NAS]; GO:0042698 - menstrual cycle [Evidence TAS] codon_start : 1 product : small proline-rich protein 2B protein_id : NP_035599.2

name	Sprr2d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755632 GeneID:20758 MGI:1330347
definition	GO_component : GO:0001533 - cornified envelope [Evidence NAS] GO_function : GO:0005198 - structural molecule activity [Evidence TAS] [Evidence IEA] GO_process : GO:0007566 - embryo implantation [Evidence TAS]; GO:0008544 - epidermis development [Evidence NAS]; GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence NAS]; GO:0042698 - menstrual cycle [Evidence TAS] codon_start : 1 function : cornified cell envelope precursor product : small proline-rich protein 2D protein_id : NP_035600.1

name	Sprr2e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755634 GeneID:20759 MGI:1330346
definition	GO_component : GO:0001533 - cornified envelope [Evidence NAS] GO_function : GO:0005198 - structural molecule activity [Evidence TAS] [Evidence IEA] GO_process : GO:0007566 - embryo implantation [Evidence TAS]; GO:0008544 - epidermis development [Evidence NAS]; GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence NAS]; GO:0042698 - menstrual cycle [Evidence TAS] codon_start : 1 product : small proline-rich protein 2E protein_id : NP_035601.1

name	Sprr2f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755636 GeneID:20760 MGI:1330349
definition	GO_component : GO:0001533 - cornified envelope [Evidence NAS] GO_function : GO:0005198 - structural molecule activity [Evidence TAS] [Evidence IEA] GO_process : GO:0007566 - embryo implantation [Evidence TAS]; GO:0008544 - epidermis development [Evidence NAS]; GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence NAS]; GO:0042698 - menstrual cycle [Evidence TAS] codon_start : 1 product : small proline-rich protein 2F protein_id : NP_035602.1

name	Sprr2h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755640 CCDS:CCDS17553.1 GeneID:20762 MGI:1330343
definition	GO_component : GO:0001533 - cornified envelope [Evidence NAS] GO_function : GO:0005198 - structural molecule activity [Evidence TAS] [Evidence IEA] GO_process : GO:0007566 - embryo implantation [Evidence TAS]; GO:0008544 - epidermis development [Evidence NAS]; GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence NAS]; GO:0042698 - menstrual cycle [Evidence TAS] codon_start : 1 product : small proline-rich protein 2H protein_id : NP_035604.1

name	Sprr2i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755642 GeneID:20763 MGI:1330309
definition	GO_component : GO:0001533 - cornified envelope [Evidence NAS] GO_function : GO:0005198 - structural molecule activity [Evidence TAS] [Evidence IEA] GO_process : GO:0007566 - embryo implantation [Evidence TAS]; GO:0008544 - epidermis development [Evidence NAS]; GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence NAS]; GO:0042698 - menstrual cycle [Evidence TAS] codon_start : 1 product : small proline-rich protein 2I protein_id : NP_035605.1

name	LOC100043022 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251339 GeneID:100043022
definition	codon_start : 1 product : similar to Adhesion regulating molecule 1 isoform 2 protein_id : XP_001479815.1

name	LOC100043022 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251337 GeneID:100043022
definition	codon_start : 1 product : similar to Adhesion regulating molecule 1 isoform 1 protein_id : XP_001479809.1

name	Sprr2k (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778910 GeneID:20765 MGI:1330344
definition	GO_component : GO:0001533 - cornified envelope [Evidence NAS] GO_function : GO:0005198 - structural molecule activity [Evidence TAS] [Evidence IEA] GO_process : GO:0007566 - embryo implantation [Evidence TAS]; GO:0008544 - epidermis development [Evidence NAS]; GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence NAS]; GO:0042698 - menstrual cycle [Evidence TAS] codon_start : 1 product : small proline-rich protein 2K protein_id : NP_035607.2

name	Sprr1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678117 CCDS:CCDS17557.1 GeneID:20754 MGI:106659
definition	GO_component : GO:0001533 - cornified envelope [Evidence TAS] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence TAS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0031424 - keratinization [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence TAS] codon_start : 1 product : small proline-rich protein 1B protein_id : NP_033291.1

name	Sprr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755648 CCDS:CCDS17558.1 GeneID:20766 MGI:1330237
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0031424 - keratinization [Evidence IEA] codon_start : 1 product : small proline-rich protein 3 protein_id : NP_035608.1

