MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-364O08
Chromosome	3 (Build37)
Map Location	97,254,490 - 97,254,833
singlet/doublet	singlet
Overlap gene	none
Upstream gene	BC107364, LOC668500, Hfe2, Txnip, Polr3gl, Ankrd34, 6330549D23Rik, Rbm8a, Pex11b, Itga10, Ankrd35, Pias3, Polr3c, Zfp364, Cd160, Pdzk1, Gpr89, Gja8, 9230114J08Rik, Gja5, Acp6, Bcl9, Olfr1402
Downstream gene	Chd1l, Fmo5, Prkab2, Pde4dip, Sec22b, EG433632, LOC100042975, Notch2, Adam30, LOC622561, Reg4, Hmgcs2, Phgdh, Zfp697, LOC100043461
Link	Open Mouse BAC browser

Click to get alignment info.

name	BC107364 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329716 MGI:3618860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 2 Proteins

name	LOC668500 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 4 Proteins pseudo : _no_value

name	Hfe2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69585 MGI:1916835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txnip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56338 MGI:1889549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Polr3gl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69870 MGI:1917120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545554 MGI:3617846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330549D23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229613 MGI:2442586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Rbm8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60365 MGI:1913129
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pex11b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18632 MGI:1338882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itga10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213119 MGI:2153482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213121 MGI:2442590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pias3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229615 MGI:1913126
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Polr3c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74414 MGI:1921664
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 117 ESTs, 3 Proteins

name	Zfp364 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67845 MGI:1915095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd160 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54215 MGI:1860383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdzk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59020 MGI:1928901
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr89 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67549 MGI:1914799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gja8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14616 MGI:99953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9230114J08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78080 MGI:1925330
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Gja5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14613 MGI:95716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acp6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66659 MGI:1931010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77578 MGI:1924828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1402 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258272 MGI:3031236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chd1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68058 MGI:1915308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fmo5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14263 MGI:1310004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkab2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108097 MGI:1336185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pde4dip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83679 MGI:1891434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Sec22b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20333 MGI:1338759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433632 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433632 MGI:3648209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042975 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Notch2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18129 MGI:97364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adam30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71078 MGI:1918328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622561 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Reg4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67709 MGI:1914959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hmgcs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15360 MGI:101939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phgdh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236539 MGI:1355330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp697 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242109 MGI:2139736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043461 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 63 ESTs, 20 Proteins

name	Hfe2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802426 GeneID:69585 MGI:1916835
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemochromatosis type 2 (juvenile) (human homolog) transcript_id : NM_027126.3

name	Txnip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131130 GeneID:56338 MGI:1889549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin interacting protein transcript_id : NM_001009935.2

name	Txnip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13994377 GeneID:56338 MGI:1889549
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin interacting protein transcript_id : NM_023719.1

name	Polr3gl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383501 GeneID:69870 MGI:1917120
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) III (DNA directed) polypeptide G like transcript_id : NM_027241.2

name	Ankrd34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122114647 GeneID:545554 MGI:3617846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 34 transcript_id : NM_001024851.3

name	Rbm8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385355 GeneID:60365 MGI:1913129
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 8a transcript_id : NM_025875.1

name	Pex11b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981574 GeneID:18632 MGI:1338882
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisomal biogenesis factor 11b transcript_id : NM_011069.2

name	Itga10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486691 GeneID:213119 MGI:2153482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin, alpha 10 transcript_id : NM_001081053.1

name	Ankrd35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487270 GeneID:213121 MGI:2442590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 35 transcript_id : NM_001081139.1

name	Pias3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122654 GeneID:229615 MGI:1913126
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein inhibitor of activated STAT 3 transcript_id : NM_146135.1

name	Pias3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055307 GeneID:229615 MGI:1913126
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein inhibitor of activated STAT 3 transcript_id : NM_018812.1

name	Polr3c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94369735 GeneID:74414 MGI:1921664
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 117 ESTs, 3 Proteins product : polymerase (RNA) III (DNA directed) polypeptide C, transcript variant 1 transcript_id : XM_131049.6

name	Zfp364 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980966 GeneID:67845 MGI:1915095
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 364 transcript_id : NM_026406.2

name	Cd160 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980880 GeneID:54215 MGI:1860383
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD160 antigen transcript_id : NM_018767.2

name	Pdzk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946937 GeneID:59020 MGI:1928901
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDZ domain containing 1 transcript_id : NM_021517.1

name	Gpr89 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802336 GeneID:67549 MGI:1914799
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 89 transcript_id : NM_026229.2

name	Gja8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331132 GeneID:14616 MGI:99953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein alpha 8 transcript_id : NM_008123.2

