MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-302O13
Chromosome	3 (Build37)
Map Location	94,687,988 - 94,689,108
singlet/doublet	singlet
Overlap gene	Psmb4
Upstream gene	LOC668344, EG668346, Tdpoz5, EG668353, EG668356, LOC668359, LOC100042761, LOC433624, LOC668367, LOC433625, LOC100043188, EG383977, EG245290, EG668385, EG212727, Them4, Them5, Gm659, Rorc, Lingo4, Tdrkh, Oaz3, Mrpl9, LOC668403, 2310007A19Rik, Tnrc4, Snx27, LOC100043228, EG668409, Tuft1, LOC100042793, BC021767, Selenbp2, LOC100042801, Cgn, Pogz
Downstream gene	Selenbp1, Rfx5, Pik4cb, Zfp687, Psmd4, Pip5k1a, Vps72, Tmod4, Scnm1, Lysmd1, Tnfaip8l2, LOC668436, Sema6c, Gabpb2, Mllt11, Cdc42se1, Gm128, Bnipl, Prune, 4930504E06Rik, Anxa9, Lass2, Setdb1, LOC100043294, 4930558C23Rik, LOC277589, LOC668448, LOC100043305, Arnt, Ctsk, Ctss, LOC100043312, Hormad1, Golph3l, EG668457, Ensa, Mcl1, Adamtsl4, Ecm1, Tars2, 4930535B03Rik, LOC100043327, Prpf3, Mrps21, LOC100042889, Gm129, BC028528
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC668344 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 20 Proteins

name	EG668346 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668346 MGI:3704095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 9 ESTs, 22 Proteins

name	Tdpoz5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399676 MGI:3027905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668353 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668353 MGI:3644976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 19 Proteins

name	EG668356 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668356 MGI:3644979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	LOC668359 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 9 ESTs, 22 Proteins

name	LOC100042761 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 18 Proteins pseudo : _no_value

name	LOC433624 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433624
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 20 Proteins

name	LOC668367 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668367
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 21 Proteins pseudo : _no_value

name	LOC433625 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 19 Proteins pseudo : _no_value

name	LOC100043188 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043188
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 21 Proteins

name	EG383977 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383977 MGI:3644284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	EG245290 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245290 MGI:3646925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 Proteins

name	EG668385 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668385 MGI:3643267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	EG212727 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212727 MGI:3643869
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	Them4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75778 MGI:1923028
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Them5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66198 MGI:1913448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm659 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271944 MGI:2685505
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins

name	Rorc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19885 MGI:104856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lingo4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320747 MGI:2444651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tdrkh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72634 MGI:1919884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oaz3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53814 MGI:1858170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78523 MGI:2137211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668403 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 6 Proteins pseudo : _no_value

name	2310007A19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66353 MGI:1913603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnrc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78784 MGI:1926034
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76742 MGI:1923992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043228 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 2 Proteins pseudo : _no_value

name	EG668409 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668409 MGI:3646595
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 596 ESTs, 5 Proteins pseudo : _no_value

name	Tuft1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22156 MGI:109572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042793 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	BC021767 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545551 MGI:3615512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 66 ESTs, 5 Proteins

name	Selenbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20342 MGI:104859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042801 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042801
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Cgn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70737 MGI:1927237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 103 ESTs, 5 Proteins

name	Pogz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229584 MGI:2442117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19172 MGI:1098257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Selenbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20341 MGI:96825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rfx5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53970 MGI:1858421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pik4cb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107650 MGI:1334433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp687 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78266 MGI:1925516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19185 MGI:1201670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pip5k1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18720 MGI:107929
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps72 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21427 MGI:1202305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmod4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50874 MGI:1355285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scnm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69269 MGI:1341284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lysmd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217779 MGI:1919409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tnfaip8l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69769 MGI:1917019
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668436 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 129 ESTs, 1 Protein pseudo : _no_value

name	Sema6c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20360 MGI:1338032
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gabpb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213054 MGI:95612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mllt11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56772 MGI:1929671
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc42se1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57912 MGI:1889510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gm128 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229588 MGI:2684974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bnipl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171388 MGI:2384749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prune (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229589 MGI:1925152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930504E06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75007 MGI:1922257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anxa9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71790 MGI:1923711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lass2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76893 MGI:1924143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Setdb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84505 MGI:1934229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043294 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	4930558C23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67654 MGI:1914904
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs

name	LOC277589 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:277589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 865 ESTs, 7 Proteins pseudo : _no_value

name	LOC668448 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 46 ESTs, 3 Proteins pseudo : _no_value

name	LOC100043305 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Arnt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11863 MGI:88071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ctsk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13038 MGI:107823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctss (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13040 MGI:107341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043312 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043312
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 364 ESTs, 12 Proteins pseudo : _no_value

name	Hormad1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67981 MGI:1915231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Golph3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229593 MGI:1917129
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668457 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668457 MGI:3644167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 1333 ESTs, 7 Proteins

name	Ensa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56205 MGI:1891189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mcl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17210 MGI:101769
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adamtsl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229595 MGI:2389008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ecm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13601 MGI:103060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tars2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71807 MGI:1919057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930535B03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75137 MGI:1922387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043327 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Prpf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70767 MGI:1918017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66292 MGI:1913542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042889 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	Gm129 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229599 MGI:2684975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC028528 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229600 MGI:2385885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668344 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251360 GeneID:668344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 20 Proteins product : similar to Tdpoz5 protein transcript_id : XM_001479907.1

name	EG668346 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369762 GeneID:668346 MGI:3704095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 9 ESTs, 22 Proteins product : predicted gene, EG668346 transcript_id : XM_001001033.1

name	Tdpoz5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402302 GeneID:399676 MGI:3027905
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TD and POZ domain containing 5 transcript_id : NM_207273.1

name	EG668353 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369764 GeneID:668353 MGI:3644976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 19 Proteins product : predicted gene, EG668353 transcript_id : XM_001001069.1

name	EG668356 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369766 GeneID:668356 MGI:3644979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG668356 transcript_id : XM_001001083.1

name	LOC668359 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94369768 GeneID:668359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 9 ESTs, 22 Proteins product : similar to TD and POZ domain containing 1 transcript_id : XM_001001094.1

name	LOC433624 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251368 GeneID:433624
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 20 Proteins product : similar to Tdpoz5 protein transcript_id : XM_001479931.1

name	LOC100043188 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251371 GeneID:100043188
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 21 Proteins product : similar to Tdpoz5 protein transcript_id : XM_001479934.1

