MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-322P20
Chromosome	3 (Build37)
Map Location	95,981,951 - 96,128,271
singlet/doublet	doublet
Overlap gene	Sv2a, Bola1, Hist2h2ab, Hist2h2ac, Hist2h2be, Hist2h3c2, Hist2h2aa1, Hist2h3c1, LOC100043378, Hist2h4, Hist2h3b, Hist2h2bb, Fcgr1
Upstream gene	Gabpb2, Mllt11, Cdc42se1, Gm128, Bnipl, Prune, 4930504E06Rik, Anxa9, Lass2, Setdb1, LOC100043294, 4930558C23Rik, LOC277589, LOC668448, LOC100043305, Arnt, Ctsk, Ctss, LOC100043312, Hormad1, Golph3l, EG668457, Ensa, Mcl1, Adamtsl4, Ecm1, Tars2, 4930535B03Rik, LOC100043327, Prpf3, Mrps21, LOC100042889, Gm129, BC028528, Aph1a, Car14, Anp32e, LOC100042897, LOC100042898, EG668224, Plekho1, EG668222, Vps45, LOC100042908, Otud7b, Mtmr11, Sf3b4
Downstream gene	Pafah1b1-ps1, Terc, BC107364, LOC668500, Hfe2, Txnip, Polr3gl, Ankrd34, 6330549D23Rik, Rbm8a, Pex11b, Itga10, Ankrd35, Pias3, Polr3c, Zfp364, Cd160, Pdzk1, Gpr89, Gja8, 9230114J08Rik, Gja5, Acp6, Bcl9
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gabpb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213054 MGI:95612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mllt11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56772 MGI:1929671
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc42se1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57912 MGI:1889510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gm128 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229588 MGI:2684974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bnipl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171388 MGI:2384749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prune (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229589 MGI:1925152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930504E06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75007 MGI:1922257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anxa9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71790 MGI:1923711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lass2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76893 MGI:1924143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Setdb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84505 MGI:1934229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043294 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	4930558C23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67654 MGI:1914904
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs

name	LOC277589 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:277589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 865 ESTs, 7 Proteins pseudo : _no_value

name	LOC668448 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 46 ESTs, 3 Proteins pseudo : _no_value

name	LOC100043305 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Arnt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11863 MGI:88071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ctsk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13038 MGI:107823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctss (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13040 MGI:107341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043312 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043312
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 364 ESTs, 12 Proteins pseudo : _no_value

name	Hormad1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67981 MGI:1915231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Golph3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229593 MGI:1917129
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668457 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668457 MGI:3644167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 1333 ESTs, 7 Proteins

name	Ensa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56205 MGI:1891189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mcl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17210 MGI:101769
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adamtsl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229595 MGI:2389008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ecm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13601 MGI:103060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tars2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71807 MGI:1919057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930535B03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75137 MGI:1922387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043327 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Prpf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70767 MGI:1918017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66292 MGI:1913542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042889 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	Gm129 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229599 MGI:2684975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC028528 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229600 MGI:2385885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aph1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226548 MGI:2385110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Car14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23831 MGI:1344341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anp32e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66471 MGI:1913721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042897 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC100042898 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042898
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	EG668224 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668224 MGI:3646918
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Plekho1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67220 MGI:1914470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668222 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668222 MGI:3646916
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	Vps45 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22365 MGI:891965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042908 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042908
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins

name	Otud7b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229603 MGI:2654703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mtmr11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194126 MGI:2652817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sf3b4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107701 MGI:109580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sv2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64051 MGI:1927139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bola1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69168 MGI:1916418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist2h2ab (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621893 MGI:2448314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist2h2ac (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319176 MGI:2448316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist2h2be (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319190 MGI:2448415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist2h3c2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97114 MGI:2448357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist2h2aa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15267 MGI:96097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist2h3c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15077 MGI:2448355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 31 ESTs, 28 Proteins

name	LOC100043378 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043378
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Hist2h4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97122 MGI:2140113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist2h3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319154 MGI:2448351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist2h2bb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319189 MGI:2448413
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcgr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14129 MGI:95498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pafah1b1-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18473 MGI:103115
definition	gene_synonym : Lis3; Mdsh3; Pafaha-ps1 note : platelet-activating factor acetylhydrolase, isoform 1b, beta1 subunit, pseudogene 1 pseudo : _no_value

name	Terc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21748 MGI:109558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC107364 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329716 MGI:3618860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 2 Proteins

name	LOC668500 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 4 Proteins pseudo : _no_value

name	Hfe2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69585 MGI:1916835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txnip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56338 MGI:1889549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Polr3gl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69870 MGI:1917120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545554 MGI:3617846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330549D23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229613 MGI:2442586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Rbm8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60365 MGI:1913129
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pex11b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18632 MGI:1338882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itga10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213119 MGI:2153482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213121 MGI:2442590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pias3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229615 MGI:1913126
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Polr3c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74414 MGI:1921664
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 117 ESTs, 3 Proteins

name	Zfp364 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67845 MGI:1915095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd160 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54215 MGI:1860383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdzk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59020 MGI:1928901
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr89 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67549 MGI:1914799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gja8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14616 MGI:99953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9230114J08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78080 MGI:1925330
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Gja5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14613 MGI:95716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acp6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66659 MGI:1931010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77578 MGI:1924828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gabpb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301202 GeneID:213054 MGI:95612
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GA repeat binding protein, beta 2 transcript_id : NM_172512.2

name	Gabpb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301211 GeneID:213054 MGI:95612
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GA repeat binding protein, beta 2 transcript_id : NM_029885.1

name	Mllt11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803083 GeneID:56772 MGI:1929671
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 transcript_id : NM_019914.3

name	Cdc42se1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385820 GeneID:57912 MGI:1889510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC42 small effector 1 transcript_id : NM_172395.2

name	Cdc42se1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803404 GeneID:57912 MGI:1889510
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC42 small effector 1 transcript_id : NM_001038708.2

name	Gm128 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802297 GeneID:229588 MGI:2684974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 128, (NCBI) transcript_id : NM_001024841.3

name	Bnipl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527417 GeneID:171388 MGI:2384749
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL2/adenovirus E1B 19kD interacting protein like transcript_id : NM_134253.1

name	Prune (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254234 GeneID:229589 MGI:1925152
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prune homolog (Drosophila) transcript_id : NM_173347.2

name	4930504E06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802760 GeneID:75007 MGI:1922257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930504E06 gene transcript_id : NM_133858.3

name	Anxa9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13487918 GeneID:71790 MGI:1923711
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : annexin A9 transcript_id : NM_023628.1

name	Lass2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22095014 GeneID:76893 MGI:1924143
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : longevity assurance homolog 2 (S. cerevisiae) transcript_id : NM_029789.1

name	Setdb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51092286 GeneID:84505 MGI:1934229
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET domain, bifurcated 1 transcript_id : NM_018877.2

name	LOC100043294 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251378 GeneID:100043294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : similar to NonO/p54nrb homolog transcript_id : XM_001480122.1

name	4930558C23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251317 GeneID:67654 MGI:1914904
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs product : RIKEN cDNA 4930558C23 gene transcript_id : XM_001478961.1

name	LOC100043305 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251381 GeneID:100043305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to ESET protein transcript_id : XM_001480125.1

