MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-051C16
Chromosome	4 (Build37)
Map Location	61,965,873 - 61,966,553
singlet/doublet	singlet
Overlap gene	Fkbp15
Upstream gene	LOC667242, LOC100039150, LOC100039019, LOC100039177, LOC621093, LOC100039206, LOC621127, LOC100039228, LOC384021, LOC100039247, LOC667278, Mup5, LOC435785, LOC667295, LOC100039305, LOC546832, OTTMUSG00000007485, Mup3, LOC100039345, OTTMUSG00000000231, Zfp37, Slc31a2
Downstream gene	Slc31a1, Cdc26, Prpf4, Rnf183, Wdr31, Bspry, Hdhd3, Alad, Pole3, 4933430I17Rik, Rgs3, Zfp618, Ambp, Kif12, Col27a1
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC667242 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins pseudo : _no_value

name	LOC100039150 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 586 ESTs, 1 Protein

name	LOC100039019 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 21 Proteins pseudo : _no_value

name	LOC100039177 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 564 ESTs, 1 Protein

name	LOC621093 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 24 Proteins pseudo : _no_value

name	LOC100039206 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039206
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 556 ESTs, 1 Protein

name	LOC621127 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins pseudo : _no_value

name	LOC100039228 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 568 ESTs, 1 Protein

name	LOC384021 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384021
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins pseudo : _no_value

name	LOC100039247 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039247
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 596 ESTs, 1 Protein

name	LOC667278 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	Mup5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17844 MGI:104974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435785 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC667295 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100039305 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 62 ESTs, 31 Proteins

name	LOC546832 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546832
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins

name	OTTMUSG00000007485 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381530 MGI:3651981
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mup3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17842 MGI:97235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039345 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039345
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	OTTMUSG00000000231 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381531 MGI:3650630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22696 MGI:99181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc31a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20530 MGI:1333844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fkbp15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338355 MGI:2444782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 106 ESTs, 1 Protein

name	Slc31a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20529 MGI:1333843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66440 MGI:1913690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prpf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70052 MGI:1917302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf183 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76072 MGI:1923322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71354 MGI:1918604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bspry (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192120 MGI:2177191
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdhd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72748 MGI:1919998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alad (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17025 MGI:96853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pole3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59001 MGI:1933378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933430I17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214106 MGI:3045314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rgs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50780 MGI:1354734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Zfp618 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72701 MGI:1919950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 54 ESTs, 4 Proteins

name	Ambp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11699 MGI:88002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16552 MGI:1098232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col27a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:373864 MGI:2672118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039150 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252551 GeneID:100039150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 586 ESTs, 1 Protein product : similar to major urinary protein 1 transcript_id : XM_001472263.1

name	LOC100039177 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252553 GeneID:100039177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 564 ESTs, 1 Protein product : similar to major urinary protein 1 transcript_id : XM_001472299.1

name	LOC100039206 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252556 GeneID:100039206
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 556 ESTs, 1 Protein product : similar to major urinary protein 1 transcript_id : XM_001472354.1

name	LOC100039228 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252558 GeneID:100039228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 568 ESTs, 1 Protein product : similar to major urinary protein 1 transcript_id : XM_001472374.1

name	LOC100039247 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252561 GeneID:100039247
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 596 ESTs, 1 Protein product : similar to major urinary protein 1 transcript_id : XM_001472422.1

name	Mup5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930707 GeneID:17844 MGI:104974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : major urinary protein 5 transcript_id : NM_008649.2

name	LOC100039305 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252565 GeneID:100039305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 62 ESTs, 31 Proteins product : similar to Predicted gene, OTTMUSG00000007485 transcript_id : XM_001472470.1

name	LOC546832 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252544 GeneID:546832
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins product : similar to Predicted gene, OTTMUSG00000007485 transcript_id : XM_621624.4

name	OTTMUSG00000007485 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59858560 GeneID:381530 MGI:3651981
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000007485 transcript_id : NM_001012323.1