name	EG383977 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82890390 GeneID:383977 MGI:3644284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG383977 transcript_id : XM_357358.3

name	EG245290 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38077895 GeneID:245290 MGI:3646925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 Proteins product : predicted gene, EG245290 transcript_id : XM_142982.3

name	EG212727 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51708306 GeneID:212727 MGI:3643869
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : predicted gene, EG212727 transcript_id : XM_143402.4

name	Them4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626049 GeneID:75778 MGI:1923028
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioesterase superfamily member 4 transcript_id : NM_029431.1

name	Them5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372271 GeneID:66198 MGI:1913448
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioesterase superfamily member 5 transcript_id : NM_025416.2

name	Gm659 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251306 GeneID:271944 MGI:2685505
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins product : gene model 659, (NCBI) transcript_id : XM_001001226.2

name	Rorc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755343 GeneID:19885 MGI:104856
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAR-related orphan receptor gamma transcript_id : NM_011281.1

name	Lingo4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343168 GeneID:320747 MGI:2444651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat and Ig domain containing 4 transcript_id : NM_177250.2

name	Tdrkh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625941 GeneID:72634 MGI:1919884
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tudor and KH domain containing protein transcript_id : NM_028307.1

name	Oaz3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8567381 GeneID:53814 MGI:1858170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ornithine decarboxylase antizyme 3 transcript_id : NM_016901.1

name	Mrpl9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130689 GeneID:78523 MGI:2137211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L9 transcript_id : NM_030116.2

name	2310007A19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115292447 GeneID:66353 MGI:1913603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310007A19 gene transcript_id : NM_025506.2

name	Tnrc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892434 GeneID:78784 MGI:1926034
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trinucleotide repeat containing 4 transcript_id : NM_172434.2

name	Snx27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126722909 GeneID:76742 MGI:1923992
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin family member 27 transcript_id : NM_029721.1

name	Snx27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723791 GeneID:76742 MGI:1923992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin family member 27 transcript_id : NM_001082484.1

name	Tuft1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130085 GeneID:22156 MGI:109572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tuftelin 1 transcript_id : NM_011656.2

name	LOC100042793 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251309 GeneID:100042793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100042793 transcript_id : XM_001478831.1

name	BC021767 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369775 GeneID:545551 MGI:3615512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 66 ESTs, 5 Proteins product : cDNA sequence BC021767 transcript_id : XM_619932.3

name	Selenbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130755 GeneID:20342 MGI:104859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : selenium binding protein 2 transcript_id : NM_019414.2

name	LOC100042801 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251311 GeneID:100042801
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to tuftelin transcript_id : XM_001478841.1

name	Cgn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251313 GeneID:70737 MGI:1927237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 103 ESTs, 5 Proteins product : cingulin transcript_id : XM_001001375.2

name	Pogz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142355637 GeneID:229584 MGI:2442117
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pogo transposable element with ZNF domain transcript_id : NM_172683.2

name	Psmb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803332 GeneID:19172 MGI:1098257
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, beta type 4 transcript_id : NM_008945.2

name	Selenbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130509 GeneID:20341 MGI:96825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : selenium binding protein 1 transcript_id : NM_009150.3

name	Rfx5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71037396 GeneID:53970 MGI:1858421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulatory factor X, 5 (influences HLA class II expression) transcript_id : NM_017395.2

name	Pik4cb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29648331 GeneID:107650 MGI:1334433
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol 4-kinase, catalytic, beta polypeptide transcript_id : NM_175356.1

name	Zfp687 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373364 GeneID:78266 MGI:1925516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 687 transcript_id : NM_030074.2

name	Psmd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679504 GeneID:19185 MGI:1201670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 transcript_id : NM_008951.1

name	Pip5k1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982832 GeneID:18720 MGI:107929
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha transcript_id : NM_008847.2

name	Vps72 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83921606 GeneID:21427 MGI:1202305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 72 (yeast) transcript_id : NM_009336.2

name	Tmod4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131109 GeneID:50874 MGI:1355285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tropomodulin 4 transcript_id : NM_016712.2

name	Scnm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037154 GeneID:69269 MGI:1341284
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sodium channel modifier 1 transcript_id : NM_027013.1

name	Lysmd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23821020 GeneID:217779 MGI:1919409
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LysM, putative peptidoglycan-binding, domain containing 1 transcript_id : NM_153121.1

name	Lysmd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364209 GeneID:217779 MGI:1919409
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LysM, putative peptidoglycan-binding, domain containing 1 transcript_id : NM_028134.2

name	Tnfaip8l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802951 GeneID:69769 MGI:1917019
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor, alpha-induced protein 8-like 2 transcript_id : NM_027206.2

name	Sema6c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755463 GeneID:20360 MGI:1338032
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C transcript_id : NM_011351.1

name	Gabpb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301202 GeneID:213054 MGI:95612
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GA repeat binding protein, beta 2 transcript_id : NM_172512.2

name	Gabpb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301211 GeneID:213054 MGI:95612
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GA repeat binding protein, beta 2 transcript_id : NM_029885.1

name	Mllt11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803083 GeneID:56772 MGI:1929671
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 transcript_id : NM_019914.3

name	Cdc42se1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385820 GeneID:57912 MGI:1889510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC42 small effector 1 transcript_id : NM_172395.2

name	Cdc42se1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803404 GeneID:57912 MGI:1889510
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC42 small effector 1 transcript_id : NM_001038708.2

name	Gm128 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802297 GeneID:229588 MGI:2684974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 128, (NCBI) transcript_id : NM_001024841.3

name	Bnipl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527417 GeneID:171388 MGI:2384749
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL2/adenovirus E1B 19kD interacting protein like transcript_id : NM_134253.1

name	Prune (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254234 GeneID:229589 MGI:1925152
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prune homolog (Drosophila) transcript_id : NM_173347.2

name	4930504E06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802760 GeneID:75007 MGI:1922257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930504E06 gene transcript_id : NM_133858.3

name	Anxa9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13487918 GeneID:71790 MGI:1923711
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : annexin A9 transcript_id : NM_023628.1

name	Lass2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22095014 GeneID:76893 MGI:1924143
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : longevity assurance homolog 2 (S. cerevisiae) transcript_id : NM_029789.1

name	Setdb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51092286 GeneID:84505 MGI:1934229
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET domain, bifurcated 1 transcript_id : NM_018877.2

name	LOC100043294 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251378 GeneID:100043294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : similar to NonO/p54nrb homolog transcript_id : XM_001480122.1