name	Arnt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83627708 GeneID:11863 MGI:88071
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aryl hydrocarbon receptor nuclear translocator transcript_id : NM_001037737.1

name	Arnt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379121 GeneID:11863 MGI:88071
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aryl hydrocarbon receptor nuclear translocator transcript_id : NM_009709.3

name	Ctsk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352209 GeneID:13038 MGI:107823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin K transcript_id : NM_007802.3

name	Ctss (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946581 GeneID:13040 MGI:107341
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin S transcript_id : NM_021281.1

name	Hormad1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802480 GeneID:67981 MGI:1915231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HORMA domain containing 1 transcript_id : NM_026489.2

name	Golph3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543170 GeneID:229593 MGI:1917129
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi phosphoprotein 3-like transcript_id : NM_146133.2

name	EG668457 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251386 GeneID:668457 MGI:3644167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 1333 ESTs, 7 Proteins product : predicted gene, EG668457 transcript_id : XM_001001572.2

name	Ensa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061456 GeneID:56205 MGI:1891189
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endosulfine alpha transcript_id : NM_019561.2

name	Ensa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061465 GeneID:56205 MGI:1891189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endosulfine alpha transcript_id : NM_001026212.1

name	Mcl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892763 GeneID:17210 MGI:101769
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid cell leukemia sequence 1 transcript_id : NM_008562.3

name	Adamtsl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30089696 GeneID:229595 MGI:2389008
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADAMTS-like 4 transcript_id : NM_144899.2

name	Ecm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681256 GeneID:13601 MGI:103060
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : extracellular matrix protein 1 transcript_id : NM_007899.1

name	Tars2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350271 GeneID:71807 MGI:1919057
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : threonyl-tRNA synthetase 2, mitochondrial (putative) transcript_id : NM_027931.2

name	4930535B03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486840 GeneID:75137 MGI:1922387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930535B03 gene transcript_id : NM_001081293.1

name	LOC100043327 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251387 GeneID:100043327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to HSPC016 transcript_id : XM_001480208.1

name	Prpf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802030 GeneID:70767 MGI:1918017
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PRP3 pre-mRNA processing factor 3 homolog (yeast) transcript_id : NM_027541.3

name	Mrps21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982593 GeneID:66292 MGI:1913542
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S21 transcript_id : NM_078479.2

name	LOC100042889 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251322 GeneID:100042889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100042889 transcript_id : XM_001479000.1

name	Gm129 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701803 GeneID:229599 MGI:2684975
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 129, (NCBI) transcript_id : NM_001033302.1

name	BC028528 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23943800 GeneID:229600 MGI:2385885
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC028528 transcript_id : NM_153513.1

name	Aph1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893006 GeneID:226548 MGI:2385110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anterior pharynx defective 1a homolog (C. elegans) transcript_id : NM_146104.2

name	Car14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892566 GeneID:23831 MGI:1344341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 14 transcript_id : NM_011797.2

name	Anp32e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364647 GeneID:66471 MGI:1913721
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acidic (leucine-rich) nuclear phosphoprotein 32 family, member E transcript_id : NM_023210.3

name	EG668224 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369728 GeneID:668224 MGI:3646918
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : predicted gene, EG668224 transcript_id : XM_001004399.1

name	Plekho1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129883 GeneID:67220 MGI:1914470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family O member 1 transcript_id : NM_023320.2

name	EG668222 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369726 GeneID:668222 MGI:3646916
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : predicted gene, EG668222 transcript_id : XM_001004395.1

name	Vps45 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367309 GeneID:22365 MGI:891965
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 45 (yeast) transcript_id : NM_013841.2

name	LOC100042908 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251324 GeneID:100042908
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to NAT9 transcript_id : XM_001479043.1

name	Otud7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043958 GeneID:229603 MGI:2654703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : OTU domain containing 7B transcript_id : NM_001025613.1

name	Otud7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043956 GeneID:229603 MGI:2654703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : OTU domain containing 7B transcript_id : NM_001025614.1

name	Mtmr11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340971 GeneID:194126 MGI:2652817
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myotubularin related protein 11 transcript_id : NM_181409.2

name	Sf3b4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982251 GeneID:107701 MGI:109580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor 3b, subunit 4 transcript_id : NM_153053.3

name	Sv2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130403 GeneID:64051 MGI:1927139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptic vesicle glycoprotein 2 a transcript_id : NM_022030.3

name	Bola1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387316 GeneID:69168 MGI:1916418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bolA-like 1 (E. coli) transcript_id : NM_026975.2

name	Hist2h2ab (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119433656 GeneID:621893 MGI:2448314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 2, H2ab transcript_id : NM_178213.3

name	Hist2h2ac (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30089709 GeneID:319176 MGI:2448316
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 2, H2ac transcript_id : NM_175662.1

name	Hist2h2be (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801732 GeneID:319190 MGI:2448415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 2, H2be transcript_id : NM_178214.3

name	Hist2h3c2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328342 GeneID:97114 MGI:2448357
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 2, H3c2 transcript_id : NM_054045.2

name	Hist2h2aa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20799906 GeneID:15267 MGI:96097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 2, H2aa1 transcript_id : NM_013549.1

name	Hist2h3c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061400 GeneID:15077 MGI:2448355
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 31 ESTs, 28 Proteins product : histone cluster 2, H3c1 transcript_id : NM_178216.1

name	LOC100043378 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251393 GeneID:100043378
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043378 transcript_id : XM_001480310.1

name	Hist2h4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21361208 GeneID:97122 MGI:2140113
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 2, H4 transcript_id : NM_033596.1

name	Hist2h3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061346 GeneID:319154 MGI:2448351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 2, H3b transcript_id : NM_178215.1

name	Hist2h2bb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68226432 GeneID:319189 MGI:2448413
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 2, H2bb transcript_id : NM_175666.2

name	Fcgr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356991 GeneID:14129 MGI:95498
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor, IgG, high affinity I transcript_id : NM_010186.3

name	Hfe2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802426 GeneID:69585 MGI:1916835
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemochromatosis type 2 (juvenile) (human homolog) transcript_id : NM_027126.3

name	Txnip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131130 GeneID:56338 MGI:1889549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin interacting protein transcript_id : NM_001009935.2

name	Txnip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13994377 GeneID:56338 MGI:1889549
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin interacting protein transcript_id : NM_023719.1

name	Polr3gl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383501 GeneID:69870 MGI:1917120
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) III (DNA directed) polypeptide G like transcript_id : NM_027241.2

name	Ankrd34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122114647 GeneID:545554 MGI:3617846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 34 transcript_id : NM_001024851.3

name	Rbm8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385355 GeneID:60365 MGI:1913129
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 8a transcript_id : NM_025875.1

name	Pex11b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981574 GeneID:18632 MGI:1338882
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisomal biogenesis factor 11b transcript_id : NM_011069.2

name	Itga10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486691 GeneID:213119 MGI:2153482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin, alpha 10 transcript_id : NM_001081053.1

name	Ankrd35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487270 GeneID:213121 MGI:2442590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 35 transcript_id : NM_001081139.1

name	Pias3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122654 GeneID:229615 MGI:1913126
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein inhibitor of activated STAT 3 transcript_id : NM_146135.1

name	Pias3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055307 GeneID:229615 MGI:1913126
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein inhibitor of activated STAT 3 transcript_id : NM_018812.1

