MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-277F13
Chromosome	3 (Build37)
Map Location	89,177,895 - 89,178,129
singlet/doublet	singlet
Overlap gene	Dcst2
Upstream gene	Bglap2, LOC627995, Bglap1, Pmf1, Slc25a44, LOC667989, Sema4a, LOC546802, Lmna, 2700083E18Rik, Rab25, Mapbpip, Ubqln4, LOC545536, Ssr2, Arhgef2, Rxfp4, 2810403A07Rik, Rit1, Syt11, 5830417I10Rik, Msto1, Dap3, Ash1l, Rusc1, Fdps, LOC628070, Pklr, Hcn3, Clk2, Scamp3, 1110013L07Rik, Gba, Mtx1, Thbs3, Muc1, Trim46, Krtcap2, Dpm3, Rag1ap1, Efna1, Efna3, Efna4, Adam15, Dcst1
Downstream gene	Zbtb7b, Lenep, Flad1, Cks1b, Shc1, Pygo2, Pbxip1, Pmvk, Kcnn3, LOC668078, Adar, Chrnb2, Ube2q1, LOC668087, She, Il6ra, Atp8b2, LOC668102, Hax1, Ubap2l, 4933434E20Rik, 1700094D03Rik, Tpm3, Nup210l, Rps27, Rab13, Jtb, Creb3l4, LOC100042397, Slc39a1, Crtc2, Dennd4b, Gatad2b
Link	Open Mouse BAC browser

Click to get alignment info.

name	Bglap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12097 MGI:88157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627995 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 2 Proteins

name	Bglap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12096 MGI:88156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pmf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67037 MGI:1914287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a44 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229517 MGI:2444391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667989 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 123 ESTs, 10 Proteins pseudo : _no_value

name	Sema4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20351 MGI:107560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546802 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546802
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Lmna (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16905 MGI:96794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2700083E18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72640 MGI:1919890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53868 MGI:1858203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapbpip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83409 MGI:1932697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubqln4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94232 MGI:2150152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545536 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 218 ESTs, 3 Proteins

name	Ssr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66256 MGI:1913506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgef2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16800 MGI:103264
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rxfp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242093 MGI:2182926
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810403A07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74200 MGI:1921450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rit1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19769 MGI:108053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syt11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229521 MGI:1859547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830417I10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76022 MGI:1923272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 42 ESTs, 1 Protein

name	Msto1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229524 MGI:2385175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dap3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65111 MGI:1929538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ash1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192195 MGI:2183158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rusc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72296 MGI:1919546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Fdps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110196 MGI:104888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628070 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628070
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	Pklr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18770 MGI:97604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hcn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15168 MGI:1298211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12748 MGI:1098669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scamp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24045 MGI:1346346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110013L07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68521 MGI:1915771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gba (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14466 MGI:95665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mtx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17827 MGI:103025
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thbs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21827 MGI:98739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Muc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17829 MGI:97231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim46 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:360213 MGI:2673000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Krtcap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66059 MGI:1913309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68563 MGI:1915813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rag1ap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19729 MGI:107417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efna1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13636 MGI:103236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efna3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13638 MGI:106644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efna4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13639 MGI:106643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adam15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11490 MGI:1333882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Dcst1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77772 MGI:1925022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dcst2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329702 MGI:2685606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein

name	Zbtb7b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22724 MGI:102755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lenep (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57275 MGI:1930020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Flad1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319945 MGI:2443030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cks1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54124 MGI:1889208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20416 MGI:98296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pygo2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68911 MGI:1916161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pbxip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229534 MGI:2441670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pmvk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68603 MGI:1915853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140493 MGI:2153183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668078 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668078
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Adar (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56417 MGI:1889575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Chrnb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11444 MGI:87891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2q1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70093 MGI:1917343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668087 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668087
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	She (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214547 MGI:1099462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il6ra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16194 MGI:105304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp8b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54667 MGI:1859660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668102 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Hax1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23897 MGI:1346319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubap2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74383 MGI:1921633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4933434E20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99650 MGI:1914027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	1700094D03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73545 MGI:1920795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 2 Proteins

name	Tpm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59069 MGI:1890149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nup210l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77595 MGI:1924845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins

name	Rps27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57294 MGI:1888676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68328 MGI:1927232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jtb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23922 MGI:1346082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Creb3l4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78284 MGI:1916603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042397 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Slc39a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30791 MGI:1353474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crtc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74343 MGI:1921593
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dennd4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229541 MGI:2446201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gatad2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229542 MGI:2443225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bglap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816951 GeneID:12097 MGI:88157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone gamma-carboxyglutamate protein 2 transcript_id : NM_001032298.2

name	LOC627995 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94369697 GeneID:627995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 2 Proteins product : similar to progestin and adipoQ receptor family member VI transcript_id : XM_892711.2

name	Bglap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816949 GeneID:12096 MGI:88156
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone gamma carboxyglutamate protein 1 transcript_id : NM_007541.2

name	Bglap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816946 GeneID:12096 MGI:88156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone gamma carboxyglutamate protein 1 transcript_id : NM_001037939.1

name	Pmf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369052 GeneID:67037 MGI:1914287
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polyamine-modulated factor 1 transcript_id : NM_025928.2

name	Slc25a44 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377008 GeneID:229517 MGI:2444391
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25, member 44 transcript_id : NM_178696.3

name	Sema4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982742 GeneID:20351 MGI:107560
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A transcript_id : NM_013658.2

name	Lmna (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50355691 GeneID:16905 MGI:96794
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lamin A transcript_id : NM_001002011.1

name	Lmna (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506842 GeneID:16905 MGI:96794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lamin A transcript_id : NM_019390.1

name	2700083E18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274133 GeneID:72640 MGI:1919890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700083E18 gene transcript_id : NM_001029890.1

name	Rab25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803166 GeneID:53868 MGI:1858203
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB25, member RAS oncogene family transcript_id : NM_016899.3

name	Mapbpip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476187 GeneID:83409 MGI:1932697
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein binding protein interacting protein transcript_id : NM_031248.3

name	Ubqln4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131205 GeneID:94232 MGI:2150152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquilin 4 transcript_id : NM_033526.2