name	4930558C23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251317 GeneID:67654 MGI:1914904
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs product : RIKEN cDNA 4930558C23 gene transcript_id : XM_001478961.1

name	LOC100043305 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251381 GeneID:100043305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to ESET protein transcript_id : XM_001480125.1

name	Arnt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83627708 GeneID:11863 MGI:88071
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aryl hydrocarbon receptor nuclear translocator transcript_id : NM_001037737.1

name	Arnt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379121 GeneID:11863 MGI:88071
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aryl hydrocarbon receptor nuclear translocator transcript_id : NM_009709.3

name	Ctsk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352209 GeneID:13038 MGI:107823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin K transcript_id : NM_007802.3

name	Ctss (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946581 GeneID:13040 MGI:107341
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin S transcript_id : NM_021281.1

name	Hormad1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802480 GeneID:67981 MGI:1915231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HORMA domain containing 1 transcript_id : NM_026489.2

name	Golph3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543170 GeneID:229593 MGI:1917129
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi phosphoprotein 3-like transcript_id : NM_146133.2

name	EG668457 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251386 GeneID:668457 MGI:3644167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 1333 ESTs, 7 Proteins product : predicted gene, EG668457 transcript_id : XM_001001572.2

name	Ensa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061456 GeneID:56205 MGI:1891189
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endosulfine alpha transcript_id : NM_019561.2

name	Ensa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061465 GeneID:56205 MGI:1891189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endosulfine alpha transcript_id : NM_001026212.1

name	Mcl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892763 GeneID:17210 MGI:101769
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid cell leukemia sequence 1 transcript_id : NM_008562.3

name	Adamtsl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30089696 GeneID:229595 MGI:2389008
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADAMTS-like 4 transcript_id : NM_144899.2

name	Ecm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681256 GeneID:13601 MGI:103060
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : extracellular matrix protein 1 transcript_id : NM_007899.1

name	Tars2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350271 GeneID:71807 MGI:1919057
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : threonyl-tRNA synthetase 2, mitochondrial (putative) transcript_id : NM_027931.2

name	4930535B03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486840 GeneID:75137 MGI:1922387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930535B03 gene transcript_id : NM_001081293.1

name	LOC100043327 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251387 GeneID:100043327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to HSPC016 transcript_id : XM_001480208.1

name	Prpf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802030 GeneID:70767 MGI:1918017
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PRP3 pre-mRNA processing factor 3 homolog (yeast) transcript_id : NM_027541.3

name	Mrps21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982593 GeneID:66292 MGI:1913542
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S21 transcript_id : NM_078479.2

name	LOC100042889 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251322 GeneID:100042889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100042889 transcript_id : XM_001479000.1

name	Gm129 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701803 GeneID:229599 MGI:2684975
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 129, (NCBI) transcript_id : NM_001033302.1

name	BC028528 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23943800 GeneID:229600 MGI:2385885
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC028528 transcript_id : NM_153513.1

name	LOC668344 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251361 GeneID:668344
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479957.1

name	EG668346 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369763 GeneID:668346 MGI:3704095
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001033.1

name	Tdpoz5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402303 CCDS:CCDS17588.1 GeneID:399676 MGI:3027905
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : TD and POZ domain containing gene 5 product : TD and POZ domain containing 5 protein_id : NP_997156.1

name	EG668353 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369765 GeneID:668353 MGI:3644976
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001069.1

name	EG668356 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369767 GeneID:668356 MGI:3644979
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001083.1

name	LOC668359 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94369769 GeneID:668359
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001094.1

name	LOC433624 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251369 GeneID:433624
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479981.1

name	LOC100043188 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251372 GeneID:100043188
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479984.1

name	EG383977 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82890391 GeneID:383977 MGI:3644284
definition	codon_start : 1 product : hypothetical protein protein_id : XP_357358.3

name	EG245290 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38077896 GeneID:245290 MGI:3646925
definition	codon_start : 1 product : similar to TDPOZ3 protein_id : XP_142982.3

name	EG212727 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51708307 GeneID:212727 MGI:3643869
definition	codon_start : 1 product : hypothetical protein protein_id : XP_143402.4

name	Them4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626050 GeneID:75778 MGI:1923028
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA] codon_start : 1 note : carboxyl-terminal modulator protein product : thioesterase superfamily member 4 protein_id : NP_083707.1

name	Them5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539589 CCDS:CCDS17590.1 GeneID:66198 MGI:1913448
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA] codon_start : 1 product : thioesterase superfamily member 5 protein_id : NP_079692.1

name	Gm659 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251307 GeneID:271944 MGI:2685505
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001226.2

name	Rorc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755344 CCDS:CCDS17591.1 GeneID:19885 MGI:104856
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IMP]; GO:0048535 - lymph node development [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : thymus orphan receptor product : RAR-related orphan receptor gamma protein_id : NP_035411.1

name	Lingo4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789433 CCDS:CCDS17592.1 GeneID:320747 MGI:2444651
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat neuronal 6D protein_id : NP_796224.1

name	Tdrkh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625942 GeneID:72634 MGI:1919884
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : tudor and KH domain containing protein protein_id : NP_082583.1

name	Oaz3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567382 GeneID:53814 MGI:1858170
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0004857 - enzyme inhibitor activity [Evidence IEA]; GO:0008073 - ornithine decarboxylase inhibitor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006595 - polyamine metabolism [Evidence TAS] codon_start : 1 note : protein translation dependent on +1 ribosomal frameshift; ornithine decarboxylase antizyme 2; Oaz t; ornithine decarboxylase antizyme in testis; antizyme 3 product : ornithine decarboxylase antizyme 3 protein_id : NP_058597.1 ribosomal_slippage : _no_value

name	Mrpl9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789253 CCDS:CCDS17593.1 GeneID:78523 MGI:2137211
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein L9 protein_id : NP_084392.1

name	2310007A19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313514 GeneID:66353 MGI:1913603
definition	codon_start : 1 product : hypothetical protein LOC66353 protein_id : NP_079782.1

name	Tnrc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369577 GeneID:78784 MGI:1926034
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : CUG-BP and ETR-3 like factor 3 protein_id : NP_766022.1

name	Snx27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723792 GeneID:76742 MGI:1923992
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : sorting nexin family member 27 isoform 1 protein_id : NP_001075953.1

name	Snx27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126722910 GeneID:76742 MGI:1923992
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : sorting nexin family member 27 isoform 2 protein_id : NP_083997.1