name	9230114J08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149251401 GeneID:78080 MGI:1925330
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 9230114J08 gene transcript_id : XM_001480413.1

name	Gja5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46575906 GeneID:14613 MGI:95716
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein alpha 5 transcript_id : NM_008121.2

name	Acp6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801701 GeneID:66659 MGI:1931010
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acid phosphatase 6, lysophosphatidic transcript_id : NM_019800.3

name	Bcl9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56606136 GeneID:77578 MGI:1924828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell CLL/lymphoma 9 transcript_id : NM_029933.3

name	Olfr1402 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129732 GeneID:258272 MGI:3031236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1402 transcript_id : NM_146275.1

name	Chd1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379831 GeneID:68058 MGI:1915308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromodomain helicase DNA binding protein 1-like transcript_id : NM_026539.2

name	Fmo5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46849767 GeneID:14263 MGI:1310004
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : flavin containing monooxygenase 5 transcript_id : NM_010232.3

name	Prkab2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:72384346 GeneID:108097 MGI:1336185
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, AMP-activated, beta 2 non-catalytic subunit transcript_id : NM_182997.2

name	Pde4dip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476087 GeneID:83679 MGI:1891434
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 4D interacting protein (myomegalin) transcript_id : NM_001039376.1

name	Pde4dip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476089 GeneID:83679 MGI:1891434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 4D interacting protein (myomegalin) transcript_id : NM_178080.4

name	Pde4dip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476086 GeneID:83679 MGI:1891434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 4D interacting protein (myomegalin) transcript_id : NM_177145.3

name	Sec22b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803409 GeneID:20333 MGI:1338759
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SEC22 vesicle trafficking protein homolog B (S. cerevisiae) transcript_id : NM_011342.3

name	EG433632 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801029 GeneID:433632 MGI:3648209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG433632 transcript_id : NM_001033779.2

name	Notch2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134288852 GeneID:18129 MGI:97364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Notch gene homolog 2 (Drosophila) transcript_id : NM_010928.2

name	Adam30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859703 GeneID:71078 MGI:1918328
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 30 transcript_id : NM_027665.1

name	Reg4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385823 GeneID:67709 MGI:1914959
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regenerating islet-derived family, member 4 transcript_id : NM_026328.1

name	Hmgcs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349549 GeneID:15360 MGI:101939
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 transcript_id : NM_008256.3

name	Phgdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52353954 GeneID:236539 MGI:1355330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 3-phosphoglycerate dehydrogenase transcript_id : NM_016966.3

name	Zfp697 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375486 GeneID:242109 MGI:2139736
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 697 transcript_id : NM_172863.3

name	LOC100043461 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251414 GeneID:100043461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 60 ESTs, 19 Proteins product : similar to 3-beta-hydroxysteroid dehydrogenase/delta-5-delta-4-isomerase, transcript variant 2 transcript_id : XM_001480502.1

name	LOC100043461 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251412 GeneID:100043461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 19 Proteins product : similar to 3-beta-hydroxysteroid dehydrogenase/delta-5-delta-4-isomerase, transcript variant 1 transcript_id : XM_001480498.1

name	LOC100043461 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149251416 GeneID:100043461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 ESTs, 2 Proteins product : similar to 3-beta-hydroxysteroid dehydrogenase/delta-5-delta-4-isomerase, transcript variant 3 transcript_id : XM_001480506.1

name	Hfe2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560104 GeneID:69585 MGI:1916835
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0005615 - extracellular space [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : RGM domain family, member C product : repulsive guidance molecule C protein_id : NP_081402.2

name	Txnip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60687518 GeneID:56338 MGI:1889549
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0004857 - enzyme inhibitor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006979 - response to oxidative stress [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; hyperlipidemia 1; upregulated by 1,25-dihydroxyvitamin D-3 product : thioredoxin interacting protein isoform 1 protein_id : NP_001009935.1

name	Txnip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13994378 CCDS:CCDS17640.1 GeneID:56338 MGI:1889549
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0004857 - enzyme inhibitor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006979 - response to oxidative stress [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; hyperlipidemia 1; upregulated by 1,25-dihydroxyvitamin D-3 product : thioredoxin interacting protein isoform 2 protein_id : NP_076208.1

name	Polr3gl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312458 CCDS:CCDS17641.1 GeneID:69870 MGI:1917120
definition	codon_start : 1 exception : mismatches in translation product : polymerase (RNA) III (DNA directed) polypeptide G like protein_id : NP_081517.1

name	Ankrd34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953245 GeneID:545554 MGI:3617846
definition	codon_start : 1 product : ankyrin repeat domain 34 protein_id : NP_001020022.2

name	Rbm8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385356 GeneID:60365 MGI:1913129
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003729 - mRNA binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0000184 - mRNA catabolism, nonsense-mediated decay [Evidence IEA]; GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RNA binding motif protein 8a protein_id : NP_080151.1