name	LOC545536 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251290 GeneID:545536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 218 ESTs, 3 Proteins product : hypothetical LOC545536 transcript_id : XM_001478774.1

name	Ssr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803157 GeneID:66256 MGI:1913506
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal sequence receptor, beta transcript_id : NM_025448.3

name	Arhgef2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271403 GeneID:16800 MGI:103264
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rho/rac guanine nucleotide exchange factor (GEF) 2 transcript_id : NM_008487.2

name	Rxfp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32451489 GeneID:242093 MGI:2182926
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : relaxin family peptide receptor 4 transcript_id : NM_181817.1

name	2810403A07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366623 GeneID:74200 MGI:1921450
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810403A07 gene transcript_id : NM_028814.2

name	Rit1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802723 GeneID:19769 MGI:108053
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ras-like without CAAX 1 transcript_id : NM_009069.3

name	Syt11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378013 GeneID:229521 MGI:1859547
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin XI transcript_id : NM_018804.3

name	5830417I10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251296 GeneID:76022 MGI:1923272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 42 ESTs, 1 Protein product : RIKEN cDNA 5830417I10 gene transcript_id : XM_001478845.1

name	Msto1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450272 GeneID:229524 MGI:2385175
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : misato homolog 1 (Drosophila) transcript_id : NM_144898.1

name	Dap3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42734455 GeneID:65111 MGI:1929538
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : death associated protein 3 transcript_id : NM_022994.2

name	Ash1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76096373 GeneID:192195 MGI:2183158
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ash1 (absent, small, or homeotic)-like (Drosophila) transcript_id : NM_138679.5

name	Rusc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139947574 GeneID:72296 MGI:1919546
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RUN and SH3 domain containing 1 transcript_id : NM_001083807.1

name	Rusc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948763 GeneID:72296 MGI:1919546
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RUN and SH3 domain containing 1 transcript_id : NM_028188.2

name	Rusc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139949086 GeneID:72296 MGI:1919546
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RUN and SH3 domain containing 1 transcript_id : NM_001083808.1

name	Fdps (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129959 GeneID:110196 MGI:104888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : farnesyl diphosphate synthetase transcript_id : NM_134469.3

name	Pklr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8567389 GeneID:18770 MGI:97604
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyruvate kinase liver and red blood cell transcript_id : NM_013631.1

name	Hcn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680190 GeneID:15168 MGI:1298211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hyperpolarization-activated, cyclic nucleotide-gated K+ 3 transcript_id : NM_008227.1

name	Clk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385060 GeneID:12748 MGI:1098669
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC-like kinase 2 transcript_id : NM_007712.2

name	Scamp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118601010 GeneID:24045 MGI:1346346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretory carrier membrane protein 3 transcript_id : NM_011886.2

name	1110013L07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67846100 GeneID:68521 MGI:1915771
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110013L07 gene transcript_id : NM_001014995.1

name	Gba (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116734814 GeneID:14466 MGI:95665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucosidase, beta, acid transcript_id : NM_001077411.1

name	Gba (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130967 GeneID:14466 MGI:95665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucosidase, beta, acid transcript_id : NM_008094.4

name	Mtx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305290 GeneID:17827 MGI:103025
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : metaxin 1 transcript_id : NM_013604.1

name	Thbs3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8567413 GeneID:21827 MGI:98739
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thrombospondin 3 transcript_id : NM_013691.1

name	Muc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305292 GeneID:17829 MGI:97231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mucin 1, transmembrane transcript_id : NM_013605.1

name	Trim46 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87080820 GeneID:360213 MGI:2673000
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 46 transcript_id : NM_183037.2

name	Trim46 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87080828 GeneID:360213 MGI:2673000
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 46 transcript_id : NM_001039466.1

name	Krtcap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382643 GeneID:66059 MGI:1913309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratinocyte associated protein 2 transcript_id : NM_025327.2

name	Dpm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801850 GeneID:68563 MGI:1915813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dolichyl-phosphate mannosyltransferase polypeptide 3 transcript_id : NM_026767.3

name	Rag1ap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353618 GeneID:19729 MGI:107417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : recombination activating gene 1 activating protein 1 transcript_id : NM_009057.2

name	Efna1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374591 GeneID:13636 MGI:103236
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ephrin A1 transcript_id : NM_010107.3

name	Efna3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117935035 GeneID:13638 MGI:106644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ephrin A3 transcript_id : NM_010108.1

name	Efna4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110835738 GeneID:13639 MGI:106643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ephrin A4 transcript_id : NM_007910.2

name	Adam15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109148518 GeneID:11490 MGI:1333882
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 15 (metargidin) transcript_id : NM_009614.2

name	Adam15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109148516 GeneID:11490 MGI:1333882
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 15 (metargidin) transcript_id : NM_001037722.2

name	Dcst1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116812882 GeneID:77772 MGI:1925022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DC-STAMP domain containing 1 transcript_id : NM_029974.1

name	Dcst2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251259 GeneID:329702 MGI:2685606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : DC-STAMP domain containing 2 transcript_id : XM_283860.5

name	Zbtb7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61657926 GeneID:22724 MGI:102755
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 7B transcript_id : NM_009565.4

name	Lenep (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113866001 GeneID:57275 MGI:1930020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lens epithelial protein transcript_id : NM_020517.3

name	Flad1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89337261 GeneID:319945 MGI:2443030
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RFad1, flavin adenine dinucleotide synthetase, homolog (yeast) transcript_id : NM_177041.3

name	Cks1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8393134 GeneID:54124 MGI:1889208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC28 protein kinase 1b transcript_id : NM_016904.1

name	Shc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802610 GeneID:20416 MGI:98296
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : src homology 2 domain-containing transforming protein C1 transcript_id : NM_011368.4

name	Pygo2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351456 GeneID:68911 MGI:1916161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pygopus 2 transcript_id : NM_026869.2

name	Pbxip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122650 GeneID:229534 MGI:2441670
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pre-B-cell leukemia transcription factor interacting protein 1 transcript_id : NM_146131.1

name	Pmvk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350475 GeneID:68603 MGI:1915853
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphomevalonate kinase transcript_id : NM_026784.2

name	Kcnn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:17978283 GeneID:140493 MGI:2153183
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 transcript_id : NM_080466.1