name	LOC100042575 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251280 GeneID:100042575
definition	codon_start : 1 product : similar to hCG1782414 protein_id : XP_001478502.1

name	Sprr1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678115 CCDS:CCDS17559.1 GeneID:20753 MGI:106660
definition	GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0031424 - keratinization [Evidence IEA] codon_start : 1 product : small proline-rich protein 1A protein_id : NP_033290.1

name	Sprr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27414499 GeneID:229562 MGI:2654508
definition	GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0031424 - keratinization [Evidence IEA] codon_start : 1 product : small proline-rich protein 4 protein_id : NP_775093.1

name	LOC100042581 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251282 GeneID:100042581
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478511.1

name	Ivl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83627715 CCDS:CCDS17561.1 GeneID:16447 MGI:96626
definition	GO_component : GO:0001533 - cornified envelope [Evidence IEA] GO_process : GO:0031424 - keratinization [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence IEA] codon_start : 1 product : involucrin protein_id : NP_032438.2

name	Smcp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15011842 GeneID:17235 MGI:96945
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005741 - mitochondrial outer membrane [Evidence TAS]; GO:0005739 - mitochondrion [Evidence IEA] [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007338 - fertilization (sensu Metazoa) [Evidence IEA]; GO:0007341 - penetration of zona pellucida [Evidence IMP]; GO:0030317 - sperm motility [Evidence IMP] [Evidence IDA] codon_start : 1 note : mitochondrial capsule selenoprotein product : sperm mitochondria-associated cysteine-rich protein protein_id : NP_032600.2 transl_except : (pos:complement(92392872..92392874),aa:Sec) transl_except : (pos:complement(92392842..92392844),aa:Sec) transl_except : (pos:complement(92392791..92392793),aa:Sec)

name	Lce1a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385486 CCDS:CCDS17562.1 GeneID:67127 MGI:1914377
definition	codon_start : 1 product : small proline rich-like 3 protein_id : NP_080260.1

name	Lce1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386170 CCDS:CCDS17563.1 GeneID:68720 MGI:1915970
definition	codon_start : 1 note : small proline rich-like 5 product : late cornified envelope 1B protein_id : NP_081098.1

name	Lce1a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386334 CCDS:CCDS17564.1 GeneID:73722 MGI:1920972
definition	GO_function : GO:0042802 - identical protein binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : small proline rich-like 2 protein_id : NP_082901.1

name	Lce1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539629 GeneID:73719 MGI:1920969
definition	codon_start : 1 product : late cornified envelope 1C protein_id : NP_082898.1

name	Lce1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386200 CCDS:CCDS17566.1 GeneID:69611 MGI:1916861
definition	codon_start : 1 note : small proline rich-like 7 product : late cornified envelope 1D protein_id : NP_081413.1

name	LOC668165 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668165
definition	number : 2 pseudo : _no_value

name	LOC668165 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668165
definition	number : 1 pseudo : _no_value

name	LOC383949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383949
definition	number : 1 pseudo : _no_value

name	LOC668179 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668179
definition	number : 3 pseudo : _no_value

name	LOC668179 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668179
definition	number : 2 pseudo : _no_value

name	LOC668179 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668179
definition	number : 1 pseudo : _no_value

name	LOC620325 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620325
definition	number : 1 pseudo : _no_value

name	4930529C04Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149251327 GeneID:619677 MGI:1922392
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 53 ESTs, 3 Proteins product : RIKEN cDNA 4930529C04 gene transcript_id : XR_034353.1

name	LOC100042999 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251331 GeneID:100042999
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 28 ESTs product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_034369.1

name	LOC545543 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251274 GeneID:545543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 1087 ESTs, 4 Proteins product : similar to Ribosomal protein L3 pseudo : _no_value transcript_id : XR_033644.1

name	LOC100043005 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251332 GeneID:100043005
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 26 ESTs product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_034371.1

name	LOC545545 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251275 GeneID:545545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 1131 ESTs, 4 Proteins product : similar to Ribosomal protein L3 pseudo : _no_value transcript_id : XR_033653.1

name	LOC619984 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251278 GeneID:619984
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 7 Proteins product : similar to hCG2016451 pseudo : _no_value transcript_id : XR_033666.1

name	Sprr2g (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149251131 GeneID:20761 MGI:1330348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2G pseudo : _no_value transcript_id : XR_035715.1

name	Sprr2j (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:114688037 GeneID:20764 MGI:1330345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small proline-rich protein 2J pseudo : _no_value transcript_id : NR_003185.1