name	Pex11b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981575 CCDS:CCDS17643.1 GeneID:18632 MGI:1338882
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005778 - peroxisomal membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_process : GO:0016559 - peroxisome fission [Evidence IEA]; GO:0007031 - peroxisome organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : peroxisomal biogenesis factor 11b protein_id : NP_035199.2

name	Itga10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486692 GeneID:213119 MGI:2153482
definition	GO_component : GO:0008305 - integrin complex [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 note : integrin subunit alpha10 product : integrin, alpha 10 protein_id : NP_001074522.1

name	Ankrd35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487271 GeneID:213121 MGI:2442590
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : ankyrin repeat domain 35 protein_id : NP_001074608.1

name	Pias3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122655 GeneID:229615 MGI:1913126
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019789 - SUMO ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016925 - protein sumoylation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : protein inhibitor of activated STAT 3 isoform 1 protein_id : NP_666247.1

name	Pias3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055308 CCDS:CCDS17645.1 GeneID:229615 MGI:1913126
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019789 - SUMO ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016925 - protein sumoylation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : protein inhibitor of activated STAT 3 isoform 2 protein_id : NP_061282.1

name	Polr3c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20874887 GeneID:74414 MGI:1921664
definition	codon_start : 1 product : polymerase (RNA) III (DNA directed) polypeptide C isoform 1 protein_id : XP_131049.1

name	Zfp364 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980967 CCDS:CCDS17647.1 GeneID:67845 MGI:1915095
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Rabring7; Rab7-interacting RING finger protein product : Rabring 7 protein_id : NP_080682.2

name	Cd160 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980881 CCDS:CCDS17648.1 GeneID:54215 MGI:1860383
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : natural killer cell BY55 product : CD160 antigen protein_id : NP_061237.2

name	Pdzk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946938 CCDS:CCDS17649.1 GeneID:59020 MGI:1928901
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] codon_start : 1 exception : mismatches in translation product : PDZ domain containing 1 protein_id : NP_067492.1

name	Gpr89 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312914 CCDS:CCDS17650.1 GeneID:67549 MGI:1914799
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 89 protein_id : NP_080505.1

name	Gja8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680009 CCDS:CCDS17651.1 GeneID:14616 MGI:99953
definition	GO_component : GO:0005922 - connexon complex [Evidence IEA]; GO:0005921 - gap junction [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015285 - connexon channel activity [Evidence IEA]; GO:0005243 - gap-junction forming channel activity [Evidence IEA] GO_process : GO:0007154 - cell communication [Evidence IEA]; GO:0007267 - cell-cell signaling [Evidence IEA]; GO:0001747 - eye development (sensu Mammalia) [Evidence IMP] codon_start : 1 note : connexin 50; alpha 8 connexin; lens opacity 10 product : gap junction membrane channel protein alpha 8 protein_id : NP_032149.1

name	9230114J08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149251402 GeneID:78080 MGI:1925330
definition	codon_start : 1 product : hypothetical protein LOC78080 protein_id : XP_001480463.1

name	Gja5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680005 CCDS:CCDS17652.1 GeneID:14613 MGI:95716
definition	GO_component : GO:0005922 - connexon complex [Evidence IEA]; GO:0005921 - gap junction [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015285 - connexon channel activity [Evidence IEA]; GO:0005243 - gap-junction forming channel activity [Evidence IEA] GO_process : GO:0001568 - blood vessel development [Evidence IMP]; GO:0007154 - cell communication [Evidence IEA]; GO:0007267 - cell-cell signaling [Evidence IEA]; GO:0035050 - embryonic heart tube development [Evidence IMP]; GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0001501 - skeletal development [Evidence IMP] codon_start : 1 note : connexin 40; gap junction protein alpha 5 product : gap junction membrane channel protein alpha 5 protein_id : NP_032147.1

name	Acp6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66773165 CCDS:CCDS17653.1 GeneID:66659 MGI:1931010
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : acid phosphatase like 1 product : acid phosphatase 6, lysophosphatidic protein_id : NP_062774.2

name	Bcl9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56606137 CCDS:CCDS17654.1 GeneID:77578 MGI:1924828
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : B-cell lymphoma 9; nuclear co-factor of beta-catenin signalling product : B-cell CLL/lymphoma 9 protein_id : NP_084209.3

name	Olfr1402 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129733 CCDS:CCDS17655.1 GeneID:258272 MGI:3031236
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2R76Y-3201307-3200360; olfactory receptor MOR217-1 product : olfactory receptor 1402 protein_id : NP_666387.1