name	LOC668078 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94369707 GeneID:668078
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical LOC668078 transcript_id : XM_994194.1

name	Adar (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388349 GeneID:56417 MGI:1889575
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine deaminase, RNA-specific transcript_id : NM_001038587.2

name	Adar (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981008 GeneID:56417 MGI:1889575
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine deaminase, RNA-specific transcript_id : NM_019655.2

name	Chrnb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789302 GeneID:11444 MGI:87891
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal) transcript_id : NM_009602.3

name	Ube2q1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352603 GeneID:70093 MGI:1917343
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2Q (putative) 1 transcript_id : NM_027315.3

name	She (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85662386 GeneID:214547 MGI:1099462
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : src homology 2 domain-containing transforming protein E transcript_id : NM_172530.2

name	Il6ra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110431355 GeneID:16194 MGI:105304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 6 receptor, alpha transcript_id : NM_010559.2

name	Atp8b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487146 GeneID:54667 MGI:1859660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Atpase, class I, type 8B, member 2 transcript_id : NM_001081182.1

name	Hax1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360300 GeneID:23897 MGI:1346319
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HCLS1 associated X-1 transcript_id : NM_011826.2

name	Ubap2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239420 GeneID:74383 MGI:1921633
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin associated protein 2-like transcript_id : NM_028475.1

name	Ubap2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23943917 GeneID:74383 MGI:1921633
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin associated protein 2-like transcript_id : NM_153489.1

name	4933434E20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387754 GeneID:99650 MGI:1914027
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933434E20 gene transcript_id : NM_027500.2

name	4933434E20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20270195 GeneID:99650 MGI:1914027
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933434E20 gene transcript_id : NM_025762.1

name	1700094D03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251316 GeneID:73545 MGI:1920795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 2 Proteins product : RIKEN cDNA 1700094D03 gene transcript_id : XM_892960.3

name	Tpm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254524 GeneID:59069 MGI:1890149
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tropomyosin 3, gamma transcript_id : NM_022314.2

name	Nup210l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251320 GeneID:77595 MGI:1924845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins product : nucleoporin 210-like transcript_id : XM_001479463.1

name	Rps27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365586 GeneID:57294 MGI:1888676
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S27 transcript_id : NM_027015.2

name	Rab13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802134 GeneID:68328 MGI:1927232
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB13, member RAS oncogene family transcript_id : NM_026677.2

name	Jtb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124377999 GeneID:23922 MGI:1346082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumping translocation breakpoint transcript_id : NM_206924.2

name	Creb3l4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368602 GeneID:78284 MGI:1916603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cAMP responsive element binding protein 3-like 4 transcript_id : NM_030080.2

name	LOC100042397 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251264 GeneID:100042397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100042397 transcript_id : XM_001478107.1

name	Slc39a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930336 GeneID:30791 MGI:1353474
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 39 (zinc transporter), member 1 transcript_id : NM_013901.1

name	Crtc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037360 GeneID:74343 MGI:1921593
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CREB regulated transcription coactivator 2 transcript_id : NM_028881.1

name	Dennd4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119372291 GeneID:229541 MGI:2446201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DENN/MADD domain containing 4B transcript_id : NM_201407.2

name	Gatad2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21314853 GeneID:229542 MGI:2443225
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GATA zinc finger domain containing 2B transcript_id : NM_139304.1

name	Bglap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83816952 CCDS:CCDS17473.1 GeneID:12097 MGI:88157
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0001503 - ossification [Evidence IEA]; GO:0030500 - regulation of bone mineralization [Evidence IEA] codon_start : 1 note : osteocalcin; bone Gla protein product : bone gamma-carboxyglutamate protein 2 protein_id : NP_001027469.2

name	LOC627995 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82890264 GeneID:627995
definition	codon_start : 1 product : similar to progestin and adipoQ receptor family member VI protein_id : XP_897804.1

name	Bglap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671634 CCDS:CCDS17474.1 GeneID:12096 MGI:88156
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0001503 - ossification [Evidence IEA]; GO:0030500 - regulation of bone mineralization [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; osteocalcin; bone Gla protein product : bone gamma carboxyglutamate protein 1 isoform 1 protein_id : NP_031567.1

name	Bglap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83816947 GeneID:12096 MGI:88156
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0001503 - ossification [Evidence IEA]; GO:0030500 - regulation of bone mineralization [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; osteocalcin; bone Gla protein product : bone gamma carboxyglutamate protein 1 isoform 2 protein_id : NP_001033028.1

name	Pmf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385420 GeneID:67037 MGI:1914287
definition	GO_component : GO:0000778 - condensed nuclear chromosome kinetochore [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence TAS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007059 - chromosome segregation [Evidence ISS]; GO:0007067 - mitosis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : polyamine-modulated factor 1 protein_id : NP_080204.1

name	Slc25a44 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520099 GeneID:229517 MGI:2444391
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : solute carrier family 25, member 44 protein_id : NP_848811.1

name	Sema4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982743 CCDS:CCDS17475.1 GeneID:20351 MGI:107560
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 exception : mismatches in translation product : sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A protein_id : NP_038686.2

name	Lmna (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50355692 GeneID:16905 MGI:96794
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0005638 - lamin filament [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006998 - nuclear membrane organization and biogenesis [Evidence IGI] codon_start : 1 exception : mismatches in translation note : isoform A is encoded by transcript variant 1; lamin A/C product : lamin A isoform A protein_id : NP_001002011.1

name	Lmna (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506843 GeneID:16905 MGI:96794
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0005638 - lamin filament [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006998 - nuclear membrane organization and biogenesis [Evidence IGI] codon_start : 1 note : isoform C2 is encoded by transcript variant 2; lamin A/C product : lamin A isoform C2 protein_id : NP_062263.1

name	2700083E18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274134 CCDS:CCDS17476.1 GeneID:72640 MGI:1919890
definition	codon_start : 1 product : hypothetical protein LOC72640 protein_id : NP_001025061.1

name	Rab25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980838 CCDS:CCDS17477.1 GeneID:53868 MGI:1858203
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB25, member RAS oncogene family protein_id : NP_058595.2