name	Tuft1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755903 CCDS:CCDS17595.1 GeneID:22156 MGI:109572
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030345 - structural constituent of tooth enamel [Evidence ISS] GO_process : GO:0030282 - bone mineralization [Evidence ISS]; GO:0042476 - odontogenesis [Evidence ISS]; GO:0001503 - ossification [Evidence IEA] codon_start : 1 product : tuftelin 1 protein_id : NP_035786.1

name	LOC100042793 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251310 GeneID:100042793
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478881.1

name	BC021767 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369776 GeneID:545551 MGI:3615512
definition	codon_start : 1 product : similar to Cgn protein protein_id : XP_619932.3

name	Selenbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507079 GeneID:20342 MGI:104859
definition	GO_function : GO:0008430 - selenium binding [Evidence IEA] codon_start : 1 note : acetaminophen-binding protein product : selenium binding protein 2 protein_id : NP_062287.1

name	LOC100042801 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251312 GeneID:100042801
definition	codon_start : 1 product : similar to tuftelin protein_id : XP_001478891.1

name	Cgn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251314 GeneID:70737 MGI:1927237
definition	codon_start : 1 product : cingulin protein_id : XP_001001375.2

name	Pogz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369994 CCDS:CCDS17596.1 GeneID:229584 MGI:2442117
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA] codon_start : 1 exception : mismatches in translation product : pogo transposable element with ZNF domain protein_id : NP_766271.1

name	Psmb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45592932 CCDS:CCDS17597.1 GeneID:19172 MGI:1098257
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : proteasome beta 4 subunit protein_id : NP_032971.1

name	Selenbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22164798 GeneID:20341 MGI:96825
definition	GO_function : GO:0008430 - selenium binding [Evidence TAS] codon_start : 1 product : selenium binding protein 1 protein_id : NP_033176.2

name	Rfx5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71037397 CCDS:CCDS17598.1 GeneID:53970 MGI:1858421
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : regulatory factor X, 5 protein_id : NP_059091.2

name	Pik4cb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29648332 CCDS:CCDS17599.1 GeneID:107650 MGI:1334433
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0004430 - 1-phosphatidylinositol 4-kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : phosphatidylinositol 4-kinase, catalytic, beta polypeptide protein_id : NP_780565.1

name	Zfp687 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229259 CCDS:CCDS17600.1 GeneID:78266 MGI:1925516
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 687 protein_id : NP_084350.1

name	Psmd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679505 GeneID:19185 MGI:1201670
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : anti secretory factor 1; multiubiquitin-chain-binding protein product : proteasome 26S non-ATPase subunit 4 protein_id : NP_032977.1

name	Pip5k1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982833 GeneID:18720 MGI:107929
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016308 - 1-phosphatidylinositol-4-phosphate 5-kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046488 - phosphatidylinositol metabolism [Evidence IDA] codon_start : 1 note : PI4P5K-I[a] product : phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha protein_id : NP_032873.2

name	Vps72 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921607 GeneID:21427 MGI:1202305
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : transcription factor-like 1 protein_id : NP_033362.2

name	Tmod4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710104 CCDS:CCDS17601.1 GeneID:50874 MGI:1355285
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005523 - tropomyosin binding [Evidence IEA] codon_start : 1 note : skeletal tropomodulin product : tropomodulin 4 protein_id : NP_057921.1

name	Scnm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037155 GeneID:69269 MGI:1341284
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0008380 - RNA splicing [Evidence IMP] codon_start : 1 exception : unclassified translation discrepancy product : sodium channel modifier 1 protein_id : NP_081289.1

name	Lysmd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24496761 CCDS:CCDS17602.1 GeneID:217779 MGI:1919409
definition	GO_process : GO:0016998 - cell wall catabolism [Evidence IEA] codon_start : 1 product : LysM, putative peptidoglycan-binding, domain containing 1 protein_id : NP_082410.1

name	Lysmd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23821021 CCDS:CCDS17602.1 GeneID:217779 MGI:1919409
definition	GO_process : GO:0016998 - cell wall catabolism [Evidence IEA] codon_start : 1 product : LysM, putative peptidoglycan-binding, domain containing 1 protein_id : NP_694761.1

name	Tnfaip8l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312410 CCDS:CCDS17603.1 GeneID:69769 MGI:1917019
definition	codon_start : 1 product : tumor necrosis factor, alpha-induced protein 8-like 2 protein_id : NP_081482.1

name	Sema6c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755464 CCDS:CCDS17604.1 GeneID:20360 MGI:1338032
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 note : Sema Y; m-Sema Y product : sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C protein_id : NP_035481.1

name	Gabpb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301212 GeneID:213054 MGI:95612
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IDA] codon_start : 1 product : GA repeat binding protein, beta 2 protein_id : NP_084161.1

name	Gabpb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369712 CCDS:CCDS17605.1 GeneID:213054 MGI:95612
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IDA] codon_start : 1 product : GA repeat binding protein, beta 2 protein_id : NP_766100.1

name	Mllt11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910124 GeneID:56772 MGI:1929671
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : zinc finger protein 692 product : ALL1-fused gene from chromosome 1q protein_id : NP_064298.1

name	Cdc42se1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781706 GeneID:57912 MGI:1889510
definition	GO_component : GO:0005938 - cell cortex [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0046329 - negative regulation of JNK cascade [Evidence ISS]; GO:0008360 - regulation of cell shape [Evidence ISS]; GO:0007264 - small GTPase mediated signal transduction [Evidence ISS] codon_start : 1 note : small protein effector 1 of Cdc42 product : CDC42 small effector 1 protein_id : NP_001033797.1

name	Cdc42se1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369483 GeneID:57912 MGI:1889510
definition	GO_component : GO:0005938 - cell cortex [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0046329 - negative regulation of JNK cascade [Evidence ISS]; GO:0008360 - regulation of cell shape [Evidence ISS]; GO:0007264 - small GTPase mediated signal transduction [Evidence ISS] codon_start : 1 note : small protein effector 1 of Cdc42 product : CDC42 small effector 1 protein_id : NP_765983.1

name	Gm128 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67625729 CCDS:CCDS17608.1 GeneID:229588 MGI:2684974
definition	codon_start : 1 product : hypothetical protein LOC229588 protein_id : NP_001020012.1

name	Bnipl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527418 CCDS:CCDS17609.1 GeneID:171388 MGI:2384749
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS] codon_start : 1 product : BNIP-2 similar protein_id : NP_599014.1

name	Prune (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27597069 CCDS:CCDS17610.1 GeneID:229589 MGI:1925152
definition	codon_start : 1 product : PRUNEM1 protein_id : NP_775482.1