name	Chd1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386044 GeneID:68058 MGI:1915308
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA] codon_start : 1 product : chromodomain helicase DNA binding protein 1-like protein_id : NP_080815.1

name	Fmo5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559382 CCDS:CCDS17656.1 GeneID:14263 MGI:1310004
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0031227 - intrinsic to endoplasmic reticulum membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0004499 - dimethylaniline monooxygenase (N-oxide-forming) activity [Evidence IEA]; GO:0015036 - disulfide oxidoreductase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0050661 - NADP binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : flavin containing monooxygenase 5 protein_id : NP_034362.2

name	Prkab2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:72384347 CCDS:CCDS17657.1 GeneID:108097 MGI:1336185
definition	GO_function : GO:0004679 - AMP-activated protein kinase activity [Evidence TAS] GO_process : GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006950 - response to stress [Evidence TAS] codon_start : 1 product : AMP-activated protein kinase beta 2 non-catalytic subunit protein_id : NP_892042.2

name	Pde4dip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86476088 GeneID:83679 MGI:1891434
definition	codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1; upregulated during skeletal muscle growth 4 product : phosphodiesterase 4D interacting protein isoform 1 protein_id : NP_001034465.1

name	Pde4dip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542051 GeneID:83679 MGI:1891434
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2; upregulated during skeletal muscle growth 4 product : phosphodiesterase 4D interacting protein isoform 2 protein_id : NP_835181.2

name	Pde4dip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893115 GeneID:83679 MGI:1891434
definition	codon_start : 1 note : isoform 3 is encoded by transcript variant 3; upregulated during skeletal muscle growth 4 product : phosphodiesterase 4D interacting protein isoform 3 protein_id : NP_796119.1

name	Sec22b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755448 CCDS:CCDS17658.1 GeneID:20333 MGI:1338759
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0000139 - Golgi membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence IDA] codon_start : 1 product : SEC22 vesicle trafficking protein-like 1 protein_id : NP_035472.1

name	EG433632 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702089 GeneID:433632 MGI:3648209
definition	codon_start : 1 product : hypothetical protein LOC433632 protein_id : NP_001028951.1

name	Notch2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134288853 GeneID:18129 MGI:97364
definition	GO_component : GO:0009986 - cell surface [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003706 - ligand-regulated transcription factor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence ISS]; GO:0007050 - cell cycle arrest [Evidence ISS]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0001709 - cell fate determination [Evidence TAS]; GO:0016049 - cell growth [Evidence ISS]; GO:0007368 - determination of left/right symmetry [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030326 - embryonic limb morphogenesis [Evidence IGI]; GO:0030097 - hemopoiesis [Evidence ISS]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0002011 - morphogenesis of an epithelial sheet [Evidence IMP]; GO:0008285 - negative regulation of cell proliferation [Evidence ISS]; GO:0007399 - nervous system development [Evidence ISS]; GO:0007219 - Notch signaling pathway [Evidence IEA] [Evidence IC]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0043065 - positive regulation of apoptosis [Evidence IGI]; GO:0046579 - positive regulation of Ras protein signal transduction [Evidence ISS]; GO:0050793 - regulation of development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0042060 - wound healing [Evidence IDA] codon_start : 1 note : Motch B product : Notch gene homolog 2 protein_id : NP_035058.2

name	Adam30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859704 CCDS:CCDS17660.1 GeneID:71078 MGI:1918328
definition	GO_function : GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 product : a disintegrin and metalloproteinase domain 30 protein_id : NP_081941.1

name	Reg4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385824 CCDS:CCDS17661.1 GeneID:67709 MGI:1914959
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : regenerating islet-derived family, member 4 protein_id : NP_080604.1

name	Hmgcs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560689 CCDS:CCDS17662.1 GeneID:15360 MGI:101939
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004421 - hydroxymethylglutaryl-CoA synthase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006084 - acetyl-CoA metabolism [Evidence IEA]; GO:0006695 - cholesterol biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0016126 - sterol biosynthesis [Evidence IEA] codon_start : 1 product : 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 protein_id : NP_032282.2

name	Phgdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52353955 CCDS:CCDS17663.1 GeneID:236539 MGI:1355330
definition	GO_function : GO:0051287 - NAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016616 - oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor [Evidence IEA]; GO:0004617 - phosphoglycerate dehydrogenase activity [Evidence TAS] GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA]; GO:0006564 - L-serine biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : 3-phosphoglycerate dehyrogenase product : 3-phosphoglycerate dehydrogenase protein_id : NP_058662.2

name	Zfp697 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62461606 GeneID:242109 MGI:2139736
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 697 protein_id : NP_766451.2

name	LOC100043461 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251417 GeneID:100043461
definition	codon_start : 1 product : similar to 3-beta-hydroxysteroid dehydrogenase/delta-5-delta-4-isomerase isoform 3 protein_id : XP_001480556.1