name	Mapbpip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13752573 CCDS:CCDS17478.1 GeneID:83409 MGI:1932697
definition	GO_component : GO:0005764 - lysosome [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : late endosomal/lysosomal MP1 interacting protein product : mitogen-activated protein-binding protein-interacting protein protein_id : NP_112538.1

name	Ubqln4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15805016 CCDS:CCDS17479.1 GeneID:94232 MGI:2150152
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005829 - cytosol [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : ataxin-1 ubiquitin-like interacting protein product : ubiquilin 4 protein_id : NP_277068.1

name	LOC545536 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251291 GeneID:545536
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478824.1

name	Ssr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384850 CCDS:CCDS17480.1 GeneID:66256 MGI:1913506
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : signal sequence receptor, beta protein_id : NP_079724.1

name	Arhgef2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47271404 CCDS:CCDS17481.1 GeneID:16800 MGI:103264
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0043198 - dendritic shaft [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005874 - microtubule [Evidence ISS] GO_function : GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence IDA] [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0048365 - Rac GTPase binding [Evidence ISS]; GO:0030676 - Rac guanyl-nucleotide exchange factor activity [Evidence ISS]; GO:0017048 - Rho GTPase binding [Evidence ISS]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IDA] [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence ISS] [Evidence IEA] GO_process : GO:0007015 - actin filament organization [Evidence ISS] [Evidence IPI]; GO:0000902 - cell morphogenesis [Evidence ISS] [Evidence IDA]; GO:0006886 - intracellular protein transport [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007026 - negative regulation of microtubule depolymerization [Evidence ISS]; GO:0042127 - regulation of cell proliferation [Evidence ISS]; GO:0035023 - regulation of Rho protein signal transduction [Evidence ISS] [Evidence IDA] codon_start : 1 exception : mismatches in translation note : lymphoid blast crisis-like 1 product : rho/rac guanine nucleotide exchange factor (GEF) 2 protein_id : NP_032513.2

name	Rxfp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32451490 CCDS:CCDS17482.1 GeneID:242093 MGI:2182926
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004945 - angiotensin type II receptor activity [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor 100; relaxin-3/INSL7 receptor 2; G-protein coupled receptor product : relaxin 3 receptor 2 protein_id : NP_861538.1

name	2810403A07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362269 CCDS:CCDS17483.1 GeneID:74200 MGI:1921450
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC74200 protein_id : NP_083090.1

name	Rit1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677755 CCDS:CCDS17484.1 GeneID:19769 MGI:108053
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : RAS-like protein expressed in many tissues product : Ras-like without CAAX 1 protein_id : NP_033095.1

name	Syt11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328242 GeneID:229521 MGI:1859547
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : synaptotagmin 11 product : synaptotagmin XI protein_id : NP_061274.2

name	5830417I10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251297 GeneID:76022 MGI:1923272
definition	codon_start : 1 product : hypothetical protein LOC76022 protein_id : XP_001478895.1

name	Msto1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450273 CCDS:CCDS17485.1 GeneID:229524 MGI:2385175
definition	GO_function : GO:0004289 - subtilase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : misato protein_id : NP_659147.1

name	Dap3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12667808 CCDS:CCDS17486.1 GeneID:65111 MGI:1929538
definition	GO_component : GO:0005759 - mitochondrial matrix [Evidence IDA]; GO:0005761 - mitochondrial ribosome [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0015935 - small ribosomal subunit [Evidence IEA] GO_process : GO:0008637 - apoptotic mitochondrial changes [Evidence IDA] codon_start : 1 product : death-associated protein 3 protein_id : NP_075370.1

name	Ash1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73622271 CCDS:CCDS17487.1 GeneID:192195 MGI:2183158
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : chromatin remodeling factor product : absent, small, or homeotic discs 1 protein_id : NP_619620.3

name	Rusc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139947575 GeneID:72296 MGI:1919546
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : RUN and SH3 domain containing 1 isoform 2 protein_id : NP_001077276.1

name	Rusc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948764 GeneID:72296 MGI:1919546
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : RUN and SH3 domain containing 1 isoform 1 protein_id : NP_082464.2

name	Rusc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139949087 GeneID:72296 MGI:1919546
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : RUN and SH3 domain containing 1 isoform 3 protein_id : NP_001077277.1

name	Fdps (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19882207 CCDS:CCDS17488.1 GeneID:110196 MGI:104888
definition	GO_function : GO:0004161 - dimethylallyltranstransferase activity [Evidence IEA]; GO:0004337 - geranyltranstransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006695 - cholesterol biosynthesis [Evidence IEA]; GO:0008299 - isoprenoid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0016126 - sterol biosynthesis [Evidence IEA] codon_start : 1 product : farnesyl diphosphate synthetase protein_id : NP_608219.1

name	Pklr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567390 CCDS:CCDS17489.1 GeneID:18770 MGI:97604
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004743 - pyruvate kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016772 - transferase activity, transferring phosphorus-containing groups [Evidence IEA] GO_process : GO:0006096 - glycolysis [Evidence IEA]; GO:0051707 - response to other organism [Evidence IMP] citation : [PUBMED 7579416] codon_start : 1 exception : mismatches in translation product : pyruvate kinase liver and red blood cell protein_id : NP_038659.1

name	Hcn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680191 CCDS:CCDS17490.1 GeneID:15168 MGI:1298211
definition	GO_function : GO:0030552 - cAMP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : hyperpolarization-activated, cyclic nucleotide-gated K+ 4 product : hyperpolarization-activated, cyclic nucleotide-gated K+ 3 protein_id : NP_032253.1

name	Clk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671764 CCDS:CCDS17491.1 GeneID:12748 MGI:1098669
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : CDC-like kinase 2 protein_id : NP_031738.1

name	Scamp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118601011 GeneID:24045 MGI:1346346
definition	GO_component : GO:0000139 - Golgi membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : secretory carrier membrane protein 3 protein_id : NP_036016.2

name	1110013L07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67846101 CCDS:CCDS17492.1 GeneID:68521 MGI:1915771
definition	codon_start : 1 product : hypothetical protein LOC68521 protein_id : NP_001014995.1