name	4930504E06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41680647 CCDS:CCDS17611.1 GeneID:75007 MGI:1922257
definition	codon_start : 1 note : NF-E2 inducible protein product : hypothetical protein LOC75007 protein_id : NP_598619.2

name	Anxa9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13487919 GeneID:71790 MGI:1923711
definition	GO_component : GO:0009986 - cell surface [Evidence ISS]; GO:0005575 - cellular_component [Evidence ND]; GO:0005829 - cytosol [Evidence ISS] GO_function : GO:0015464 - acetylcholine receptor activity [Evidence ISS]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005544 - calcium-dependent phospholipid binding [Evidence IEA]; GO:0001786 - phosphatidylserine binding [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0016337 - cell-cell adhesion [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy product : annexin A9 protein_id : NP_076117.1

name	Lass2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22095015 CCDS:CCDS17612.1 GeneID:76893 MGI:1924143
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : longevity assurance homolog 2 protein_id : NP_084065.1

name	Setdb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51092287 CCDS:CCDS17613.1 GeneID:84505 MGI:1934229
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0018024 - histone-lysine N-methyltransferase activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0001833 - inner cell mass cell proliferation [Evidence IMP]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : SET domain ERG-associated histone methyltransferase product : SET domain, bifurcated 1 protein_id : NP_061365.2

name	LOC100043294 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251379 GeneID:100043294
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480172.1

name	4930558C23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251318 GeneID:67654 MGI:1914904
definition	codon_start : 1 product : hypothetical protein LOC67654 protein_id : XP_001479011.1

name	LOC100043305 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251382 GeneID:100043305
definition	codon_start : 1 product : similar to ESET protein protein_id : XP_001480175.1

name	Arnt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83627709 CCDS:CCDS17614.1 GeneID:11863 MGI:88071
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0003713 - transcription coactivator activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence TAS]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence ISS]; GO:0000155 - two-component sensor activity [Evidence IEA] GO_process : GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0009636 - response to toxin [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0000160 - two-component signal transduction system (phosphorelay) [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : aryl hydrocarbon receptor nuclear translocator isoform a protein_id : NP_001032826.1

name	Arnt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83627702 GeneID:11863 MGI:88071
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0003713 - transcription coactivator activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence TAS]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence ISS]; GO:0000155 - two-component sensor activity [Evidence IEA] GO_process : GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0009636 - response to toxin [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0000160 - two-component signal transduction system (phosphorelay) [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : aryl hydrocarbon receptor nuclear translocator isoform b protein_id : NP_033839.2

name	Ctsk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982433 CCDS:CCDS17615.1 GeneID:13038 MGI:107823
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004216 - cathepsin K activity [Evidence IEA] [Evidence ISS]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence ISS] [Evidence IEA] codon_start : 1 note : Cat K; minisatellite 10q detected by probe MMS10 product : cathepsin K protein_id : NP_031828.2

name	Ctss (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946582 GeneID:13040 MGI:107341
definition	GO_component : GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IDA] GO_function : GO:0004218 - cathepsin S activity [Evidence IDA]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IDA] codon_start : 1 exception : mismatches in translation note : Cat S product : cathepsin S preproprotein protein_id : NP_067256.1

name	Hormad1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385974 GeneID:67981 MGI:1915231
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : HORMA domain containing protein product : HORMA domain containing 1 protein_id : NP_080765.1

name	Golph3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122661 CCDS:CCDS17616.1 GeneID:229593 MGI:1917129
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : golgi phosphoprotein 3-like protein_id : NP_666245.1

name	EG668457 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369782 GeneID:668457 MGI:3644167
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001572.1

name	Ensa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9624979 GeneID:56205 MGI:1891189
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0019870 - potassium channel inhibitor activity [Evidence ISS]; GO:0005102 - receptor binding [Evidence ISS] GO_process : GO:0050796 - regulation of insulin secretion [Evidence ISS] codon_start : 1 note : isoform a is encoded by transcript variant 1; alpha-endosulfine product : endosulfine alpha isoform a protein_id : NP_062507.1

name	Ensa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71061466 CCDS:CCDS17617.1 GeneID:56205 MGI:1891189
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0019870 - potassium channel inhibitor activity [Evidence ISS]; GO:0005102 - receptor binding [Evidence ISS] GO_process : GO:0050796 - regulation of insulin secretion [Evidence ISS] codon_start : 1 note : isoform b is encoded by transcript variant 2; alpha-endosulfine product : endosulfine alpha isoform b protein_id : NP_001021383.1

name	Mcl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678824 GeneID:17210 MGI:101769
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : myeloid cell leukemia sequence 1 protein_id : NP_032588.1

name	Adamtsl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30089697 CCDS:CCDS17618.1 GeneID:229595 MGI:2389008
definition	GO_component : GO:0031012 - extracellular matrix [Evidence IEA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0002020 - protease binding [Evidence ISS] GO_process : GO:0043065 - positive regulation of apoptosis [Evidence ISS] codon_start : 1 note : thrombospondin repeat protein 1 product : thrombospondin repeat containing 1 protein_id : NP_659148.2

name	Ecm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681257 CCDS:CCDS17619.1 GeneID:13601 MGI:103060
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005386 - carrier activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : extracellular matrix protein 1 protein_id : NP_031925.1

name	Tars2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313644 GeneID:71807 MGI:1919057
definition	GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0004829 - threonine-tRNA ligase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006435 - threonyl-tRNA aminoacylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : threonyl-tRNA synthetase-like 1 protein_id : NP_082207.1

name	4930535B03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486841 GeneID:75137 MGI:1922387
definition	codon_start : 1 product : hypothetical protein LOC75137 protein_id : NP_001074762.1

name	LOC100043327 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251388 GeneID:100043327
definition	codon_start : 1 product : similar to HSPC016 protein_id : XP_001480258.1

name	Prpf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980657 CCDS:CCDS17621.1 GeneID:70767 MGI:1918017
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : PRP3 pre-mRNA processing factor 3 homolog protein_id : NP_081817.2

name	Mrps21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17505220 GeneID:66292 MGI:1913542
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein S21 protein_id : NP_510964.1

name	LOC100042889 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251323 GeneID:100042889
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479050.1

name	Gm129 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701804 GeneID:229599 MGI:2684975
definition	codon_start : 1 product : hypothetical protein LOC229599 protein_id : NP_001028474.1

name	BC028528 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943801 GeneID:229600 MGI:2385885
definition	codon_start : 1 product : hypothetical protein LOC229600 protein_id : NP_705733.1