name	LOC100043461 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251413 GeneID:100043461
definition	codon_start : 1 product : similar to 3-beta-hydroxysteroid dehydrogenase/delta-5-delta-4-isomerase isoform 1 protein_id : XP_001480548.1

name	LOC100043461 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149251415 GeneID:100043461
definition	codon_start : 1 product : similar to 3-beta-hydroxysteroid dehydrogenase/delta-5-delta-4-isomerase isoform 2 protein_id : XP_001480552.1

name	LOC100042975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042975
definition	number : 1 pseudo : _no_value

name	LOC100042975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042975
definition	number : 2 pseudo : _no_value

name	LOC100042975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042975
definition	number : 3 pseudo : _no_value

name	LOC100042975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042975
definition	number : 4 pseudo : _no_value

name	LOC622561 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622561
definition	number : 1 pseudo : _no_value

name	BC107364 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149251395 GeneID:329716 MGI:3618860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : cDNA sequence BC107364 transcript_id : XR_035445.1

name	LOC668500 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149251326 GeneID:668500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 4 Proteins product : similar to CCR4-NOT transcription complex, subunit 3 pseudo : _no_value transcript_id : XR_034066.1

name	6330549D23Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149251132 GeneID:229613 MGI:2442586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330549D23 gene pseudo : _no_value transcript_id : XR_035121.1