name	LOC100043062 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251346 GeneID:100043062
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 655 ESTs, 37 Proteins product : similar to 14-3-3 zeta pseudo : _no_value transcript_id : XR_034395.1

clone name	MSMg01-372B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132P10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-529O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424M14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-124B19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-058F19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-061I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358H13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-387B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298O04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-475H22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-349A02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-319L08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-212I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058O14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-319L08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-546B13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534K18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-071D17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-091K05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-052K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462A10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-081C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262A24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-159C09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-389B21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-546M15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-449C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270D24
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-289C14.b	B6Ng01-289C14.g
ACC	GA086636	GA086637
length	1,197	1,086
definition	B6Ng01-289C14.b	B6Ng01-289C14.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcttattgctgtatcaagacagacagaggatgtctacaggaatttt ctgtgcagaggtgttcttgcttaacccctccatgaattctactccttaaa ctgacacaggaattgttaacaaatcatgtgtcaggtacaaagtgtattag gcaaggtgtcccagcataagaatgtaagatctgcagctggtggtgctctc actctcactaagatcaatcaccagtacacttaagtcccatcacatctatt accaaatgtttattacctagaaagttccaccaatttaggagtttatactg gcattttcttctcaggatttcccagtcagtagcttcagtgggattcactc attagttctctccaggggaagtaatgtggagaaattaaattagaatactg gagggaacattcaattctctgcctgagacttgtgtttaaatctcttctag ttcctgtgtttgcagcctctgcaacagtaaaagccattaaccttttgcca ggccagttttcaaggaagatgccttttattcaggctaatttttatagaca aatgttggatacttctagacaaactaactgtcttatttttctgcaaaaca gaatcctagctctgaatttgaaaggctggcagaaccaaattgcaaagtat taacctctatttagtatgtttctttatgagcacaaacctcttcactttta tactcaaatgggaatcctgggccagttttactatgcatttgcattctgct gactcagtgtgcaccctaatcctttcctgggacactatcaatgctaacag tcatctttcttccaggaagtacaggaaagtccttttaagtagactataga atgaaccaaagggatcacagtgttgaagaggcttttgacatgataagaag aatgggaatgctgtaatatagggaagatgaacaacaatgctttttgaaca ttagcatcatcacattgatgtgtctggccattgaagagggtgaacataga tatgaccagcattcctaagcagagttctggaacactttcttaatatccca cccagtgttctgatttttagacagacactgaattatgtttggggtctagg gtaatgcaaaaaagtctttctccacaccagtgtttctcaatgttttctga agtcttatcttaggatttgtgatcccaaaaacaaatgtggatataca	gaattcagtaatgagtttgattattttctgccttttactactccttgttg tgcttgcttcttctagttctagaactttacttttaaactgctgatgtaga aactttgaaattactttgtgaaggcatttattcctatgaatgttgctctt ggcactgcttcccttgtggcccctatatttgggtatgatgttccttaatt ttcagtgaatactagcaacctttcatttgttgctttatttcttccctgac cacaagatcactgagtagagctttgttctgtttctattagtgtgtagtct gtgtgtagtctttcagtttttcctttgttgttgaagtacagatgagtcca tgttgggctgaaagaacatcctttgtcatttcaaatctcttgtatcactt caggcttgattgtgacccatatgaggtcaattttttttgagaaggatcct tgaggggatgagaagaagatatattcttttgggtttaggtgaaatataga ttctatagatgtctattaggtccatttgattcaccatgccaattagtttc attatttctcagtatagatttttttctggatgtcctgtcaattagtgaga ctggagtgtttaagtttgccagtattagtgagtgagtattgatgtgtgat ttaagctttaggaatcttccttttgcaaatacaggtgcccttgtgtatgg gcataggtgttcagatttgaaatatcatactggtagatttttctattgat gaccatgacatataattccctgacaccgttcatgaaatttgttgaaaggc ttctgtcaggatttttttcttttgttttttagatttaaattgttcttgac tgacattatcaatttcttacagatcatcttcggcccctgaaattgtctct ttcatttcccggtattatgatggtgatctatttttcctgttctctttccc taggtttccatttcctggactccttcaggcttgttttgttggtttgtttg tttgctggtaggtttctgatcaacttcatgtcagagtgcacagtttaatt ccatttccatcactaatttaaactacattggctcgt