name	Polr3c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369735 GeneID:74414 MGI:1921664
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 117 ESTs, 3 Proteins product : polymerase (RNA) III (DNA directed) polypeptide C, transcript variant 1 transcript_id : XM_131049.6

name	Zfp364 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980966 GeneID:67845 MGI:1915095
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 364 transcript_id : NM_026406.2

name	Cd160 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980880 GeneID:54215 MGI:1860383
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD160 antigen transcript_id : NM_018767.2

name	Pdzk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946937 GeneID:59020 MGI:1928901
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDZ domain containing 1 transcript_id : NM_021517.1

name	Gpr89 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802336 GeneID:67549 MGI:1914799
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 89 transcript_id : NM_026229.2

name	Gja8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331132 GeneID:14616 MGI:99953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein alpha 8 transcript_id : NM_008123.2

name	9230114J08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251401 GeneID:78080 MGI:1925330
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 9230114J08 gene transcript_id : XM_001480413.1

name	Gja5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46575906 GeneID:14613 MGI:95716
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein alpha 5 transcript_id : NM_008121.2

name	Acp6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801701 GeneID:66659 MGI:1931010
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acid phosphatase 6, lysophosphatidic transcript_id : NM_019800.3

name	Bcl9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56606136 GeneID:77578 MGI:1924828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell CLL/lymphoma 9 transcript_id : NM_029933.3

name	Gabpb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301212 GeneID:213054 MGI:95612
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IDA] codon_start : 1 product : GA repeat binding protein, beta 2 protein_id : NP_084161.1

name	Gabpb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369712 CCDS:CCDS17605.1 GeneID:213054 MGI:95612
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IDA] codon_start : 1 product : GA repeat binding protein, beta 2 protein_id : NP_766100.1

name	Mllt11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910124 GeneID:56772 MGI:1929671
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : zinc finger protein 692 product : ALL1-fused gene from chromosome 1q protein_id : NP_064298.1

name	Cdc42se1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781706 GeneID:57912 MGI:1889510
definition	GO_component : GO:0005938 - cell cortex [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0046329 - negative regulation of JNK cascade [Evidence ISS]; GO:0008360 - regulation of cell shape [Evidence ISS]; GO:0007264 - small GTPase mediated signal transduction [Evidence ISS] codon_start : 1 note : small protein effector 1 of Cdc42 product : CDC42 small effector 1 protein_id : NP_001033797.1

name	Cdc42se1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369483 GeneID:57912 MGI:1889510
definition	GO_component : GO:0005938 - cell cortex [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0046329 - negative regulation of JNK cascade [Evidence ISS]; GO:0008360 - regulation of cell shape [Evidence ISS]; GO:0007264 - small GTPase mediated signal transduction [Evidence ISS] codon_start : 1 note : small protein effector 1 of Cdc42 product : CDC42 small effector 1 protein_id : NP_765983.1

name	Gm128 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67625729 CCDS:CCDS17608.1 GeneID:229588 MGI:2684974
definition	codon_start : 1 product : hypothetical protein LOC229588 protein_id : NP_001020012.1

name	Bnipl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527418 CCDS:CCDS17609.1 GeneID:171388 MGI:2384749
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS] codon_start : 1 product : BNIP-2 similar protein_id : NP_599014.1

name	Prune (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27597069 CCDS:CCDS17610.1 GeneID:229589 MGI:1925152
definition	codon_start : 1 product : PRUNEM1 protein_id : NP_775482.1

name	4930504E06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41680647 CCDS:CCDS17611.1 GeneID:75007 MGI:1922257
definition	codon_start : 1 note : NF-E2 inducible protein product : hypothetical protein LOC75007 protein_id : NP_598619.2

name	Anxa9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13487919 GeneID:71790 MGI:1923711
definition	GO_component : GO:0009986 - cell surface [Evidence ISS]; GO:0005575 - cellular_component [Evidence ND]; GO:0005829 - cytosol [Evidence ISS] GO_function : GO:0015464 - acetylcholine receptor activity [Evidence ISS]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005544 - calcium-dependent phospholipid binding [Evidence IEA]; GO:0001786 - phosphatidylserine binding [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0016337 - cell-cell adhesion [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy product : annexin A9 protein_id : NP_076117.1

name	Lass2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22095015 CCDS:CCDS17612.1 GeneID:76893 MGI:1924143
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : longevity assurance homolog 2 protein_id : NP_084065.1

name	Setdb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51092287 CCDS:CCDS17613.1 GeneID:84505 MGI:1934229
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0018024 - histone-lysine N-methyltransferase activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0001833 - inner cell mass cell proliferation [Evidence IMP]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : SET domain ERG-associated histone methyltransferase product : SET domain, bifurcated 1 protein_id : NP_061365.2

name	LOC100043294 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251379 GeneID:100043294
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480172.1

name	4930558C23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251318 GeneID:67654 MGI:1914904
definition	codon_start : 1 product : hypothetical protein LOC67654 protein_id : XP_001479011.1

name	LOC100043305 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251382 GeneID:100043305
definition	codon_start : 1 product : similar to ESET protein protein_id : XP_001480175.1

name	Arnt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83627709 CCDS:CCDS17614.1 GeneID:11863 MGI:88071
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0003713 - transcription coactivator activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence TAS]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence ISS]; GO:0000155 - two-component sensor activity [Evidence IEA] GO_process : GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0009636 - response to toxin [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0000160 - two-component signal transduction system (phosphorelay) [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : aryl hydrocarbon receptor nuclear translocator isoform a protein_id : NP_001032826.1

name	Arnt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83627702 GeneID:11863 MGI:88071
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0003713 - transcription coactivator activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence TAS]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence ISS]; GO:0000155 - two-component sensor activity [Evidence IEA] GO_process : GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0009636 - response to toxin [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0000160 - two-component signal transduction system (phosphorelay) [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : aryl hydrocarbon receptor nuclear translocator isoform b protein_id : NP_033839.2

name	Ctsk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982433 CCDS:CCDS17615.1 GeneID:13038 MGI:107823
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004216 - cathepsin K activity [Evidence IEA] [Evidence ISS]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence ISS] [Evidence IEA] codon_start : 1 note : Cat K; minisatellite 10q detected by probe MMS10 product : cathepsin K protein_id : NP_031828.2

name	Ctss (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946582 GeneID:13040 MGI:107341
definition	GO_component : GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IDA] GO_function : GO:0004218 - cathepsin S activity [Evidence IDA]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IDA] codon_start : 1 exception : mismatches in translation note : Cat S product : cathepsin S preproprotein protein_id : NP_067256.1

name	Hormad1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385974 GeneID:67981 MGI:1915231
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : HORMA domain containing protein product : HORMA domain containing 1 protein_id : NP_080765.1

name	Golph3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122661 CCDS:CCDS17616.1 GeneID:229593 MGI:1917129
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : golgi phosphoprotein 3-like protein_id : NP_666245.1

name	EG668457 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369782 GeneID:668457 MGI:3644167
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001572.1

name	Ensa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9624979 GeneID:56205 MGI:1891189
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0019870 - potassium channel inhibitor activity [Evidence ISS]; GO:0005102 - receptor binding [Evidence ISS] GO_process : GO:0050796 - regulation of insulin secretion [Evidence ISS] codon_start : 1 note : isoform a is encoded by transcript variant 1; alpha-endosulfine product : endosulfine alpha isoform a protein_id : NP_062507.1