name	Gba (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116734815 GeneID:14466 MGI:95665
definition	GO_component : GO:0005764 - lysosome [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004348 - glucosylceramidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0007040 - lysosome organization and biogenesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006665 - sphingolipid metabolism [Evidence IEA] codon_start : 1 note : acid beta glucosidase; glucocerebrosidase product : glucosidase, beta, acid protein_id : NP_001070879.1

name	Gba (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679955 CCDS:CCDS17493.1 GeneID:14466 MGI:95665
definition	GO_component : GO:0005764 - lysosome [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004348 - glucosylceramidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0007040 - lysosome organization and biogenesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006665 - sphingolipid metabolism [Evidence IEA] codon_start : 1 note : acid beta glucosidase; glucocerebrosidase product : glucosidase, beta, acid protein_id : NP_032120.1

name	Mtx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305291 CCDS:CCDS17494.1 GeneID:17827 MGI:103025
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : metaxin 1 protein_id : NP_038632.1

name	Thbs3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567414 CCDS:CCDS17495.1 GeneID:21827 MGI:98739
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation product : thrombospondin 3 protein_id : NP_038719.1

name	Muc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305293 CCDS:CCDS17496.1 GeneID:17829 MGI:97231
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 product : mucin 1, transmembrane protein_id : NP_038633.1

name	Trim46 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51492004 CCDS:CCDS17497.1 GeneID:360213 MGI:2673000
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; TRIFIC; tripartite, fibronectin type III and C-terminal SPRY motif-containing; tripartite motif-containing 46 product : tripartite motif protein 46 isoform 2 protein_id : NP_898858.1

name	Trim46 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87080829 CCDS:CCDS17498.1 GeneID:360213 MGI:2673000
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; TRIFIC; tripartite, fibronectin type III and C-terminal SPRY motif-containing; tripartite motif-containing 46 product : tripartite motif protein 46 isoform 3 protein_id : NP_001034555.1

name	Krtcap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384696 GeneID:66059 MGI:1913309
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0008250 - oligosaccharyl transferase complex [Evidence IPI] GO_function : GO:0004579 - dolichyl-diphosphooligosaccharide-protein glycotransferase activity [Evidence IC] GO_process : GO:0018279 - protein amino acid N-linked glycosylation via asparagine [Evidence IC] codon_start : 1 product : keratinocytes associated protein 2 protein_id : NP_079603.1

name	Dpm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037125 GeneID:68563 MGI:1915813
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0031501 - mannosyltransferase complex [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006506 - GPI anchor biosynthesis [Evidence ISS]; GO:0018406 - protein amino acid C-linked glycosylation via 2'-alpha-mannosyl-L-tryptophan [Evidence ISS]; GO:0035269 - protein amino acid O-linked mannosylation [Evidence ISS] codon_start : 1 product : dolichyl-phosphate mannosyltransferase polypeptide 3 protein_id : NP_081043.1

name	Rag1ap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677733 CCDS:CCDS17500.1 GeneID:19729 MGI:107417
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003674 - molecular_function [Evidence IEA] GO_process : GO:0045815 - positive regulation of gene expression, epigenetic [Evidence IMP] codon_start : 1 exception : mismatches in translation product : recombination activating gene 1 gene activation protein_id : NP_033083.1

name	Efna1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560598 CCDS:CCDS17501.1 GeneID:13636 MGI:103236
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0048013 - ephrin receptor signaling pathway [Evidence IDA]; GO:0030182 - neuron differentiation [Evidence IDA]; GO:0050770 - regulation of axonogenesis [Evidence IDA] codon_start : 1 exception : mismatches in translation product : ephrin A1 protein_id : NP_034237.2

name	Efna3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117935036 GeneID:13638 MGI:106644
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : ephrin A3 protein_id : NP_034238.1

name	Efna4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110835739 GeneID:13639 MGI:106643
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : ephrin A4 protein_id : NP_031936.2

name	Adam15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6752962 CCDS:CCDS17503.1 GeneID:11490 MGI:1333882
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; a disintegrin and metalloproteinase domain 15 (metargidin) product : a disintegrin and metalloprotease domain 15 (metargidin) isoform b protein_id : NP_033744.1

name	Adam15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109148517 CCDS:CCDS17502.1 GeneID:11490 MGI:1333882
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; a disintegrin and metalloproteinase domain 15 (metargidin) product : a disintegrin and metalloprotease domain 15 (metargidin) isoform a protein_id : NP_001032811.2

name	Dcst1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116812883 GeneID:77772 MGI:1925022
definition	codon_start : 1 product : DC-STAMP domain containing 1 protein_id : NP_084250.1

name	Dcst2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82890279 GeneID:329702 MGI:2685606
definition	codon_start : 1 product : similar to DC-STAMP domain containing 2 protein_id : XP_283860.4

name	Zbtb7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059087 CCDS:CCDS17504.1 GeneID:22724 MGI:102755
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 67; Vzinc finger and BTB domain containing 7B product : T helper-inducing POZ/Krueppel factor protein_id : NP_033591.2

name	Lenep (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048454 GeneID:57275 MGI:1930020
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] codon_start : 1 note : lens epithelial protein 503; lens epithelial cell protein product : lens epithelial protein protein_id : NP_065263.1

name	Flad1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89337262 GeneID:319945 MGI:2443030
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0006777 - Mo-molybdopterin cofactor biosynthesis [Evidence IEA] codon_start : 1 product : FAD-synthetase protein_id : NP_796015.2

name	Cks1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393135 GeneID:54124 MGI:1889208
definition	GO_function : GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA] codon_start : 1 note : cyclin-dependent kinase regulatory subunit 1 product : CDC28 protein kinase 1b protein_id : NP_058600.1

name	Shc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15778828 CCDS:CCDS17508.1 GeneID:20416 MGI:98296
definition	GO_component : GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005543 - phospholipid binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0005068 - transmembrane receptor protein tyrosine kinase adaptor protein activity [Evidence ISS] GO_process : GO:0000187 - activation of MAPK activity [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0008284 - positive regulation of cell proliferation [Evidence ISS]; GO:0045840 - positive regulation of mitosis [Evidence ISS]; GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 product : src homology 2 domain-containing transforming protein C protein_id : NP_035498.2

name	Pygo2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625705 GeneID:68911 MGI:1916161
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : pygopus 2 protein_id : NP_081145.1