name	Mup3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88196795 GeneID:17842 MGI:97235
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : major urinary protein 3 transcript_id : NM_001039544.1

name	LOC100039345 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252567 GeneID:100039345
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : hypothetical protein LOC100039345 transcript_id : XM_001472530.1

name	OTTMUSG00000000231 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222277 GeneID:381531 MGI:3650630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000231 transcript_id : NM_001009550.1

name	Zfp37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123701553 GeneID:22696 MGI:99181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 37 transcript_id : NM_009554.3

name	Slc31a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130373 GeneID:20530 MGI:1333844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 31, member 2 transcript_id : NM_025286.2

name	Fkbp15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252549 GeneID:338355 MGI:2444782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 106 ESTs, 1 Protein product : FK506 binding protein 15 transcript_id : XM_485391.5

name	Slc31a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388333 GeneID:20529 MGI:1333843
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 31, member 1 transcript_id : NM_175090.3

name	Cdc26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363144 GeneID:66440 MGI:1913690
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 26 transcript_id : NM_139291.3

name	Prpf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872208 GeneID:70052 MGI:1917302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PRP4 pre-mRNA processing factor 4 homolog (yeast) transcript_id : NM_027297.3

name	Rnf183 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801750 GeneID:76072 MGI:1923322
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 183 transcript_id : NM_153504.3

name	Wdr31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963744 GeneID:71354 MGI:1918604
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 31 transcript_id : NM_023597.1

name	Bspry (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149729 GeneID:192120 MGI:2177191
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-box and SPRY domain containing transcript_id : NM_138653.1

name	Hdhd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312203 GeneID:72748 MGI:1919998
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : haloacid dehalogenase-like hydrolase domain containing 3 transcript_id : NM_024257.1

name	Alad (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328484 GeneID:17025 MGI:96853
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aminolevulinate, delta-, dehydratase transcript_id : NM_008525.3

name	Pole3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981173 GeneID:59001 MGI:1933378
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), epsilon 3 (p17 subunit) transcript_id : NM_021498.2

name	4933430I17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366749 GeneID:214106 MGI:3045314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933430I17 gene transcript_id : NM_177607.3

name	Rgs3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126032316 GeneID:50780 MGI:1354734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of G-protein signaling 3 transcript_id : NM_019492.2

name	Rgs3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126032320 GeneID:50780 MGI:1354734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of G-protein signaling 3 transcript_id : NM_134257.2

name	Rgs3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126032300 GeneID:50780 MGI:1354734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of G-protein signaling 3 transcript_id : NM_001081650.1

name	Zfp618 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252570 GeneID:72701 MGI:1919950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 54 ESTs, 4 Proteins product : zinc fingerprotein 618 transcript_id : XM_001473196.1

name	Ambp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385932 GeneID:11699 MGI:88002
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alpha 1 microglobulin/bikunin transcript_id : NM_007443.2

name	Kif12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802873 GeneID:16552 MGI:1098232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 12 transcript_id : NM_010616.2

name	Col27a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116063545 GeneID:373864 MGI:2672118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type XXVII, alpha 1 transcript_id : NM_025685.3

name	LOC100039150 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252552 GeneID:100039150
definition	codon_start : 1 product : similar to major urinary protein 1 protein_id : XP_001472313.1

name	LOC100039177 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252554 GeneID:100039177
definition	codon_start : 1 product : similar to major urinary protein 1 protein_id : XP_001472349.1

name	LOC100039206 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252557 GeneID:100039206
definition	codon_start : 1 product : similar to major urinary protein 1 protein_id : XP_001472404.1

name	LOC100039228 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252559 GeneID:100039228
definition	codon_start : 1 product : similar to major urinary protein 1 protein_id : XP_001472424.1

name	LOC100039247 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252562 GeneID:100039247
definition	codon_start : 1 product : similar to major urinary protein 1 protein_id : XP_001472472.1