name	Ensa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71061466 CCDS:CCDS17617.1 GeneID:56205 MGI:1891189
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0019870 - potassium channel inhibitor activity [Evidence ISS]; GO:0005102 - receptor binding [Evidence ISS] GO_process : GO:0050796 - regulation of insulin secretion [Evidence ISS] codon_start : 1 note : isoform b is encoded by transcript variant 2; alpha-endosulfine product : endosulfine alpha isoform b protein_id : NP_001021383.1

name	Mcl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678824 GeneID:17210 MGI:101769
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : myeloid cell leukemia sequence 1 protein_id : NP_032588.1

name	Adamtsl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30089697 CCDS:CCDS17618.1 GeneID:229595 MGI:2389008
definition	GO_component : GO:0031012 - extracellular matrix [Evidence IEA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0002020 - protease binding [Evidence ISS] GO_process : GO:0043065 - positive regulation of apoptosis [Evidence ISS] codon_start : 1 note : thrombospondin repeat protein 1 product : thrombospondin repeat containing 1 protein_id : NP_659148.2

name	Ecm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681257 CCDS:CCDS17619.1 GeneID:13601 MGI:103060
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005386 - carrier activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : extracellular matrix protein 1 protein_id : NP_031925.1

name	Tars2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313644 GeneID:71807 MGI:1919057
definition	GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0004829 - threonine-tRNA ligase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006435 - threonyl-tRNA aminoacylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : threonyl-tRNA synthetase-like 1 protein_id : NP_082207.1

name	4930535B03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486841 GeneID:75137 MGI:1922387
definition	codon_start : 1 product : hypothetical protein LOC75137 protein_id : NP_001074762.1

name	LOC100043327 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251388 GeneID:100043327
definition	codon_start : 1 product : similar to HSPC016 protein_id : XP_001480258.1

name	Prpf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980657 CCDS:CCDS17621.1 GeneID:70767 MGI:1918017
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : PRP3 pre-mRNA processing factor 3 homolog protein_id : NP_081817.2

name	Mrps21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17505220 GeneID:66292 MGI:1913542
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein S21 protein_id : NP_510964.1

name	LOC100042889 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251323 GeneID:100042889
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479050.1

name	Gm129 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701804 GeneID:229599 MGI:2684975
definition	codon_start : 1 product : hypothetical protein LOC229599 protein_id : NP_001028474.1

name	BC028528 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943801 GeneID:229600 MGI:2385885
definition	codon_start : 1 product : hypothetical protein LOC229600 protein_id : NP_705733.1

name	Aph1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203751 CCDS:CCDS17624.1 GeneID:226548 MGI:2385110
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IMP] [Evidence IDA]; GO:0008233 - peptidase activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] [Evidence IEA] GO_process : GO:0042987 - amyloid precursor protein catabolism [Evidence ISS]; GO:0006509 - membrane protein ectodomain proteolysis [Evidence ISS]; GO:0001656 - metanephros development [Evidence IMP]; GO:0007220 - Notch receptor processing [Evidence ISS]; GO:0007219 - Notch signaling pathway [Evidence IEA]; GO:0043085 - positive regulation of enzyme activity [Evidence ISS] [Evidence IEA]; GO:0016485 - protein processing [Evidence ISS] codon_start : 1 product : anterior pharynx defective 1a homolog protein_id : NP_666216.1

name	Car14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753264 CCDS:CCDS17625.1 GeneID:23831 MGI:1344341
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004089 - carbonate dehydratase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 note : CA XIV product : carbonic anhydrase 14 protein_id : NP_035927.1

name	Anp32e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542131 CCDS:CCDS17626.1 GeneID:66471 MGI:1913721
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0019212 - phosphatase inhibitor activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : cerebellar postnatal development protein 1 product : acidic (leucine-rich) nuclear phosphoprotein 32 family, member E protein_id : NP_075699.2

name	EG668224 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369729 GeneID:668224 MGI:3646918
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001004399.1

name	Plekho1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963637 CCDS:CCDS17627.1 GeneID:67220 MGI:1914470
definition	codon_start : 1 note : Jun zipper-associated 2; CK2 interacting protein 1 product : TNF intracellular domain-interacting protein protein_id : NP_075809.1

name	EG668222 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94369727 GeneID:668222 MGI:3646916
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001004395.1

name	Vps45 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305631 CCDS:CCDS17628.1 GeneID:22365 MGI:891965
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006904 - vesicle docking during exocytosis [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 note : vacuolar protein sorting-associated protein 45; vacuolar protein sorting protein 45 product : vacuolar protein sorting 45 protein_id : NP_038869.1

name	LOC100042908 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251325 GeneID:100042908
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479093.1

name	Otud7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043959 CCDS:CCDS17629.1 GeneID:229603 MGI:2654703
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016579 - protein deubiquitination [Evidence IDA] codon_start : 1 note : TRAF binding domain containing 2 product : zinc finger, A20 domain containing 1 protein_id : NP_001020784.1

name	Otud7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043957 CCDS:CCDS17629.1 GeneID:229603 MGI:2654703
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016579 - protein deubiquitination [Evidence IDA] codon_start : 1 note : TRAF binding domain containing 2 product : zinc finger, A20 domain containing 1 protein_id : NP_001020785.1

name	Mtmr11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31088900 GeneID:194126 MGI:2652817
definition	GO_function : GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence IEA] GO_process : GO:0046839 - phospholipid dephosphorylation [Evidence IEA] codon_start : 1 product : cisplatin resistance associated protein_id : NP_852074.1

name	Sf3b4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346437 CCDS:CCDS17630.1 GeneID:107701 MGI:109580
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : spliceosome associated protein 49; splicing factor 3b, subunit 4, 49kD product : splicing factor 3b, subunit 4 protein_id : NP_694693.1

name	Sv2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11528518 CCDS:CCDS17631.1 GeneID:64051 MGI:1927139
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IDA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0007268 - synaptic transmission [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : synaptic vesicle glycoprotein 2 a protein_id : NP_071313.1

name	Bola1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037151 CCDS:CCDS17632.1 GeneID:69168 MGI:1916418
definition	GO_function : GO:0030528 - transcription regulator activity [Evidence IEA] codon_start : 1 product : bolA-like 1 protein_id : NP_081251.1

name	Hist2h2ab (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119433657 GeneID:621893 MGI:2448314
definition	codon_start : 1 product : histone 2, H2ab protein_id : NP_835585.3

name	Hist2h2ac (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30089710 CCDS:CCDS17634.1 GeneID:319176 MGI:2448316
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 2, H2ac protein_id : NP_783593.1

name	Hist2h2be (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68226431 CCDS:CCDS17635.1 GeneID:319190 MGI:2448415
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 2, H2be protein_id : NP_835586.2

name	Hist2h3c2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21489953 GeneID:97114 MGI:2448357
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : histone 2, H3ca2; histone 3.2-614 product : histone 2, H3c2 protein_id : NP_473386.1

name	Hist2h2aa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20799907 CCDS:CCDS17636.1 GeneID:15267 MGI:96097
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : histone gene complex 2 product : histone 2, H2aa1 protein_id : NP_038577.1

name	Hist2h3c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061401 GeneID:15077 MGI:2448355
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; H3 histone, family 2; histone 2, H3ca1; histone 2, H3c1 product : H3 histone, family 2 isoform 2 protein_id : NP_835734.1