name	EG668385 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668385
definition	number : 2 pseudo : _no_value

name	EG668385 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668385
definition	number : 1 pseudo : _no_value

name	LOC100042761 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251304 GeneID:100042761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 18 Proteins product : similar to Tdpoz5 protein pseudo : _no_value transcript_id : XR_033875.1

name	LOC668367 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251370 GeneID:668367
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 21 Proteins product : similar to Tdpoz5 protein pseudo : _no_value transcript_id : XR_034457.1

name	LOC433625 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251305 GeneID:433625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 19 Proteins product : similar to Tdpoz5 protein pseudo : _no_value transcript_id : XR_033885.1

name	LOC668403 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251308 GeneID:668403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 6 Proteins product : similar to ribosomal protein S2 pseudo : _no_value transcript_id : XR_033918.1

name	LOC100043228 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251375 GeneID:100043228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 2 Proteins product : similar to coiled-coil domain containing 72 pseudo : _no_value transcript_id : XR_034479.1

name	EG668409 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94369774 GeneID:668409 MGI:3646595
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 596 ESTs, 5 Proteins product : predicted gene, EG668409 pseudo : _no_value transcript_id : XR_002179.1

name	LOC668436 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251315 GeneID:668436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 129 ESTs, 1 Protein product : similar to chromosome 11 open reading frame 58 pseudo : _no_value transcript_id : XR_033969.1

name	LOC277589 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251319 GeneID:277589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 865 ESTs, 7 Proteins product : similar to MGC27348 protein pseudo : _no_value transcript_id : XR_034004.1

name	LOC668448 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251380 GeneID:668448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 46 ESTs, 3 Proteins product : similar to mitochondrial ribosomal protein S16 pseudo : _no_value transcript_id : XR_034548.1

name	LOC100043312 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251385 GeneID:100043312
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 364 ESTs, 12 Proteins product : similar to high-mobility group box 1 pseudo : _no_value transcript_id : XR_034560.1