clone name	MSMg01-468L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098D05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-379H13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-483P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-475M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278O20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-392C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-208M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057E21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-470H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372P09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-427A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048K11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-048J11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-350P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201H16
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-364O08.T7 (MSMg01no364_o08.b1)	MSMg01-364O08.TJ (MSMg01no364_o08.g1)
ACC	AG472982	AG472983
length	1,415	777
length of high quality (start - end)	---	345 (84 - 428)
definition	CHROMAT_FILE: MSMg01no364_o08.b1 PHD_FILE: MSMg01no364_o08.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:01:11 2005	CHROMAT_FILE: MSMg01no364_o08.g1 PHD_FILE: MSMg01no364_o08.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:01:11 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	TTTTATATTATTTTTCTATAAGATGATCANGTGTAATGATTTCGTCGCGT CGTTTTCTCTTATGAGTTGCCCACGTAGGTAGGCTCAGTCGCTGCCGTGG ACTTATGATTTNATATACTACACCACACGCCAGTTAACACGTATCATATC GTCGCTGTATGTACCTTAGCAGTGTGGCGCCTATCTGCGTNCATATACTC TTATTGATGCATCTAGAACATCAGCACCAGCGAATGTACACTGGAGAATC CTAAATATTGTATGTTAAGTTAACTATAGACAGAGAGAAGCGGTGTTGGT GAATGGGNGACTGNCACGAATTGTAATGCACACTAGATATGCTACTCTTA TAAGTATCGAGCTATACTATAATAGATCACAGATGAATCGCACTACATCT ACACTCTATAGCTAGACGGATCTATATTCTATCATCATAATTAATCCCGG ATATTTCATCAGCAACGCTAGACCTTCTACATATCCTGATAGTTGTATCT GTGATGTTACTAAGCGATATAGACTGTTGTCTGTATAANTGGTATGCGCA CTCATGTGCTGTCGTAGCGCCAAGACTAATATCTTCTTGTCATTGCGCTA GGTCGCGTCTGTCAATGATATCGCGTCTGATATACATAGTTCAGACAAAT ATACCACCGACGTCAATATAGAGTCTTCATACTGATACTATGTCATCTCC ACTACTATTAACATATCTAATGTTCCTTGAATTGTCTCAGTTTATTGACG TCTCACTATATTCACTATACATGCTAAATACAACGGTAATAGTCAGCTGA ACATGTAACGCACGCGCGTCACGAAGCGGCCCTATGCGATATATTATTAC TACCGCGCCGCTTGTGTCTACCGTGGATCATAGAAGCTCTCACAGCAGCC ACAACTGATGCTCACGGAATGAGTTATTTAGTATTGACGTATGTTAACAG TTGCAGTGTTATTCCATGCATCCCGTGTCGCTGNCTCACATGCCGTTGTC GACGGTTCGTTACTGTTACCTCGCTGCATCACACCTATATCGCTTACTTA TCCCATACTACTTCTATGTACCCACTACTGCCACTACTATGTGCGTTACA TCTACGGCCACGATTATGTTTGATTCCTAATGCGCGGTGCGTCATTATCT CTTACGACCGATCACCACTTAATAGTTACATATAGTCTTCGTTCTTATCT TGGTCCTCACCATACTATACGTTTTCCTATTGACATTATTATACATATTC TATACTTTCTATAATTCCGCCTTATTGACTAGTTATCACTACTCTATATA CGTTGCTTATTACTCTTTGTCTTCTTAGTCACTCGCAATGTATCGCGTCA GTATGTCATNATATGTAAGTAGCATTGTATATATCAACTTATCTCTAGTG AACTGATGAGAATGN	AATTATTTCGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTCTCTAATTATTGGTGA ATAAATAATCAAGGATAGTACAGTCTATAATAAGTCATTAACTACTAAAA TTGTGAGCAAAAGTAATATGGACTGGGCAAGGATGGGGATTGGTATTAGA CCAATTTAAAAAAAAATCAAGATGAGAAAATTACCCAAGAAGAGATAGTT GGGAGACTGTTATGGATCAGAGAGTTTATTATTAAAGGTTATTAAACTTT GTTGAGGTCATAGTTAAGAAATAAAAACAATAGGGATATGAGGGAAAAGA GATAGAATGAGAATTTTTGCCTGAATGATCTAGCTATTGATGGGAATATT GACATCACCCATTATTACTGTATCTTAACCACACTTTGTTTTCCTATAGT TTTCATTTCATGAATCTACATGTACTCATGTCCAGTGCATATATTTTATC TATTCTTGGAGCACTTTTTGTTCGAAGAACTGTAATGACCTTCTTTAGCT CCTTCTGTAATATTTTTTCGTTGATCTTTTGTCTTTCCCCTGATTACTTA TCATCTCACCCTACCCCCTTTTCTACCTTATAGGTATCCATTCAGTGTTC ACCCGTCCTTCGTTATATTATATTTTACTACTTCATCTTTTTTTCTACTT TTCACCTTTACCTAATCATTTGTGTTTTTTTTTTATATTAAAAACGCATT CCTATTTATTACCTTTGATTAATAGTN
quality values	Open. Hide. 19 19 19 10 6 6 6 6 6 6 8 7 10 10 8 8 8 8 8 8 8 8 10 8 8 8 8 7 3 0 3 10 10 10 10 10 11 12 12 12 12 6 8 6 6 8 6 8 8 8 10 10 12 8 8 8 8 8 6 9 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 9 9 8 8 8 8 8 8 10 10 12 10 8 8 8 8 3 0 3 8 8 8 8 8 9 8 8 8 8 8 8 9 11 10 10 8 8 8 8 8 8 8 6 6 6 8 7 7 10 8 8 9 9 12 10 10 10 9 9 9 8 8 8 6 6 8 8 8 6 6 10 12 9 8 10 8 9 9 8 8 8 8 6 6 6 6 8 8 8 8 8 6 6 6 8 3 0 3 9 9 10 10 7 6 10 6 8 8 8 15 8 8 6 6 6 6 6 6 10 10 8 6 6 8 8 8 6 6 6 6 6 6 6 6 6 8 8 8 8 8 10 8 10 9 10 10 9 9 8 8 8 6 7 7 9 9 9 12 12 14 13 10 10 10 10 10 11 18 14 20 24 22 14 10 9 8 8 8 11 8 8 9 6 6 6 6 8 8 8 8 8 8 10 9 9 10 10 10 10 10 10 10 8 6 6 6 6 8 6 6 6 6 3 0 3 6 8 8 3 0 3 7 9 10 9 9 9 10 9 15 11 10 10 10 10 9 10 10 8 8 8 8 8 8 8 8 8 6 6 6 6 8 8 8 7 7 6 6 8 6 6 8 6 8 6 6 8 10 10 10 10 10 12 11 10 9 9 9 9 12 18 10 6 6 6 6 6 8 8 8 6 6 6 6 6 6 6 8 9 9 6 6 6 6 6 6 7 7 9 9 9 8 8 8 