name	LOC100043378 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251394 GeneID:100043378
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480360.1

name	Hist2h4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21361209 GeneID:97122 MGI:2140113
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : histone 2, H4 product : histone cluster 2, H4 protein_id : NP_291074.1

name	Hist2h3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061347 CCDS:CCDS17638.1 GeneID:319154 MGI:2448351
definition	codon_start : 1 note : histone protein Hist2h2bb product : histone 2, H3b protein_id : NP_835587.1

name	Hist2h2bb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68226433 GeneID:319189 MGI:2448413
definition	GO_component : GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 2, H2bb protein_id : NP_783597.2

name	Fcgr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753832 CCDS:CCDS17639.1 GeneID:14129 MGI:95498
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0019864 - IgG binding [Evidence IMP] [Evidence IDA]; GO:0019770 - IgG receptor activity [Evidence IMP]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0001788 - antibody-dependent cellular cytotoxicity [Evidence IMP]; GO:0019884 - antigen processing and presentation of exogenous antigen [Evidence IMP]; GO:0042590 - antigen processing and presentation of exogenous peptide antigen via MHC class I [Evidence IMP]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IMP]; GO:0042742 - defense response to bacterium [Evidence IMP]; GO:0006911 - phagocytosis, engulfment [Evidence IMP]; GO:0006910 - phagocytosis, recognition [Evidence IMP]; GO:0050766 - positive regulation of phagocytosis [Evidence IMP]; GO:0001798 - positive regulation of type IIa hypersensitivity [Evidence IMP]; GO:0001805 - positive regulation of type III hypersensitivity [Evidence IMP]; GO:0006898 - receptor mediated endocytosis [Evidence IMP]; GO:0050776 - regulation of immune response [Evidence IMP] codon_start : 1 note : IgG high affinity Fc receptor; high affinity immunoglobulin gamma Fc receptor I product : Fc receptor, IgG, high affinity I protein_id : NP_034316.1

name	Hfe2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560104 GeneID:69585 MGI:1916835
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0005615 - extracellular space [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : RGM domain family, member C product : repulsive guidance molecule C protein_id : NP_081402.2

name	Txnip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60687518 GeneID:56338 MGI:1889549
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0004857 - enzyme inhibitor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006979 - response to oxidative stress [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; hyperlipidemia 1; upregulated by 1,25-dihydroxyvitamin D-3 product : thioredoxin interacting protein isoform 1 protein_id : NP_001009935.1

name	Txnip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13994378 CCDS:CCDS17640.1 GeneID:56338 MGI:1889549
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0004857 - enzyme inhibitor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006979 - response to oxidative stress [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; hyperlipidemia 1; upregulated by 1,25-dihydroxyvitamin D-3 product : thioredoxin interacting protein isoform 2 protein_id : NP_076208.1

name	Polr3gl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312458 CCDS:CCDS17641.1 GeneID:69870 MGI:1917120
definition	codon_start : 1 exception : mismatches in translation product : polymerase (RNA) III (DNA directed) polypeptide G like protein_id : NP_081517.1

name	Ankrd34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953245 GeneID:545554 MGI:3617846
definition	codon_start : 1 product : ankyrin repeat domain 34 protein_id : NP_001020022.2

name	Rbm8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385356 GeneID:60365 MGI:1913129
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003729 - mRNA binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0000184 - mRNA catabolism, nonsense-mediated decay [Evidence IEA]; GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RNA binding motif protein 8a protein_id : NP_080151.1

name	Pex11b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981575 CCDS:CCDS17643.1 GeneID:18632 MGI:1338882
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005778 - peroxisomal membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_process : GO:0016559 - peroxisome fission [Evidence IEA]; GO:0007031 - peroxisome organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : peroxisomal biogenesis factor 11b protein_id : NP_035199.2

name	Itga10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486692 GeneID:213119 MGI:2153482
definition	GO_component : GO:0008305 - integrin complex [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 note : integrin subunit alpha10 product : integrin, alpha 10 protein_id : NP_001074522.1

name	Ankrd35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487271 GeneID:213121 MGI:2442590
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : ankyrin repeat domain 35 protein_id : NP_001074608.1

name	Pias3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122655 GeneID:229615 MGI:1913126
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019789 - SUMO ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016925 - protein sumoylation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : protein inhibitor of activated STAT 3 isoform 1 protein_id : NP_666247.1

name	Pias3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055308 CCDS:CCDS17645.1 GeneID:229615 MGI:1913126
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019789 - SUMO ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016925 - protein sumoylation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : protein inhibitor of activated STAT 3 isoform 2 protein_id : NP_061282.1

name	Polr3c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20874887 GeneID:74414 MGI:1921664
definition	codon_start : 1 product : polymerase (RNA) III (DNA directed) polypeptide C isoform 1 protein_id : XP_131049.1

name	Zfp364 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980967 CCDS:CCDS17647.1 GeneID:67845 MGI:1915095
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Rabring7; Rab7-interacting RING finger protein product : Rabring 7 protein_id : NP_080682.2

name	Cd160 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980881 CCDS:CCDS17648.1 GeneID:54215 MGI:1860383
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : natural killer cell BY55 product : CD160 antigen protein_id : NP_061237.2

name	Pdzk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946938 CCDS:CCDS17649.1 GeneID:59020 MGI:1928901
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] codon_start : 1 exception : mismatches in translation product : PDZ domain containing 1 protein_id : NP_067492.1

name	Gpr89 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312914 CCDS:CCDS17650.1 GeneID:67549 MGI:1914799
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 89 protein_id : NP_080505.1

name	Gja8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680009 CCDS:CCDS17651.1 GeneID:14616 MGI:99953
definition	GO_component : GO:0005922 - connexon complex [Evidence IEA]; GO:0005921 - gap junction [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015285 - connexon channel activity [Evidence IEA]; GO:0005243 - gap-junction forming channel activity [Evidence IEA] GO_process : GO:0007154 - cell communication [Evidence IEA]; GO:0007267 - cell-cell signaling [Evidence IEA]; GO:0001747 - eye development (sensu Mammalia) [Evidence IMP] codon_start : 1 note : connexin 50; alpha 8 connexin; lens opacity 10 product : gap junction membrane channel protein alpha 8 protein_id : NP_032149.1

name	9230114J08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251402 GeneID:78080 MGI:1925330
definition	codon_start : 1 product : hypothetical protein LOC78080 protein_id : XP_001480463.1

name	Gja5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680005 CCDS:CCDS17652.1 GeneID:14613 MGI:95716
definition	GO_component : GO:0005922 - connexon complex [Evidence IEA]; GO:0005921 - gap junction [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015285 - connexon channel activity [Evidence IEA]; GO:0005243 - gap-junction forming channel activity [Evidence IEA] GO_process : GO:0001568 - blood vessel development [Evidence IMP]; GO:0007154 - cell communication [Evidence IEA]; GO:0007267 - cell-cell signaling [Evidence IEA]; GO:0035050 - embryonic heart tube development [Evidence IMP]; GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0001501 - skeletal development [Evidence IMP] codon_start : 1 note : connexin 40; gap junction protein alpha 5 product : gap junction membrane channel protein alpha 5 protein_id : NP_032147.1

name	Acp6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66773165 CCDS:CCDS17653.1 GeneID:66659 MGI:1931010
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : acid phosphatase like 1 product : acid phosphatase 6, lysophosphatidic protein_id : NP_062774.2