quality values	Open. Hide. 41 14 19 16 58 54 58 36 52 36 47 28 40 52 43 44 38 54 41 42 47 62 54 62 47 62 47 62 47 51 32 24 21 15 14 21 34 34 38 45 51 59 62 62 46 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 56 42 54 59 59 46 59 54 54 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 49 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 44 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 56 56 62 62 62 62 62 56 62 62 62 62 62 56 47 47 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 54 62 62 62 54 62 62 62 52 62 62 62 47 54 62 62 62 62 62 62 62 52 62 62 62 62 62 54 54 46 54 54 54 58 58 58 54 52 46 58 58 58 58 58 58 45 54 54 58 58 58 54 58 58 58 54 32 54 54 58 52 47 52 58 44 52 54 52 54 54 54 54 58 52 58 54 58 52 54 58 58 54 54 58 58 42 58 50 54 58 58 47 42 52 58 54 42 54 32 58 48 58 58 58 54 50 58 58 50 54 41 41 45 52 50 51 58 53 58 53 49 38 58 50 41 39 50 49 51 58 58 58 58 50 49 58 52 40 42 58 58 42 49 47 48 44 47 50 54 54 49 49 58 52 39 28 50 54 58 58 25 22 49 50 48 51 52 50 49 32 43 50 58 49 44 44 46 50 51 50 54 51 49 37 54 46 41 36 58 58 52 39 36 28 33 41 46 41 39 29 58 39 52 53 39 46 52 53 53 50 51 49 50 39 25 53 53 41 24 41 58 53 52 49 39 49 49 42 34 50 38 45 34 47 42 54 28 31 42 30 49 50 51 35 24 32 29 33 39 34 39 23 42 37 52 40 35 21 37 40 32 52 38 42 33 42 34 51 54 33 41 54 37 24 31 20 19 24 54 32 31 34 37 42 25 9 35 29 51 39 28 17 13 10 5 12 32 15 19 42 26 33 31 25 31 31 36 34 34 27 22 31 28 28 32 26 33 23 22 32 45 41 9 40 22 24 26 33 33 31 30 30 30 28 12 33 29 26 28 9 40 8 30 23 31 42 46 37 31 30 24 19 31 31 31 31 27 33 27 42 38 30 46 9 9 31 46 15 26 32 26 31 31 25 29 31 34 37 32 24 15 26 18 40 6 17 31 14 30 13 16 25 36 27 33 27 30 30 18 23 41 33 25 39 36 36 12 16 30 29 26 26 33 18 31 19 42 32 32 32 16 17 30 33 32 28 23 19 32 15 21 32 25 29 27 31 11 21 17 14 33 11 8 13 17 26 30 14 31 26 48 24 20 25 31 18 16 16 21 13 14 17 17 16 30 18 37 11 26 25 32 25 21 24 20 21 19 18 21 25 19 23 18 8 24 13 33 15 22 23 14 24 12 7 7 7 24 20 33 25 11 18 5 5 4 7 6 19 16 29 25 6 7 10 15 20 10 7 10 18 21 9 16 11 20 4 5 5 5 8 10 6 3 3 3 6 7 5 5 14 24 12 27 8 3 6 24 10 24 15 27 8 14 27 19 17 4 6 10 18 20 30 20 15 14 9 8 24 5 25 30 30 28 25 12 5 9 10 9 30 13 12 13 14 19 5 5 12 5 10 1 2 3 9 5 18 7 14 7 12 6 22 8 9 4 18 26 11 9 4 4 3 14 1 1 2 1 3 7 6 4 5 9 10 4 6 3 3 2 4 6 7 4 2 3 2 13 6 1 2 2 3 4 4 10 17 12 7 21 5 5 5 8 6 11 5 7 7 7	Open. Hide. 62 47 42 47 62 59 59 62 62 51 24 24 28 28 23 43 51 62 54 54 49 59 62 62 62 62 62 62 62 59 62 62 62 54 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 48 38 56 59 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 49 49 62 62 62 62 54 47 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 54 62 62 62 62 62 62 49 62 62 62 62 54 47 62 62 56 62 62 56 62 62 62 54 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 56 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 53 62 62 62 62 47 43 62 62 35 62 54 54 58 58 58 45 39 58 58 58 54 58 58 58 58 54 50 58 54 58 54 58 58 54 58 32 39 15 14 29 34 58 58 58 52 58 58 58 58 58 58 52 54 58 58 45 39 58 52 54 58 54 58 58 54 42 52 49 39 47 52 58 58 58 52 54 46 58 58 43 58 52 58 58 52 58 58 53 53 53 58 58 58 53 41 50 35 51 54 42 41 47 50 46 51 58 54 54 54 58 58 52 58 33 42 50 51 42 41 51 50 58 51 54 29 21 58 37 37 51 42 50 46 58 40 42 29 53 54 41 50 52 41 32 51 54 47 46 49 32 25 33 31 44 48 41 35 48 35 29 58 50 52 42 26 39 50 49 44 51 53 50 38 45 28 58 24 32 41 42 47 14 51 39 51 40 49 39 50 29 53 26 36 36 37 50 54 53 53 53 42 37 25 53 53 50 49 49 38 37 42 39 31 16 54 54 54 25 39 33 39 34 34 51 35 35 40 42 22 53 41 42 37 53 40 29 35 38 33 45 42 47 31 25 54 54 26 35 35 29 20 17 36 37 31 28 31 31 28 39 52 54 31 23 54 47 47 27 28 12 18 47 12 8 46 15 46 23 29 31 53 36 45 20 25 15 31 29 52 51 51 49 51 29 31 23 49 46 31 42 41 51 51 51 51 23 31 24 51 33 51 34 30 51 42 20 42 42 22 17 35 20 27 29 30 24 31 31 43 32 26 35 12 12 30 22 9 46 41 46 43 27 25 20 30 15 12 20 30 34 25 31 34 32 33 30 17 12 10 9 32 42 31 30 25 27 41 21 13 11 25 29 35 32 43 27 46 12 31 19 30 33 36 20 46 12 33 37 9 27 33 24 36 31 32 43 28 37 46 26 31 23 20 34 31 31 21 41 44 38 25 7 25 12 24 9 17 31 27 21 8 44 10 6 41 31 9 15 25 11 25 33 28 14 26 16 35 44 32 16 22 21 23 25 22 15 15 29 29 11 12 21 6 13 23 20 10 10 4 4 19 36 26 11 9 28 6 8 10 24 8 31 11 36 16 11 8 34 7 31 7 21 18 17 13 5 21 10 3 10 25 9 16 13 24 6 5 3 8 8 20 9 28 14 4 19 7 27 27 21 5 3 6 8 16 5 5 4 13 9 26 11 6 5 8 5 5 6 8 24 18 11 5 3 8 21 10 4 5 4 4 15 22 19 7 14 21 5 3 3 3 6 10 15 5 8 4 4 3 4 4 16