name	Pbxip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122651 CCDS:CCDS17510.1 GeneID:229534 MGI:2441670
definition	codon_start : 1 product : pre-B-cell leukemia transcription factor interacting protein 1 protein_id : NP_666243.1

name	Pmvk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312068 CCDS:CCDS17511.1 GeneID:68603 MGI:1915853
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0004631 - phosphomevalonate kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006695 - cholesterol biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0016126 - sterol biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : phosphomevalonate kinase protein_id : NP_081060.1

name	Kcnn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17978284 GeneID:140493 MGI:2153183
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015269 - calcium-activated potassium channel activity [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0016286 - small conductance calcium-activated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : small conductance calcium-activated potassium channel 3 product : small conductance calcium-activated potassium channel protein 3 protein_id : NP_536714.1

name	LOC668078 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94369708 GeneID:668078
definition	codon_start : 1 product : hypothetical protein protein_id : XP_999288.1

name	Adar (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981009 CCDS:CCDS17513.1 GeneID:56417 MGI:1889575
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003726 - double-stranded RNA adenosine deaminase activity [Evidence ISS] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003692 - left-handed Z-DNA binding [Evidence TAS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016553 - base conversion or substitution editing [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; double-stranded RNA-specific adenosine deaminase; RNA-specific adenosine deaminase p150 form; RNA-specific adenosine deaminase p110 form product : adenosine deaminase, RNA-specific isoform 1 protein_id : NP_062629.2

name	Adar (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370216 CCDS:CCDS17514.1 GeneID:56417 MGI:1889575
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003726 - double-stranded RNA adenosine deaminase activity [Evidence ISS] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003692 - left-handed Z-DNA binding [Evidence TAS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016553 - base conversion or substitution editing [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 1; double-stranded RNA-specific adenosine deaminase; RNA-specific adenosine deaminase p150 form; RNA-specific adenosine deaminase p110 form product : adenosine deaminase, RNA-specific isoform 2 protein_id : NP_001033676.1

name	Chrnb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542397 CCDS:CCDS17515.1 GeneID:11444 MGI:87891
definition	GO_component : GO:0005624 - membrane fraction [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004889 - nicotinic acetylcholine-activated cation-selective channel activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007613 - memory [Evidence IMP]; GO:0007600 - sensory perception [Evidence IMP]; GO:0007271 - synaptic transmission, cholinergic [Evidence IEA] codon_start : 1 note : acetylcholine receptor beta 2 neural product : neuronal nicotinic acetylcholine receptor beta 2 protein_id : NP_033732.2

name	Ube2q1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541872 CCDS:CCDS17517.1 GeneID:70093 MGI:1917343
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : galactosyl transferase-associated protein product : ubiquitin-conjugating enzyme E2Q protein_id : NP_081591.2

name	She (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85662387 CCDS:CCDS17518.1 GeneID:214547 MGI:1099462
definition	GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Src homology 2 domain containing E protein_id : NP_766118.2

name	Il6ra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110431356 GeneID:16194 MGI:105304
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 note : IL-6 receptor alpha chain product : interleukin 6 receptor, alpha protein_id : NP_034689.2

name	Atp8b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487147 GeneID:54667 MGI:1859660
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004012 - phospholipid-translocating ATPase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : Atpase 8B2, p type product : Atpase, class I, type 8B, member 2 protein_id : NP_001074651.1

name	Hax1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754160 CCDS:CCDS17519.1 GeneID:23897 MGI:1346319
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence TAS] codon_start : 1 note : HS1 binding protein product : HCLS1 associated X-1 protein_id : NP_035956.1

name	Ubap2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943918 GeneID:74383 MGI:1921633
definition	codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : Nice-4 protein homolog isoform 2 protein_id : NP_705693.1

name	Ubap2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239421 GeneID:74383 MGI:1921633
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : Nice-4 protein homolog isoform 1 protein_id : NP_082751.1

name	4933434E20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270196 CCDS:CCDS17520.1 GeneID:99650 MGI:1914027
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC99650 isoform 1 protein_id : NP_080038.1

name	4933434E20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229108 GeneID:99650 MGI:1914027
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC99650 isoform 2 protein_id : NP_081776.1

name	1700094D03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82890281 GeneID:73545 MGI:1920795
definition	codon_start : 1 product : hypothetical protein LOC73545 protein_id : XP_898053.1

name	Tpm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254525 GeneID:59069 MGI:1890149
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 note : tropomyosin 5; skalphaTM.2 product : tropomyosin 3, gamma protein_id : NP_071709.2

name	Nup210l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251321 GeneID:77595 MGI:1924845
definition	codon_start : 1 product : nucleoporin 210-like protein_id : XP_001479513.1

name	Rps27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26024336 GeneID:57294 MGI:1888676
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : snoRNA MBI-112 product : ribosomal protein S27 protein_id : NP_081291.1

name	Rab13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311975 CCDS:CCDS17522.1 GeneID:68328 MGI:1927232
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence TAS]; GO:0019897 - extrinsic to plasma membrane [Evidence TAS]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005911 - intercellular junction [Evidence IDA]; GO:0005923 - tight junction [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAS-associated protein RAB13 protein_id : NP_080953.1

name	Jtb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46049047 CCDS:CCDS17523.1 GeneID:23922 MGI:1346082
definition	codon_start : 1 product : jumping translocation breakpoint protein_id : NP_996807.1

name	Creb3l4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313434 CCDS:CCDS17524.1 GeneID:78284 MGI:1916603
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : (attaching to CRE-like 1 product : androgen-induced basic leucine zipper protein_id : NP_084356.1

name	LOC100042397 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251265 GeneID:100042397
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478157.1

name	Slc39a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930337 CCDS:CCDS17525.1 GeneID:30791 MGI:1353474
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046873 - metal ion transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA]; GO:0005385 - zinc ion transporter activity [Evidence IDA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0030001 - metal ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006829 - zinc ion transport [Evidence IDA] codon_start : 1 exception : mismatches in translation note : Zrt/Irt-like protein 1; zinc-iron transporter-like product : solute carrier family 39 (zinc transporter), member 1 protein_id : NP_038929.1