name	Bcl9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56606137 CCDS:CCDS17654.1 GeneID:77578 MGI:1924828
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : B-cell lymphoma 9; nuclear co-factor of beta-catenin signalling product : B-cell CLL/lymphoma 9 protein_id : NP_084209.3

name	LOC100042897 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042897
definition	number : 4 pseudo : _no_value

name	LOC100042897 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042897
definition	number : 3 pseudo : _no_value

name	LOC100042897 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042897
definition	number : 2 pseudo : _no_value

name	LOC100042897 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042897
definition	number : 1 pseudo : _no_value

name	LOC100042898 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042898
definition	number : 1 pseudo : _no_value

name	LOC277589 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251319 GeneID:277589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 865 ESTs, 7 Proteins product : similar to MGC27348 protein pseudo : _no_value transcript_id : XR_034004.1

name	LOC668448 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251380 GeneID:668448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 46 ESTs, 3 Proteins product : similar to mitochondrial ribosomal protein S16 pseudo : _no_value transcript_id : XR_034548.1

name	LOC100043312 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251385 GeneID:100043312
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 364 ESTs, 12 Proteins product : similar to high-mobility group box 1 pseudo : _no_value transcript_id : XR_034560.1

name	Terc (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:38157993 GeneID:21748 MGI:109558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : telomerase RNA component transcript_id : NR_001579.1

name	BC107364 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149251395 GeneID:329716 MGI:3618860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : cDNA sequence BC107364 transcript_id : XR_035445.1

name	LOC668500 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251326 GeneID:668500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 4 Proteins product : similar to CCR4-NOT transcription complex, subunit 3 pseudo : _no_value transcript_id : XR_034066.1

name	6330549D23Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149251132 GeneID:229613 MGI:2442586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330549D23 gene pseudo : _no_value transcript_id : XR_035121.1

clone name	MSMg01-389D04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-408M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261M21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-469D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518B05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-524G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381F03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-328J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137B03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-260N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346G13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-378L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212A24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-078P20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-426F23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-273D18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-421N11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-271B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-502K05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-495K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-098D05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-379H13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-464D01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-360N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-475M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278O20
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-243H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215G09
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-322P20.b	B6Ng01-322P20.g
ACC	GA111688	GA111689
length	1,082	1,049
definition	B6Ng01-322P20.b	B6Ng01-322P20.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(96,127,190 - 96,128,271)	(95,981,951 - 95,982,990)
sequence	gaattcatatagaaacagcactccctccaattgagggataacataaagac aatatcatagccagctagactgtctaggtcatcgtataaacatttttggt ccagcatgatgctagatgttttggcaaaggtatattcaattaaattactt ccttaggtttgtttgttttttgttttgtttttgtttgtttgtttgttttt tcgagacagggtttctctgtatagccctggctgtcctggaactcactttg tagaccaggctggcctcgaactcagagatccacattcctctgcctcccaa gtgctgggattaaaggcgtgcgccaccacgcccggctcttgtttgttttt aagacaggggtcctctacatagtcctggccatcctgaacttactatgtag actaggcaagagtgtatttgaaatgagatcagcttttacattggtaaatg ctaagtgaagcagaatgtgaatgggttttatccaatcagctgaaggactt aataaaaacaggtggaccttcccaaagagggagtcaattgtatttattat ataagataattataacactacgttacttgttctagaagacctacctaaac caaaattcttacaggactcatttgctgggattcatacctttaacttttga tttgccacaatgatgtgaaccaatatcttaaattacatattgattgatca acatgtagctaggtggaagtctgctccatccttctggaaaatactgaaga acagggtacattctactaattctctcctgttgcccacagcagacagagag gaggcacaaacatcaggggtcagcgagcgaggtttttctcctttggggga agatgctgggcacagagctctttaagaagtcattctgaccggcccctcta gcccttggtttgaccaggtcaccagagaaataattcacaaatgtacaaaa ttgtctttgagatgtcatctgatgaccagacagggagaggtccttctcac ttccacagaaaaacacacgcattcctggatgtatttctatagttggagtt aacacactatcaggatgtgaagattttttttt	gaattcactaggtagaccaggctggccatgaactcagatctgcctctgct ggggttgaagacaccatgctcagaggaagcttcagctcctgagtgttatt accatggctttcatctggagccatgggaatgtcttaagtaattgctagac agggtgagtgaggaaagcagatgttcagtgaatgacgcttagatcttagt cctaattgcgttcacattctccattcttccactctaacgtttatggttcc tgcaaaggctttgctggtgaccaggatgaacacagcaagtgttaaactgt cagaacatctaacttggtccgaatgttcaggaagacttcttcggaaaata gtgatgtctaggtttttggtcggaagatggtcttactagtcagccatggt ggtgcatgcctttgaccccggcagaggcgggcaggtgggtctcttgagtt caagaccagtctggcctacatagttcctaggacaagccagagttaagaag atgatctagcctaatcctaacccagaagccttacctggttctcaacaggc cttgtcctcctgcctgtcaatagaatgttggaattgggaggttgccatgc tcctagctggagttctcttgaaaggtggatctagcactaaggctgtgtga aggctgaggtcagagccaggttgggctggaggttttagtgcttttcagct ctttttcattggtgaccataaaaacccttcaaaacagctgggcagtggtg gcgcatgcctttaatcccagcactcgggaggcagaggcaggtggatttct gagtttgaggccagcctggtctacagagtgagttccaggacagccagggt ttctacagagaaaccctgtctcaaaacaacaaacacaaacaaacaaaccc ttcaaaacaaccttgaggtaaggggaggatgctgtgggctctttgcccag gaatattgaactgccccaaggcatccaggtagtgaaatgactaagcaggt ggaagcagacttggattagagatgtaatatgagaagttcaaccaaccga
quality values	Open. Hide. 58 31 35 31 62 32 29 62 56 62 47 62 62 62 56 56 29 62 54 62 62 62 62 62 37 49 49 44 34 59 59 59 49 38 34 49 49 16 26 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 59 62 62 59 59 62 62 62 62 59 62 62 62 62 56 54 62 59 56 59 62 62 62 62 62 54 54 54 49 49 49 49 54 42 54 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 54 42 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 43 37 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 42 54 62 62 62 62 62 43 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 41 41 42 62 62 47 47 39 62 62 46 58 46 38 41 52 45 42 54 40 54 58 54 54 58 58 52 54 48 48 52 41 58 36 39 54 54 52 54 54 58 58 54 58 58 58 58 54 35 54 52 34 54 54 52 58 58 58 52 33 58 52 58 58 58 58 58 47 47 58 58 58 52 42 34 52 42 39 58 58 54 58 58 58 54 58 43 42 42 37 34 47 41 41 52 58 52 51 42 40 39 43 40 53 29 51 52 58 53 58 54 50 47 54 51 41 42 32 50 46 50 46 58 50 51 31 49 50 51 51 58 50 58 58 58 58 50 52 51 50 50 52 52 51 41 32 41 41 46 54 40 52 52 58 49 50 50 48 50 49 41 33 51 39 38 39 23 58 50 40 39 20 36 33 21 36 30 27 53 53 52 33 37 37 41 53 53 53 58 34 53 42 53 40 39 35 33 33 51 42 29 52 37 32 37 32 31 45 40 22 51 25 40 41 46 14 22 17 52 30 9 38 22 27 45 40 47 29 44 28 53 31 13 9 54 45 51 37 31 29 31 41 30 30 24 35 28 28 13 17 25 40 37 54 31 31 39 19 52 18 47 6 9 41 40 32 24 25 23 18 23 15 31 31 32 19 40 40 22 30 31 30 10 28 18 31 40 31 42 45 26 22 20 13 31 18 18 30 33 28 45 30 23 26 34 32 20 34 31 32 27 30 31 22 26 25 16 32 17 36 46 15 6 10 36 12 8 42 13 24 31 7 31 27 20 9 14 29 9 7 16 20 10 19 6 14 47 26 15 8 36 13 10 22 25 23 15 39 20 10 15 11 14 20 14 39 44 9 9 6 20 7 26 21 31 6 20 12 6 31 9 17 14 24 27 33 32 20 20 11 11 32 23 16 25 21 24 27 9 9 10 28 19 6 5 36 31 20 10 8 36 32 31 25 29 9 9 20 21 38 11 23 10 18 12 22 34 28 33 30 23 24 24 17 4 7 10 16 10 25 10 23 26 14 26 7 7 8 32 10 18 9 43 8 10 7 5 6 14 8 10 18 7 4 5 14 29 27 9 5 4 4 4 7 25 18 9 3 7 10 15 8 5 3 9 19 8 21 7 8 20 13 28 28 33 21 32 11 28 23	Open. Hide. 62 47 51 47 62 47 42 47 38 44 24 38 19 21 20 21 24 23 27 24 49 56 62 62 62 62 59 62 62 59 59 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 54 38 32 54 56 59 62 62 59 59 59 62 62 62 62 62 54 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 54 49 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 56 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 47 41 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 54 58 58 58 58 54 45 47 58 58 54 58 49 58 58 54 58 58 54 54 58 58 54 58 58 54 54 45 58 58 58 58 58 58 58 58 58 58 58 58 52 54 58 58 58 52 58 58 47 58 54 58 58 58 58 58 47 58 58 58 58 54 38 45 29 58 58 39 58 52 54 58 54 54 51 54 54 52 52 54 54 58 58 54 50 58 58 46 53 51 58 51 58 58 58 48 50 54 46 58 49 50 49 49 53 42 53 58 52 47 51 40 52 41 49 31 58 50 52 41 47 50 50 40 38 45 36 58 48 32 11 58 39 46 50 34 58 32 50 50 37 53 53 49 49 58 58 51 50 49 51 58 26 14 36 50 54 58 58 51 39 51 51 34 58 49 58 49 30 49 40 41 58 50 53 58 58 58 49 42 24 42 25 44 50 50 51 52 23 49 26 51 31 58 52 50 41 42 37 39 51 51 35 17 58 52 50 40 30 33 41 52 52 54 43 39 33 21 32 52 49 35 54 53 32 37 28 37 32 23 25 35 36 51 28 33 41 41 31 51 27 31 32 52 37 28 32 30 31 52 36 12 9 54 32 38 37 33 9 31 21 13 10 49 24 38 37 23 19 54 45 40 34 25 49 21 47 54 49 37 30 8 35 31 38 27 29 45 26 33 41 26 37 37 32 33 31 26 28 27 26 37 34 41 30 53 31 26 19 15 12 21 31 24 29 33 25 41 28 27 47 51 25 53 17 24 29 28 35 24 32 47 19 36 51 45 21 40 13 17 46 32 31 18 21 31 30 45 19 27 29 22 30 11 42 7 9 18 6 6 42 29 11 25 41 23 25 30 33 33 9 22 16 18 20 33 29 46 46 33 10 9 26 18 31 31 33 31 33 18 34 15 29 26 27 48 46 8 28 25 21 26 25 25 22 31 23 9 21 46 34 26 22 11 25 31 26 11 6 46 38 26 31 21 36 25 24 8 6 6 9 27 27 19 23 28 14 30 12 11 7 10 19 29 31 21 31 15 27 14 14 19 18 21 6 5 17 10 44 26 29 7 20 32 38 12 32 16 21 29 24 20 17 35 7 11 8 24 16 21 9 32 22 18 25 10 18 14 8 14 11 8 26 19 8 4 4 19 28 17 13 5 11 6 5 7 6 10 6 14 11 8 8 7 7 29 4 8 8 8 18 21