Alignment Information

BAC End 1

BAC End 2

seq1: chr3_91503158_91504348
seq2: B6Ng01-289C14.b_43_1239 (reverse)

seq1  TGTAT---CACATTTG-TCTGGGAAGCACAAATCCTAAGAT-AGACTTCA  45
      |||||   |||||||| | | || | ||||||||||||||| ||||||||
seq2  TGTATATCCACATTTGTTTTTGGGATCACAAATCCTAAGATAAGACTTCA  50

seq1  G-AAACATTGAG-AACACTGGTGTGGAGAAAGACTTTTTTCCATTACCCT  93
      | |||||||||| ||||||||||||||||||||||||||| |||||||||
seq2  GAAAACATTGAGAAACACTGGTGTGGAGAAAGACTTTTTTGCATTACCCT  100

seq1  AGACCCCCAAACATAATTTCAGTGTCTGTTTCTATATATTTCAGAAACAC  143
      ||| |||||||||||| |||||||||||  |||| | |  |||| |||||
seq2  AGA-CCCCAAACATAA-TTCAGTGTCTG--TCTAAAAA--TCAG-AACAC  143

seq1  T-GGTGGGATA-TAAGAAAGGTGTCCAGAACTCTTGCTTAGGAATGCTGG  191
      | ||||||||| ||||||||   |||||||||| ||||||||||||||||
seq2  TGGGTGGGATATTAAGAAAGTGTTCCAGAACTC-TGCTTAGGAATGCTGG  192

seq1  TCATATCTATGTTCACCCTCTTC-ATGGCCAGACACATCAATGTGATGAT  240
      ||||||||||||||||||||||| ||||||||||||||||||||||||||
seq2  TCATATCTATGTTCACCCTCTTCAATGGCCAGACACATCAATGTGATGAT  242

seq1  GCTAATGTTC-AAAAGCATTGTTGTTCATCTT-CCTATATTACAGCATTC  288
      |||||||||| ||||||||||||||||||||| |||||||||||||||||
seq2  GCTAATGTTCAAAAAGCATTGTTGTTCATCTTCCCTATATTACAGCATTC  292