clone name	MSMg01-500I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-132M12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-382H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-496I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418K06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-051A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332B04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-095G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329H01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-106P07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-166C12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-166E12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-410N22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-261H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185I21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-411M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437D11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-095G02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-091B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-277D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389D04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-116A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261M21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-468J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518B05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-524G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381F03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-328J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137B03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-260N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118G07
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-302O13.b	B6Ng01-302O13.g
ACC	GA096838	GA096839
length	1,175	1,137
definition	B6Ng01-302O13.b	B6Ng01-302O13.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcctgatctttccaagacttttatcatgaatgggtgttggatcttg tgaaatgctttttctgcatctaacgagatgatcttgtggtttttctcttt gagtttgtttatataatggattacattgatggattttcgtatattaaacc atccctgcatccctggaataaaacctacttggtcaggatggatgattgct ttaatgtgttcttggattcggttagtgagaattttattgaggatttttgc atcgatattcataatagaaattggtctgaagttctctatctttgttggat ctttctgtggtttaggtatcagagtaatagtggcttcataaaatgagttg ggtagagtaccttctacttctattttgtgaaatagtttgtgcagaactgg aattagatcttctttgaaggtctgatagaactctgcactaaacccgtctg gtcctgggcttttgttggctgggagactattaataactgcttctatttct ttaggggatatgggactgtttagatggtcaacttgatcctgattcaactt tggtacctggtatctgtccagaaatttgtccatttcgtccaggttttcca gttttgttgagtatagctttttgtagaaggatctgattgtgttttggatt tcttcaggatctgttgttatgtctcccttttcatttctgattttgttaat taggattttgtccctgtgccctctagtgagtctagctaagggtttatcta tcttgttgattttctcaaagaaccaactcctcgtttggttaattctttga atagttcttcttgtttccacttgggttgatttcacccctgagtttgatta tttcctgccatctactcctcttgggtgaatttgcttcctttttttctaga gcttttagatgtgttgtcaagctactagtatgtgctctctcccgtttctt cttggaggcactcagagctatgagtttcctctttagaaatgcttccatgt ggtccataggtttgggtacgtatggcttccatttttcattaacctctaaa agtcttaatttctgtccttatgcttccttgacaagatacatgaaaaagag gttgtcacatttcccacgtgaagtgtgctcatacttatgcttgctattgg agaatcagctaatgcacagtgtagg	gaattcaatgtcaaacaaacaaagccagcacctaattcttttgaaacagt gggtagaaaactcatccactttggtgcctgtttacatgggttagagtagg ttgccttctgttaagccagtctaatttctccaatgttttgcccgcctgtg tagcctctgcttcgagaagttctagagaagcagccagtgctgagtcagac tgaggctcgggagcttgtggagcgctgcatgagagtgctgtactacagag atgcccgttcgtataaccgggtgagaaatgggctggaaggtacaaattct ggagccaggcatggtggcacatgcctttaatcccagtagggaaacagggg tgggtgggactctgcatttgaggcgagcttggtttacatagtgagacgct atcattgcacgctttgccttctttcagtttcaaattgccactgtgactga aaagggtgtcgagatagaaggaccgctgtccgcacagaccaactgggaca tcgctcacatgatcaggtgagcaagctacagtagggatcggtgacacagg gaagctcttgacttttacagaatggctcttctggagggttcaagcagaaa ctctgtgtgggtggttttggagggaacctctccaggttgggggcggggga actctccaggtgggtggtcttggaaatggggagctccttcagaagttgat gcctttatccgccttcattttccctaaatgtttcttctttctttagtggc tttgaatgaaatccagttgaatgtccagagtgttgaagctttgctcttct aaacgtgactgtagctggctcaaaggcagacttttgtaaataaatcagtc gtttgaagtgttcgctgagttggattttgtgttttgaaacaggatttatg tagcccaggcttgcctggaacgcagaaatctgccctcccaaaagctagag gtaaaagcttctggcatagcctgggcaatttcagttgtttattctaacat ggttcacattgagacctcagctaccaagtactgctttgttaccaatgtcc cgttgctgtttctttccttggaaagagtaacccattcaagtctaaattgg gtgtgtgacccagagctgtccttctcaattattttcc
quality values	Open. Hide. 58 31 17 25 58 58 62 47 62 23 38 62 62 62 62 62 30 11 47 62 47 56 62 62 62 62 56 47 41 42 54 45 26 24 16 28 27 19 23 40 33 34 38 46 59 43 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 59 49 49 35 43 33 59 59 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 54 42 49 38 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 42 58 58 58 54 58 54 46 54 54 51 58 58 58 58 54 54 54 54 41 54 58 58 58 58 58 47 54 58 58 58 58 58 54 50 54 58 58 52 54 58 58 58 50 58 58 52 54 58 58 58 54 58 58 52 47 46 58 54 58 58 50 52 54 46 58 58 58 58 58 51 48 58 51 58 46 49 53 53 51 40 58 58 58 58 58 58 51 52 51 26 58 58 32 58 37 26 58 54 49 42 25 50 58 35 46 32 58 58 58 58 32 39 26 58 58 58 53 52 53 46 21 58 36 21 58 51 54 49 50 58 40 40 46 42 51 52 53 53 58 49 49 37 58 58 50 46 33 41 58 49 52 50 43 47 28 49 58 38 54 50 42 39 52 39 52 53 35 37 39 18 58 58 42 51 50 58 49 58 35 39 41 51 58 58 54 42 52 49 53 34 45 52 41 32 41 49 41 52 42 53 49 26 29 6 29 51 26 54 46 47 37 41 41 42 42 49 28 33 53 51 54 37 41 17 54 54 39 52 40 41 32 54 54 30 54 16 12 54 31 40 38 47 40 51 41 45 40 34 54 40 32 41 33 31 53 35 40 52 53 40 53 51 31 42 32 32 40 32 27 33 40 29 31 53 28 12 17 20 47 32 31 31 22 32 25 27 21 51 27 29 25 27 31 18 51 30 31 16 38 51 51 51 31 31 35 17 31 51 31 31 31 25 31 30 32 46 36 31 46 28 41 27 32 20 31 17 7 9 11 14 31 36 30 30 19 28 46 37 40 20 26 20 24 32 48 31 23 20 18 21 25 27 10 46 46 46 46 46 24 41 14 16 20 41 28 32 31 41 35 25 23 7 33 15 25 27 33 16 19 19 18 36 20 30 24 16 32 27 31 35 37 15 12 21 17 31 20 17 17 26 28 17 29 31 31 44 30 18 16 31 17 33 16 11 22 13 17 24 25 25 7 25 32 16 27 34 32 17 13 30 10 33 14 19 19 10 9 4 4 21 14 43 21 8 16 12 22 10 11 5 11 21 17 4 12 18 16 27 6 18 9 27 9 8 10 6 7 30 21 17 16 13 9 9 5 21 8 25 34 23 13 11 6 6 12 10 18 13 21 21 13 16 17 14 24 24 38 33 22 7 12 15 18 16 7 19 5 4 12 6 3 7 22 27 6 6 8 7 9 12 9 13 7 25 5 5 2 1 3 2 1 3 1 2 3 1 3 3 2 10 17 7 16 16 11 9 3 3 3 1 3 7 6 8 20 7 8 12 10 22 5 4 4 2 4 6 18 6 7 6 4 1 2 10 8 5 13 22 8 13 9 20 8 7 13 8 4 5 6 5 3 2 3 3 1 8 3 1 5 3 4 6 5 2 6 5 4 1 1 2 7 5 3 2 3 5 18 8 8 6 6 2 2 3 11 6 5 24 7 3 9 3 5 4 15 6 7 15 13	Open. Hide. 56 36 39 47 56 43 50 39 51 62 56 15 10 15 15 24 10 18 18 22 18 27 27 32 28 44 36 43 62 59 62 62 46 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 59 49 51 46 50 46 48 32 28 56 51 59 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 54 56 59 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 50 62 54 42 49 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 59 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 62 62 59 59 59 62 59 62 62 59 62 54 59 59 62 62 62 62 62 62 54 62 59 62 62 62 54 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 56 62 56 56 56 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 52 62 62 62 62 62 62 41 54 62 62 62 62 58 58 58 58 54 58 54 58 54 52 45 54 54 54 58 58 58 58 58 58 45 46 54 58 58 52 54 58 54 54 54 54 58 58 45 42 54 41 52 58 54 58 58 54 58 58 58 54 58 58 52 58 54 54 58 58 42 58 58 39 46 58 58 58 58 58 46 51 52 53 53 49 58 43 58 58 50 54 58 58 58 58 58 45 47 58 58 58 58 49 53 42 51 58 41 38 58 58 51 54 58 58 58 58 58 58 58 54 29 58 58 46 58 53 52 58 51 58 54 50 58 58 51 47 58 53 58 58 53 58 52 58 58 44 40 58 50 32 58 58 53 58 51 49 29 58 44 43 52 39 58 53 54 53 53 51 34 53 53 50 32 46 58 58 43 58 50 51 54 54 42 38 38 40 35 51 54 49 49 49 29 37 54 30 54 54 54 50 54 54 32 54 42 49 44 44 49 54 42 41 54 54 54 39 28 29 45 52 39 53 53 47 35 31 18 54 44 26 37 53 53 41 37 45 42 42 33 54 35 38 40 30 54 35 47 51 45 40 40 33 28 46 46 21 34 53 52 45 40 53 35 32 51 23 52 34 52 42 34 52 35 53 40 45 41 53 45 34 33 32 45 53 34 45 51 40 32 33 33 31 45 31 51 31 39 34 42 31 30 35 38 42 28 24 22 51 32 31 27 28 31 31 29 31 42 18 27 31 42 38 28 41 27 47 31 31 36 43 42 42 32 43 37 33 46 27 31 32 38 42 29 26 36 43 31 31 19 31 37 34 46 30 42 38 30 48 42 18 41 32 26 15 21 16 36 46 46 36 39 20 48 47 46 30 34 48 35 31 31 37 31 31 43 19 11 46 29 37 24 23 29 21 39 26 26 37 30 42 31 21 35 21 48 10 8 25 12 5 43 41 28 28 16 31 26 38 44 31 20 29 44 24 26 10 9 7 33 31 48 37 27 26 37 34 32 15 38 39 33 8 4 8 21 33 30 21 8 28 15 22 20 5 29 7 10 21 22 8 43 39 12 21 34 21 22 19 40 10 23 21 37 26 19 37 39 28 22 32 31 17 17 33 14 33 26 33 39 30 23 14 28 17 21 8 5 8 15 6 26 28 19 15 15 11 28 13 30 14 13 18 16 9 34 14 27 21 10 6 8 15 8 34 19 7 7 27 15 11 18 7 27 18 20 14 21 6 9 18 18 18 16 18 17 15 11 14 19 22 26 27 27 11 18 18 6 11 10 17 4 13 18 23 18 21 16 18 9 18 26 19 10 6 4 5 8 20 6 9 16 13 13 6 21 14 8 13 4 3 5 9 12 18 16 9 3 2 3 11 4 16 5 7 25 13 8 17 13 4 6 5 5 18 13 7 21 6 15 24 3 1 2 8 4 3 4 5 3 20 11 5 7 15 4 2 4 6 7 5 4 2 1 3 25 22 6 4 2 2 1 2 13 6 4 6 7 3 1 6 6 4 9 15 11 9 14 22 18 13 5 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr3_94687988_94689108
seq2: B6Ng01-302O13.g_68_1204 (reverse)