8 8 8 8 8 6 8 6 6 8 6 7 7 10 8 8 8 8 8 10 13 8 8 10 10 10 8 9 8 10 8 6 6 6 6 12 12 7 6 6 6 10 10 10 12 9 9 9 10 8 8 8 8 8 8 8 8 8 8 9 9 9 9 9 9 9 6 6 6 6 8 6 6 8 8 12 12 8 6 6 6 6 6 8 6 6 6 6 6 8 8 8 8 9 9 9 9 9 8 9 8 12 8 10 10 10 10 8 8 8 6 6 8 6 6 7 8 8 8 10 11 10 10 10 6 8 7 6 6 3 0 3 6 8 8 10 10 6 6 6 6 8 8 8 8 6 6 6 6 8 8 8 8 9 8 8 8 8 8 8 8 8 8 8 8 8 8 9 9 9 9 9 9 10 10 11 8 6 6 6 6 6 10 8 8 8 8 8 6 8 6 6 8 10 10 10 10 8 8 8 8 8 8 8 8 8 6 6 6 8 8 8 8 10 8 8 10 8 6 8 6 6 8 6 7 8 6 9 9 12 12 16 11 10 10 8 10 8 8 8 10 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 8 8 6 6 8 6 6 6 8 6 8 8 9 12 8 8 8 8 8 8 8 9 9 10 9 9 10 10 8 8 8 8 6 6 6 6 8 10 10 8 8 8 8 8 8 8 8 8 8 8 10 8 8 8 8 6 6 8 8 8 8 8 6 6 6 7 10 12 12 10 10 8 8 8 8 10 10 10 12 10 10 8 6 6 6 8 8 8 8 10 9 9 8 8 8 8 9 9 8 9 8 8 8 8 8 8 8 8 7 7 10 6 6 8 8 8 8 6 6 6 6 6 6 6 6 6 6 8 8 8 8 8 10 9 9 10 10 13 11 13 11 9 9 9 9 8 7 6 8 8 8 8 10 8 8 9 8 8 8 8 8 8 10 8 8 10 10 10 10 12 10 10 10 8 6 7 6 6 8 8 8 8 8 8 10 7 6 8 8 9 7 7 7 7 10 10 8 8 8 6 6 8 6 9 12 10 10 8 8 6 6 6 8 8 10 10 10 8 8 8 8 8 8 9 9 9 10 10 9 6 6 6 6 8 6 8 8 8 8 8 8 8 8 9 9 8 6 6 6 7 8 8 9 9 9 9 10 9 16 8 8 8 8 6 6 8 8 8 8 6 6 8 8 8 7 8 8 8 8 11 10 8 8 8 8 8 8 6 6 8 6 8 6 8 6 6 8 8 8 8 8 8 9 8 8 8 8 8 8 8 8 8 7 6 8 8 3 0 3 8 6 7 10 12 11 8 8 8 8 8 8 8 10 9 9 9 9 9 9 7 7 8 11 8 8 9 9 9 9 9 9 10 8 8 8 8 8 8 8 8 8 8 6 6 6 6 6 6 6 6 6 6 8 6 6 6 6 8 6 6 8 6 7 7 10 8 8 8 8 8 8 8 8 8 10 10 8 8 10 11 10 8 8 6 6 8 6 6 6 6 8 8 8 8 8 8 10 10 10 10 8 8 8 10 10 8 6 6 6 8 8 8 8 8 8 8 8 8 10 8 8 8 11 8 8 8 8 8 8 8 8 8 8 8 7 6 6 6 8 8 8 6 6 8 8 9 8 8 7 9 11 8 8 8 7 7 7 9 10 9 12 12 12 12 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 7 8 8 8 8 6 6 8 6 9 10 10 12 12 12 10 8 8 8 8 11 16 11 11 11 13 17 13 10 8 8 8 8 12 8 8 8 8 6 6 8 8 8 7 7 10 8 9 9 9 12 8 7 6 6 6 8 13 9 9 8 8 8 6 6 6 6 6 6 8 7 10 9 9 6 6 6 6 8 8 8 8 8 8 13 8 6 6 6 7 6 10 9 10 7 6 6 6 6 8 8 8 8 10 8 9 8 8 8 6 6 6 8 8 8 8 8 8 18 19 19 10 8 6 6 6 6 8 10 8 8 9 8 8 8 8 8 8 8 8 8 8 8 8 11 11 11 11 10 10 8 8 6 7 8 6 8 8 11 10 9 10 10 10 9 8 8 8 8 8 8 8 8 8 10 8 8 8 9 9 9 9 10 8 8 8 8 8 8 8 6 3 0 3 8 8 8 8 8 8 9 12 9 8 8 8 8 8 8 8 6 6 11 8 9 13 10 8 8 8 8 8 8 10 10 8 10 9 9 8 12 9 11 17 9 9 10 10 8 6 6 6 6 8 9 9 3 0	Open. Hide. 11 11 11 11 9 9 8 6 6 6 8 8 10 11 9 8 7 7 9 9 15 15 29 29 30 30 37 39 39 39 39 37 31 32 37 32 16 23 9 6 6 6 6 7 13 17 9 12 12 30 26 37 30 32 37 39 47 47 39 37 48 41 59 59 36 33 16 16 6 6 6 6 10 10 19 23 32 29 31 31 33 36 36 57 57 50 50 53 50 50 50 53 53 53 53 50 57 57 48 48 48 54 54 54 54 54 47 43 43 43 50 50 68 68 68 68 68 68 54 54 54 54 57 57 54 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 59 59 54 57 57 68 68 50 50 51 50 50 68 68 59 59 57 57 57 50 50 50 50 50 50 68 68 68 68 68 68 68 68 57 57 50 50 50 50 50 50 50 50 50 50 50 50 57 57 57 57 57 57 57 59 59 59 57 57 57 57 57 57 59 59 59 59 59 59 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 57 57 57 57 57 57 57 57 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 59 68 68 57 57 57 57 57 59 59 59 59 59 59 57 57 59 59 59 59 59 59 59 59 59 59 59 57 59 59 59 57 57 59 59 59 59 57 57 57 59 57 54 54 59 52 59 43 50 35 43 43 57 52 52 43 43 38 24 18 12 12 12 15 11 12 15 38 38 57 57 57 57 47 47 43 50 47 48 48 48 48 48 57 48 47 47 57 57 57 57 57 48 57 57 57 57 59 59 43 43 43 47 43 37 37 44 43 47 48 43 44 46 46 37 43 46 57 57 57 59 48 46 43 41 39 43 48 54 54 48 43 43 43 43 39 39 39 43 43 43 43 43 43 43 43 36 36 39 43 39 39 47 37 25 21 12 11 11 10 10 8 7 7 7 13 14 34 25 34 34 46 48 46 46 43 43 43 34 34 34 26 26 16 20 20 32 28 42 32 32 32 39 42 48 46 43 30 29 17 17 17 30 19 23 22 22 13 18 13 18 15 29 17 17 10 11 11 19 19 28 31 32 32 37 37 37 37 28 28 29 33 28 24 24 24 23 13 15 11 11 10 16 9 9 12 17 17 20 16 10 10 10 9 8 8 6 6 6 6 8 8 8 8 8 6 6 10 12 14 14 10 9 9 9 8 10 8 8 8 15 12 12 12 12 16 12 10 9 8 10 10 12 12 14 14 14 10 10 10 10 9 10 8 8 8 8 8 10 10 15 11 10 10 10 11 15 15 11 17 16 13 10 10 8 8 8 8 8 8 8 8 8 8 8 8 9 9 10 10 10 8 11 7 6 6 6 8 8 8 14 13 13 11 11 11 11 13 10 8 8 8 8 8 8 9 9 8 8 6 6 6 6 8 8 8 8 6 6 8 6 8 8 8 8 8 8 8 10 10 8 8 6 6 8 8 10 13 13 11 8 8 8 8 8 8 9 8 8 7 6 8 8 8 9 9 9 9 10 11 11 13 10 10 10 10 8 8 8 10 10 10 10 8 8 8 8 8 8 6 7 10 10 8 8 8 8 10 8 8 8 10 8 8 8 8 8 8 8 8 8 11 12 9 9 10 9 7 7 7 6 8 8 8 10 10 8 8 8 8 8 8 6 6 6 6 10 7 7 8 8 9 9 9 8 8 8 8 8 8 10 9 9 9 9 9 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no364_o08.g1 MSMg01no364_o08.g1 CHROMAT_FILE:
MSMg01no364_o08.g1 PHD_FILE: MSMg01no364_o08.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 23:01:11 2005
         (345 letters)