seq1  CCATTCTTCTTATCATGTCAAAAGCCTCTTCAACACTGTGAT-CCTTTGG  337
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  CCATTCTTCTTATCATGTCAAAAGCCTCTTCAACACTGTGATCCCTTTGG  342

seq1  TTCATTCTATAGTCTACTT-AAAGGACTTTCCTGTACTTCCTGGAAGAAA  386
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  TTCATTCTATAGTCTACTTAAAAGGACTTTCCTGTACTTCCTGGAAGAAA  392

seq1  GATGACTGTTAGCATTGATAGTGTCCCAGGAAAGGATTAGGGTGCACACT  436
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGACTGTTAGCATTGATAGTGTCCCAGGAAAGGATTAGGGTGCACACT  442

seq1  GAGTCAGCAGAATGCAAATGCATAGTAAAACTGGCCCAGGATTCCCATTT  486
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTCAGCAGAATGCAAATGCATAGTAAAACTGGCCCAGGATTCCCATTT  492

seq1  GAGTATAAAAGTGAAGAGGTTTGTGCTCATAAAGAAACATACTAAATAGA  536
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTATAAAAGTGAAGAGGTTTGTGCTCATAAAGAAACATACTAAATAGA  542

seq1  GGTTAATACTTTGCAATTTGGTTCTGCCAGCCTTTCAAATTCAGAGCTAG  586
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTAATACTTTGCAATTTGGTTCTGCCAGCCTTTCAAATTCAGAGCTAG  592

seq1  GATTCTGTTTTGCAGAAAAATAAGACAGTTAGTTTGTCTAGAAGTATCCA  636
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTCTGTTTTGCAGAAAAATAAGACAGTTAGTTTGTCTAGAAGTATCCA  642

seq1  ACATTTGTCTATAAAAATTAGCCTGAATAAAAGGCATCTTCCTTGAAAAC  686
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTTGTCTATAAAAATTAGCCTGAATAAAAGGCATCTTCCTTGAAAAC  692

seq1  TGGCCTGGCAAAAGGTTAATGGCTTTTACTGTTGCAGAGGCTGCAAACAC  736
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCCTGGCAAAAGGTTAATGGCTTTTACTGTTGCAGAGGCTGCAAACAC  742

seq1  AGGAACTAGAAGAGATTTAAACACAAGTCTCAGGCAGAGAATTGAATGTT  786
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAACTAGAAGAGATTTAAACACAAGTCTCAGGCAGAGAATTGAATGTT  792

seq1  CCCTCCAGTATTCTAATTTAATTTCTCCACATTACTTCCCCTGGAGAGAA  836
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCCAGTATTCTAATTTAATTTCTCCACATTACTTCCCCTGGAGAGAA  842

seq1  CTAATGAGTGAATCCCACTGAAGCTACTGACTGGGAAATCCTGAGAAGAA  886
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAATGAGTGAATCCCACTGAAGCTACTGACTGGGAAATCCTGAGAAGAA  892

seq1  AATGCCAGTATAAACTCCTAAATTGGTGGAACTTTCTAGGTAATAAACAT  936
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGCCAGTATAAACTCCTAAATTGGTGGAACTTTCTAGGTAATAAACAT  942

seq1  TTGGTAATAGATGTGATGGGACTTAAGTGTACTGGTGATTGATCTTAGTG  986
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTAATAGATGTGATGGGACTTAAGTGTACTGGTGATTGATCTTAGTG  992

seq1  AGAGTGAGAGCACCACCAGCTGCAGATCTTACATTCTTATGCTGGGACAC  1036
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGTGAGAGCACCACCAGCTGCAGATCTTACATTCTTATGCTGGGACAC  1042

seq1  CTTGCCTAATACACTTTGTACCTGACACATGATTTGTTAACAATTCCTGT  1086
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGCCTAATACACTTTGTACCTGACACATGATTTGTTAACAATTCCTGT  1092

seq1  GTCAGTTTAAGGAGTAGAATTCATGGAGGGGTTAAGCAAGAACACCTCTG  1136
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAGTTTAAGGAGTAGAATTCATGGAGGGGTTAAGCAAGAACACCTCTG  1142

seq1  CACAGAAAATTCCTGTAGACATCCTCTGTCTGTCTTGATACAGCAATAAG  1186
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGAAAATTCCTGTAGACATCCTCTGTCTGTCTTGATACAGCAATAAG  1192

seq1  AATTC  1191
      |||||
seq2  AATTC  1197

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information