Alignment Information

BAC End 1

BAC End 2

seq1: chr3_96127190_96128271
seq2: B6Ng01-322P20.b_46_1127 (reverse)

seq1  AAAAAAAAATCTTCACACTCCTGATAGTGTGGTAAACTACAAACTATAGA  50
      ||||||||||||||||| |||||||||||| || |||| | |||||||||
seq2  AAAAAAAAATCTTCACA-TCCTGATAGTGT-GTTAACT-CCAACTATAGA  47

seq1  AATACATCCAGGAATGGCGTGGTTGTTTTTCTGT-GAAGTGAGAAGGACC  99
      ||||||||||||||| |||||  ||||||||||| |||||||||||||||
seq2  AATACATCCAGGAAT-GCGTG--TGTTTTTCTGTGGAAGTGAGAAGGACC  94

seq1  TCTCCCTGTCTGGTCATCAGATGACATCTCCAAGAC-ATTTTGTACATTT  148
      |||||||||||||||||||||||||||||| ||||| |||||||||||||
seq2  TCTCCCTGTCTGGTCATCAGATGACATCTCAAAGACAATTTTGTACATTT  144

seq1  GTG-ATTATTTCTCTGGTGACCTGGTCAA--CCAGGGCTAGAGGGGCCGG  195
      ||| |||||||||||||||||||||||||  | |||||||||||||||||
seq2  GTGAATTATTTCTCTGGTGACCTGGTCAAACCAAGGGCTAGAGGGGCCGG  194

seq1  TCAGAATGACTTCTTAAAGAGCTCTGTGCCCAGCATCTTCCCCC-AAGGA  244
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  TCAGAATGACTTCTTAAAGAGCTCTGTGCCCAGCATCTTCCCCCAAAGGA  244

seq1  GAAAAACCTCGCTCGCTGACCCCTGATGTTTGTGCCTCCTCTCTGTCTGC  294
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAAACCTCGCTCGCTGACCCCTGATGTTTGTGCCTCCTCTCTGTCTGC  294

seq1  TGTGGGCAACAGGAGAGAATTAGTAGAATGTACCCTGTTCTTCAGTATTT  344
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGGCAACAGGAGAGAATTAGTAGAATGTACCCTGTTCTTCAGTATTT  344

seq1  TCCAGAAGGATGGAGCAGACTTCCACCTAGCTACATGTTGATCAATCAAT  394
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGAAGGATGGAGCAGACTTCCACCTAGCTACATGTTGATCAATCAAT  394

seq1  ATGTAATTTAAGATATTGGTTCACATCATTGTGGCAAATCAAAAGTTAAA  444
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTAATTTAAGATATTGGTTCACATCATTGTGGCAAATCAAAAGTTAAA  444

seq1  GGTATGAATCCCAGCAAATGAGTCCTGTAAGAATTTTGGTTTAGGTAGGT  494
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTATGAATCCCAGCAAATGAGTCCTGTAAGAATTTTGGTTTAGGTAGGT  494

seq1  CTTCTAGAACAAGTAACGTAGTGTTATAATTATCTTATATAATAAATACA  544
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTAGAACAAGTAACGTAGTGTTATAATTATCTTATATAATAAATACA  544