seq1  GGAAAATAATTGAGAAAGACAACCTCTGGG-CACACAC---ATTAAGACT  46
      |||||||||||||||| ||| | ||||||| |||||||   ||| |||||
seq2  GGAAAATAATTGAGAAGGAC-AGCTCTGGGTCACACACCCAATTTAGACT  49

seq1  TAAATGG----TTCTCTCCAGGAAAGGAAACAGCA--CGGACA-TGGT-A  88
      | |||||     ||| |||| | || |||||||||   ||||| |||| |
seq2  TGAATGGGTTACTCTTTCCAAGGAAAGAAACAGCAACGGGACATTGGTAA  99

seq1  CAAAGCAGTACTTGGTAGCTGAGGTCTCAATGTG-ACCATGTTAGAATAA  137
      |||||||||||||||||||||||||||||||||| |||||||||||||||
seq2  CAAAGCAGTACTTGGTAGCTGAGGTCTCAATGTGAACCATGTTAGAATAA  149

seq1  AC-ACTG-AATTGCC--AGCTATGCCAGAAGCTTTTACCTCTAGCTTTTG  183
      || |||| |||||||   ||||||||||||||||||||||||||||||||
seq2  ACAACTGAAATTGCCCAGGCTATGCCAGAAGCTTTTACCTCTAGCTTTTG  199

seq1  GGA-GGCAGATTTCTGCGTTCCAGGCAAGCCTGGGCTACATAAATCCTGT  232
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGGGCAGATTTCTGCGTTCCAGGCAAGCCTGGGCTACATAAATCCTGT  249

seq1  TTCAAAACACAAAATCCAACTCAGCGAACACTTCAAACGACTGATTTATT  282
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  TTCAAAACACAAAATCCAACTCAGCGAACACTTCAAACGACTGATTTA-T  298

seq1  TTACAAAAGTCTGCCTTTGAGCCAGCTACAGTCACGTTTAGAAGAGCAAA  332
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACAAAAGTCTGCCTTTGAGCCAGCTACAGTCACGTTTAGAAGAGCAAA  348

seq1  GCTTCAACACTCTGGACATTCAACTGGATTTCATTCAAAGCCACTAAAGA  382
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTCAACACTCTGGACATTCAACTGGATTTCATTCAAAGCCACTAAAGA  398

seq1  AAGAAGAAACATTTAGGGAAAATGAAGGCGGATAAAGGCATCAACTTCTG  432
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAAGAAACATTTAGGGAAAATGAAGGCGGATAAAGGCATCAACTTCTG  448

seq1  AAGGAGCTCCCCATTTCCAAGACCACCCACCTGGAGAGTTCCCCCGCCCC  482
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAGCTCCCCATTTCCAAGACCACCCACCTGGAGAGTTCCCCCGCCCC  498

seq1  CAACCTGGAGAGGTTCCCTCCAAAACCACCCACACAGAGTTTCTGCTTGA  532
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACCTGGAGAGGTTCCCTCCAAAACCACCCACACAGAGTTTCTGCTTGA  548

seq1  ACCCTCCAGAAGAGCCATTCTGTAAAAGTCAAGAGCTTCCCTGTGTCACC  582
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCTCCAGAAGAGCCATTCTGTAAAAGTCAAGAGCTTCCCTGTGTCACC  598

seq1  GATCCCTACTGTAGCTTGCTCACCTGATCATGTGAGCGATGTCCCAGTTG  632
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCCCTACTGTAGCTTGCTCACCTGATCATGTGAGCGATGTCCCAGTTG  648

seq1  GTCTGTGCGGACAGCGGTCCTTCTATCTCGACACCCTTTTCAGTCACAGT  682
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTGTGCGGACAGCGGTCCTTCTATCTCGACACCCTTTTCAGTCACAGT  698

seq1  GGCAATTTGAAACTGAAAGAAGGCAAAGCGTGCAATGATAGCGTCTCACT  732
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAATTTGAAACTGAAAGAAGGCAAAGCGTGCAATGATAGCGTCTCACT  748

seq1  ATGTAAACCAAGCTCGCCTCAAATGCAGAGTCCCACCCACCCCTGTTTCC  782
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTAAACCAAGCTCGCCTCAAATGCAGAGTCCCACCCACCCCTGTTTCC  798

seq1  CTACTGGGATTAAAGGCATGTGCCACCATGCCTGGCTCCAGAATTTGTAC  832
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTGGGATTAAAGGCATGTGCCACCATGCCTGGCTCCAGAATTTGTAC  848

seq1  CTTCCAGCCCATTTCTCACCCGGTTATACGAACGGGCATCTCTGTAGTAC  882
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCAGCCCATTTCTCACCCGGTTATACGAACGGGCATCTCTGTAGTAC  898

seq1  AGCACTCTCATGCAGCGCTCCACAAGCTCCCGAGCCTCAGTCTGACTCAG  932
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCACTCTCATGCAGCGCTCCACAAGCTCCCGAGCCTCAGTCTGACTCAG  948

seq1  CACTGGCTGCTTCTCTAGAACTTCTCGAAGCAGAGGCTACACAGGCGGGC  982
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGGCTGCTTCTCTAGAACTTCTCGAAGCAGAGGCTACACAGGCGGGC  998

seq1  AAAACATTGGAGAAATTAGACTGGCTTAACAGAAGGCAACCTACTCTAAC  1032
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACATTGGAGAAATTAGACTGGCTTAACAGAAGGCAACCTACTCTAAC  1048

seq1  CCATGTAAACAGGCACCAAAGTGGATGAGTTTTCTACCCACTGTTTCAAA  1082
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATGTAAACAGGCACCAAAGTGGATGAGTTTTCTACCCACTGTTTCAAA  1098

seq1  AGAATTAGGTGCTGGCTTTGTTTGTTTGACATTGAATTC  1121
      |||||||||||||||||||||||||||||||||||||||
seq2  AGAATTAGGTGCTGGCTTTGTTTGTTTGACATTGAATTC  1137

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information