>mm_chr3_97254290_97255033
          Length = 744

 Score =  644 bits (333), Expect = 0.0
 Identities = 342/345 (99%), Gaps = 1/345 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   tctctaattattggtgaataaataatcaaggatagtacagtctataataagtcattaact 60
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 tctctaattattgatgaataaataatcaaggatagtacagtctataataagtcattaact 260

                                                                       
Query: 61  actaaaattgtgagcaaaagtaatatggactgggcaaggatggggattggtattagacca 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 actaaaattgtgagcaaaagtaatatggactgggcaaggatggggattggtattagacca 320

                                                                       
Query: 121 atttaaaaaaaaatcaagatgagaaaattacccaagaagagatagttgggagactgttat 180
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 attt-aaaaaaaatcaagatgagaaaattacccaagaagagatagttgggagactgttat 379

                                                                       
Query: 181 ggatcagagagtttattattaaaggttattaaactttgttgaggtcatagttaagaaata 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 380 ggatcagagagtttattattaaaggttattaaactttgttgaggtcatagttaagaaata 439

                                                                       
Query: 241 aaaacaatagggatatgagggaaaagagatagaatgagaatttttgcctgaatgatctag 300
           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 440 aaaacaaaagggatatgagggaaaagagatagaatgagaatttttgcctgaatgatctag 499

                                                        
Query: 301 ctattgatgggaatattgacatcacccattattactgtatcttaa 345
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 500 ctattgatgggaatattgacatcacccattattactgtatcttaa 544


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 15
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 345
Length of database: 744
Length adjustment: 9
Effective length of query: 336
Effective length of database: 735
Effective search space:   246960
Effective search space used:   246960
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information