seq1  ATTGACTCCCTCTTTGGGAAGGTCCACCTGTTTTTATTAAGTCCTTCAGC  594
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGACTCCCTCTTTGGGAAGGTCCACCTGTTTTTATTAAGTCCTTCAGC  594

seq1  TGATTGGATAAAACCCATTCACATTCTGCTTCACTTAGCATTTACCAATG  644
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTGGATAAAACCCATTCACATTCTGCTTCACTTAGCATTTACCAATG  644

seq1  TAAAAGCTGATCTCATTTCAAATACACTCTTGCCTAGTCTACATAGTAAG  694
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAAGCTGATCTCATTTCAAATACACTCTTGCCTAGTCTACATAGTAAG  694

seq1  TTCAGGATGGCCAGGACTATGTAGAGGACCCCTGTCTTAAAAACAAACAA  744
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGGATGGCCAGGACTATGTAGAGGACCCCTGTCTTAAAAACAAACAA  744

seq1  GAGCCGGGCGTGGTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGA  794
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCGGGCGTGGTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGA  794

seq1  GGAATGTGGATCTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTC  844
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAATGTGGATCTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTC  844

seq1  CAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCGAAAAAACAAACAA  894
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCGAAAAAACAAACAA  894

seq1  ACAAACAAAAACAAAACAAAAAACAAACAAACCTAAGGAAGTAATTTAAT  944
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAACAAAAACAAAACAAAAAACAAACAAACCTAAGGAAGTAATTTAAT  944

seq1  TGAATATACCTTTGCCAAAACATCTAGCATCATGCTGGACCAAAAATGTT  994
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATATACCTTTGCCAAAACATCTAGCATCATGCTGGACCAAAAATGTT  994

seq1  TATACGATGACCTAGACAGTCTAGCTGGCTATGATATTGTCTTTATGTTA  1044
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATACGATGACCTAGACAGTCTAGCTGGCTATGATATTGTCTTTATGTTA  1044

seq1  TCCCTCAATTGGAGGGAGTGCTGTTTCTATATGAATTC  1082
      ||||||||||||||||||||||||||||||||||||||
seq2  TCCCTCAATTGGAGGGAGTGCTGTTTCTATATGAATTC  1082

seq1: chr3_95981951_95982990
seq2: B6Ng01-322P20.g_66_1108

seq1  GAATTCACTAGGTAGACCAGGCTGGCCATGAACTCAGATCTGCCTCTGCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTAGGTAGACCAGGCTGGCCATGAACTCAGATCTGCCTCTGCT  50

seq1  GGGGTTGAAGACACCATGCTCAGAGGAAGCTTCAGCTCCTGAGTGTTATT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGTTGAAGACACCATGCTCAGAGGAAGCTTCAGCTCCTGAGTGTTATT  100

seq1  ACCATGGCTTTCATCTGGAGCCATGGGAATGTCTTAAGTAATTGCTAGAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCATGGCTTTCATCTGGAGCCATGGGAATGTCTTAAGTAATTGCTAGAC  150

seq1  AGGGTGAGTGAGGAAAGCAGATGTTCAGTGAATGACGCTTAGATCTTAGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGTGAGTGAGGAAAGCAGATGTTCAGTGAATGACGCTTAGATCTTAGT  200

seq1  CCTAATTGCGTTCACATTCTCCATTCTTCCACTCTAACGTTTATGGTTCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAATTGCGTTCACATTCTCCATTCTTCCACTCTAACGTTTATGGTTCC  250

seq1  TGCAAAGGCTTTGCTGGTGACCAGGATGAACACAGCAAGTGTTAAACTGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAAAGGCTTTGCTGGTGACCAGGATGAACACAGCAAGTGTTAAACTGT  300

seq1  CAGAACATCTAACTTGGTCCGAATGTTCAGGAAGACTTCTTCGGAAAATA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAACATCTAACTTGGTCCGAATGTTCAGGAAGACTTCTTCGGAAAATA  350

seq1  GTGATGTCTAGGTTTTTGGTCGGAAGATGGTCTTACTAGTCAGCCATGGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGATGTCTAGGTTTTTGGTCGGAAGATGGTCTTACTAGTCAGCCATGGT  400

seq1  GGTGCATGCCTTTGACCCCGGCAGAGGCGGGCAGGTGGGTCTCTTGAGTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGCATGCCTTTGACCCCGGCAGAGGCGGGCAGGTGGGTCTCTTGAGTT  450

seq1  CAAGACCAGTCTGGCCTACATAGTTCCTAGGACAAGCCAGAGTTAAGAAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGACCAGTCTGGCCTACATAGTTCCTAGGACAAGCCAGAGTTAAGAAG  500

seq1  ATGATCTAGCCTAATCCTAACCCAGAAGCCTTACCTGGTTCTCAACAGGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGATCTAGCCTAATCCTAACCCAGAAGCCTTACCTGGTTCTCAACAGGC  550

seq1  CTTGTCCTCCTGCCTGTCAATAGAATGTTGGAATTGGGAGGTTGCCATGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGTCCTCCTGCCTGTCAATAGAATGTTGGAATTGGGAGGTTGCCATGC  600

seq1  TCCTAGCTGGAGTTCTCTTGAAAGGTGGATCTAGCACTAAGGCTGTGTGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTAGCTGGAGTTCTCTTGAAAGGTGGATCTAGCACTAAGGCTGTGTGA  650

seq1  AGGCTGAGGTCAGAGCCAGGTTGGGCTGGAGGTTTTAGTGCTTTTCAGCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCTGAGGTCAGAGCCAGGTTGGGCTGGAGGTTTTAGTGCTTTTCAGCT  700

seq1  CTTTTTCATTGGTGACCATAAAAACCCTTCAAAACAGCTGGGCAGTGGTG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTTCATTGGTGACCATAAAAACCCTTCAAAACAGCTGGGCAGTGGTG  750

seq1  GCGCATGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGTGGATTTCT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGCATGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGTGGATTTCT  800

seq1  GAGTTTGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGG-  849
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  GAGTTTGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGT  850

seq1  TTCTACAGAGAAACCCTGTCTCAAAACAACAACAACAAACAAACAAAACC  899
      ||||||||||||||||||||||||||||||||  |||||||||| |||||
seq2  TTCTACAGAGAAACCCTGTCTCAAAACAACAAACACAAACAAAC-AAACC  899

seq1  CTTCAAAACAACCTTGAGGTAA-GGGAGGATGCTGTGGGCTCTTTGCCCA  948
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  CTTCAAAACAACCTTGAGGTAAGGGGAGGATGCTGTGGGCTCTTTGCCCA  949

seq1  GGAATA-TGAACTGCCCC-AGGCATCCAGGTAGTGAAATTGACTAAGCAG  996
      |||||| ||||||||||| ||||||||||||||||||| |||||||||||
seq2  GGAATATTGAACTGCCCCAAGGCATCCAGGTAGTGAAA-TGACTAAGCAG  998

seq1  GTGGAGGCAGACTTGGATTAGAGATGTAAATATGAGA--GTCAACC  1040
      ||||| ||||||||||||||||||||| |||||||||   ||||||
seq2  GTGGAAGCAGACTTGGATTAGAGATGT-AATATGAGAAGTTCAACC  1043

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information