name	Crtc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037361 GeneID:74343 MGI:1921593
definition	codon_start : 1 product : transducer of regulated cAMP response element-binding protein (CREB) 2 protein_id : NP_083157.1

name	Dennd4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119372292 GeneID:229541 MGI:2446201
definition	codon_start : 1 product : DENN/MADD domain containing 4B protein_id : NP_958809.2

name	Gatad2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314854 CCDS:CCDS17526.1 GeneID:229542 MGI:2443225
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : transcription repressor p66; transcription repressor p66 beta component of the MeCP1 complex product : transcription repressor p66 component of the MeCP1 complex protein_id : NP_647465.1

name	LOC546802 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546802
definition	number : 1 pseudo : _no_value

name	LOC546802 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546802
definition	number : 2 pseudo : _no_value

name	LOC546802 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546802
definition	number : 3 pseudo : _no_value

name	LOC668087 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668087
definition	number : 1 pseudo : _no_value

name	LOC668102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668102
definition	number : 8 pseudo : _no_value

name	LOC668102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668102
definition	number : 7 pseudo : _no_value

name	LOC668102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668102
definition	number : 6 pseudo : _no_value

name	LOC668102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668102
definition	number : 5 pseudo : _no_value

name	LOC668102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668102
definition	number : 4 pseudo : _no_value

name	LOC668102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668102
definition	number : 3 pseudo : _no_value

name	LOC668102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668102
definition	number : 2 pseudo : _no_value

name	LOC668102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668102
definition	number : 1 pseudo : _no_value

name	LOC667989 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251283 GeneID:667989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 123 ESTs, 10 Proteins product : similar to hCG2016451 pseudo : _no_value transcript_id : XR_033817.1

name	LOC628070 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251300 GeneID:628070
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to LOC506492 protein pseudo : _no_value transcript_id : XR_033961.1

clone name	MSMg01-488H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435I02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-425P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377C04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-330F07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-370P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468C01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-173F17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-439A14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-172N10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-269H10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-535P21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-176E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502N17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-301E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-538C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194B10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-497E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025C10
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-277F13.T7 (MSMg01no277_f13.b1)	MSMg01-277F13.TJ (MSMg01no277_f13.g1)
ACC	AG415274	AG415275
length	725	727
length of high quality (start - end)	237 (133 - 369)	234 (129 - 362)
definition	CHROMAT_FILE: MSMg01no277_f13.b1 PHD_FILE: MSMg01no277_f13.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:17:28 2005	CHROMAT_FILE: MSMg01no277_f13.g1 PHD_FILE: MSMg01no277_f13.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:17:28 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	TCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGG AATTCCAGGACATTCCGATCTACCCATTGAGACCGCGCCTCAAAACAGAA AAGAGATAAAAGTGAATTTTTGCCCACCTTAGCCAGCTAAGATCCTCCCG AGGCCAGGGGAGCCTCCCCCCCCCCCAGTCCTTCCCACCCTGCCTCTCAC AGCGAGGTCTCACACCCAGCACAAGCACACACACCCTTGGGCTTTATTTA CCCTCCTAAATGTTTTACATTCTCCAAACTCAAAGGTCTCTGCTTCCTCG CCTCCCTTAGCCTGTGCCTAACTAACCCCAGGCTGCCCCGAACCCCAGCT CATTTCTCTCCTTTTCTGTGAAGCCTCCCCCGCTTGCAGATTGGTTGGGG TTTTGTTTGTTTTGTACCCACCCCACCCAATTAAAAGACAGGCTTTCTCT GTGTAGCTTGGCTGGCCTTGAACTCACAGAGATTTGCCTGTCTCTGCCTT CCTAGTGCTGGAAGTGTCTTCCGAGTGCCACTCCACACCCTGCTCTGTGA AGTTTCTTTTTTCTTTTTTGAGGGGGGATGCGGAGTCTTAACTACCTCCC CATATTTTAATATCCGTGTTCTTACCCATCGATGTGTCACTCTTCTGAAA TTATCATTTTTCTCTCTTTGCCTAATCTCCTAGCCCTGTATCCTTATCGC TGATTTTATTTCTTTCTCATTCTCG	CGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXCAGGACAGTCACGGCTACACAGAA AAACCCTGTCTCAAAAAATTTTAACCCAAACAAAAAAAACCCAAGGTCAG TGTGGTAGCTCAGAGCAAATAAAGGCACTTGCCACCAAGCCTAGTGACTT GAGTTTAATCCCTGAAACTCATATAGTGGGAGGAGAGAATCTATTGTTAC AAATTGTCCTCTGGAGTGACCTCCATATAGGCACAGTGGCACTTGTGTGA CCACATACATATACTACTTAAATAAGTACATGTAAGAAAAGGAAAGAGGG CTGGAGAGATGGCTCTTTGTTAACACCACCGGCTGCTCTTCCACAGGTTC CTAGTTCAATTCCCAGCACCCACATGGCAACTCACAACTGCCTGTAATTC TAGTTCCAGGGGACCTTACACAGACATATATGCAGTTAAACCACCAATGT ACACAAGATCTAAATAAATAAAAATAAATAAATCTTAAGAAAAGAAAGAA AGAAGGAAGGAAGGAAAAAGAAAGAGAGAAAGAGAAAGAAAGAAAGAAAG AAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGATAGATAGAAAGAA AGAAAGAAAGAAAGAAAGGAGAGATGAAATGAAAACAAAAGAAAAGCCAG ACCCCCCTCTCTGCTGCTCTAATCCCA
quality values	Open. Hide. 8 10 8 9 13 12 16 28 34 34 29 28 24 22 22 32 41 32 32 28 37 37 37 47 47 31 31 31 31 28 22 22 10 8 8 8 8 10 19 27 29 29 28 21 20 30 41 53 57 36 36 36 31 44 31 31 31 28 21 15 10 9 9 10 10 13 9 9 9 9 18 19 34 34 37 37 41 41 59 53 57 57 59 59 57 57 57 57 53 53 57 57 57 53 47 47 47 42 42 57 59 59 59 53 53 47 47 33 33 50 50 42 39 39 19 15 9 10 11 16 16 18 8 8 6 7 7 13 21 24 12 15 15 24 30 37 47 59 59 57 57 57 57 53 53 59 59 59 57 59 59 59 59 59 59 68 68 51 51 51 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 24 21 11 11 11 12 18 25 28 34 37 39 48 50 50 50 57 59 59 59 53 50 53 53 57 57 59 57 57 57 57 57 57 59 59 59 59 59 59 59 59 59 59 33 19 8 8 8 8 8 15 15 21 16 13 10 10 10 10 10 10 12 12 11 12 12 19 21 30 37 50 50 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 57 57 48 48 59 59 59 59 59 59 57 48 48 48 43 39 28 28 12 12 11 10 10 10 10 10 10 12 12 11 11 11 18 16 32 32 47 47 47 47 48 48 39 39 35 35 35 39 39 48 48 57 57 57 43 59 43 47 43 59 59 59 59 57 57 57 53 50 48 41 37 37 37 37 37 41 35 31 28 30 30 37 37 47 50 50 50 48 48 48 48 48 48 48 48 48 41 41 39 39 35 37 37 35 17 14 14 19 16 16 18 33 37 39 59 48 48 48 48 48 46 28 28 13 13 12 27 19 37 28 32 32 37 32 31 20 20 32 32 48 48 48 43 33 28 24 20 20 17 16 11 14 19 23 23 23 32 37 37 32 27 29 28 28 28 32 28 25 25 15 13 8 8 8 8 11 16 10 8 8 8 8 10 10 8 8 8 8 9 10 16 11 11 12 11 9 9 9 8 8 8 8 8 8 8 10 10 10 9 9 9 8 8 8 8 8 8 13 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 8 8 8 8 10 10 10 9 8 8 8 6 10 8 8 8 8 9 15 10 10 10 13 10 12 11 8 8 8 8 9 8 8 8 8 8 10 9 12 12 10 8 8 8 8 8 9 9 8 8 6 6 8 8 8 9 9 9 8 8 8 8 8 8 8 8 15 14 13 10 8 10 8 8 8 8 9 13 8 10 9 9 10 8 8 8	Open. Hide. 10 10 9 13 12 8 8 8 8 15 20 32 37 37 41 37 37 41 37 37 37 37 37 39 50 50 53 53 57 53 48 39 39 30 32 37 37 30 42 22 29 29 48 32 43 36 43 44 44 54 68 68 54 54 54 50 50 48 57 44 34 20 14 23 23 30 17 19 19 34 24 47 50 50 50 51 50 50 50 50 68 68 68 68 68 68 68 57 57 57 57 47 47 50 47 47 47 47 47 57 53 57 57 57 57 53 57 53 53 41 41 37 37 37 27 24 12 11 11 14 14 12 11 11 9 10 9 9 9 13 27 39 47 50 59 59 50 50 50 57 57 57 57 57 53 53 53 53 53 53 53 59 53 53 53 53 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 51 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 59 57 68 68 68 68 68 59 59 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 44 44 36 32 23 23 23 34 37 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 53 50 50 50 50 42 41 34 25 18 11 8 6 6 6 6 6 7 7 15 15 11 11 11 12 9 6 6 8 6 6 8 12 12 13 26 24 36 32 50 47 48 48 48 48 59 59 59 59 59 59 59 59 57 57 57 57 57 57 59 57 57 57 57 57 53 59 50 50 50 50 41 47 28 28 12 12 11 11 9 11 11 11 11 11 12 12 13 14 19 26 34 43 41 41 48 43 43 43 43 43 43 43 43 57 57 57 57 50 42 42 28 34 34 48 59 57 54 59 59 59 57 57 54 59 59 59 57 57 57 48 48 57 48 48 50 50 50 57 57 57 57 48 43 43 43 48 48 43 43 43 43 39 43 43 54 54 50 50 57 59 59 59 48 57 48 57 59 59 59 57 57 57 57 50 48 48 48 41 41 46 41 39 39 34 24 22 34 34 41 37 37 44 44 44 44 44 37 41 44 41 31 31 28 28 31 32 32 36 31 31 31 36 36 37 41 43 37 35 28 25 31 32 35 35 36 39 39 39 39 37 41 41 37 37 37 39 35 31 36 34 34 28 28 34 30 29 29 32 29 31 31 35 31 31 37 37 37 37 41 41 37 37 41 30 26 25 27 27 27 31 16 9 9 9 9 11 20 18 32 28 27 24 19 22 9 9 9 17 7 7 7 11 9 22 25 25 25 18 19 19 24 24 37 28 24 22 24 32 31 29 25 28 25 22 18 15 21 18 25 24 32 31 39 34 25 22 25 28 34 37 33 23 15 17 15 15 19 18 23 19 20 20 19 24 24 31 21 19 11 9 9 19 15 11 11 27 30 37 39 39 35 32 28 28 23 19 19 19 18 19 15 17 14 13 13

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no277_f13.b1 MSMg01no277_f13.b1 CHROMAT_FILE:
MSMg01no277_f13.b1 PHD_FILE: MSMg01no277_f13.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 21:17:28 2005
         (237 letters)



>mm_chr3_89177695_89178332
          Length = 638

 Score =  439 bits (227), Expect = e-128
 Identities = 233/235 (99%), Gaps = 1/235 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   ccagctaagatcctcccgaggccaggggagcct-cccccccccccagtccttcccaccct 59
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 435 ccagctaagatcctcccgaggccaggggagcctccccccccccccagtccttcccaccct 376

                                                                       
Query: 60  gcctctcacagcgaggtctcacacccagcacaagcacacacacccttgggctttatttac 119
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 375 gcctctcacagcgaggtctcacacccagcacaagcacacacacccttgggctttatttac 316

                                                                       
Query: 120 cctcctaaatgttttacattctccaaactcaaaggtctctgcttcctcgcctcccttagc 179
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 315 cctcctaaatgttttacattctccaaactcaaaggtctctgcttcctcgcctcccttagc 256

                                                                  
Query: 180 ctgtgcctaactaaccccaggctgccccgaaccccagctcatttctctccttttc 234
           ||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 255 ctgtgcctaacaaaccccaggctgccccgaaccccagctcatttctctccttttc 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 11
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 237
Length of database: 638
Length adjustment: 9
Effective length of query: 228
Effective length of database: 629
Effective search space:   143412
Effective search space used:   143412
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information