name	Mup5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930708 CCDS:CCDS18232.1 GeneID:17844 MGI:104974
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005550 - pheromone binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : Mup V; novel major urinary protein (Mup) product : major urinary protein 5 protein_id : NP_032675.2

name	LOC100039305 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252566 GeneID:100039305
definition	codon_start : 1 product : similar to Predicted gene, OTTMUSG00000007485 protein_id : XP_001472520.1

name	LOC546832 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252545 GeneID:546832
definition	codon_start : 1 product : similar to Predicted gene, OTTMUSG00000007485 protein_id : XP_621624.4

name	OTTMUSG00000007485 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59858561 CCDS:CCDS18233.1 GeneID:381530 MGI:3651981
definition	codon_start : 1 note : novel member of the major urinary protein (Mup) gene family product : hypothetical protein LOC381530 protein_id : NP_001012323.1

name	Mup3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88196796 CCDS:CCDS18234.1 GeneID:17842 MGI:97235
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : alpha-2u-globulin III; novel member of the major urinary protein (Mup) gene family product : major urinary protein 3 protein_id : NP_001034633.1

name	LOC100039345 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252568 GeneID:100039345
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472580.1

name	OTTMUSG00000000231 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222278 CCDS:CCDS18235.1 GeneID:381531 MGI:3650630
definition	codon_start : 1 note : bM64F17.3 (putative novel protein) product : major urinary protein protein_id : NP_001009550.1

name	Zfp37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123701554 GeneID:22696 MGI:99181
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence TAS] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007281 - germ cell development [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 37 homolog product : zinc finger protein 37 protein_id : NP_033580.3

name	Slc31a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384632 CCDS:CCDS18236.1 GeneID:20530 MGI:1333844
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0005507 - copper ion binding [Evidence IEA]; GO:0005375 - copper ion transporter activity [Evidence IEA] GO_process : GO:0006825 - copper ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 31 (copper transporters), member 2 product : solute carrier family 31, member 2 protein_id : NP_079562.1

name	Fkbp15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252550 GeneID:338355 MGI:2444782
definition	codon_start : 1 product : FK506 binding protein 15 protein_id : XP_485391.4

name	Slc31a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28201980 CCDS:CCDS18237.1 GeneID:20529 MGI:1333843
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0005375 - copper ion transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : solute carrier family 31, member 1 protein_id : NP_780299.1

name	Cdc26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314828 GeneID:66440 MGI:1913690
definition	GO_component : GO:0005680 - anaphase-promoting complex [Evidence ISS] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0051301 - cell division [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : CDC26 subunit of anaphase promoting complex product : cell division cycle 26 protein_id : NP_647452.1

name	Prpf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55925589 CCDS:CCDS18239.1 GeneID:70052 MGI:1917302
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA]; GO:0046540 - U4/U6 x U5 tri-snRNP complex [Evidence ISS] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] [Evidence ISS]; GO:0008380 - RNA splicing [Evidence IEA] codon_start : 1 product : PRP4 pre-mRNA processing factor 4 homolog protein_id : NP_081573.1

name	Rnf183 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943803 GeneID:76072 MGI:1923322
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 183 protein_id : NP_705724.1

name	Wdr31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963745 CCDS:CCDS18240.1 GeneID:71354 MGI:1918604
definition	codon_start : 1 product : spermatid WD-repeat protein protein_id : NP_076086.1

name	Bspry (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149730 CCDS:CCDS18241.1 GeneID:192120 MGI:2177191
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005499 - vitamin D binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 function : unknown note : zetin 1 product : B-box and SPRY domain containing protein_id : NP_619594.1

name	Hdhd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312204 CCDS:CCDS18242.1 GeneID:72748 MGI:1919998
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008967 - phosphoglycolate phosphatase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : haloacid dehalogenase-like hydrolase domain containing 3 protein_id : NP_077219.1

name	Alad (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328485 CCDS:CCDS18243.1 GeneID:17025 MGI:96853
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0042802 - identical protein binding [Evidence IPI]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004655 - porphobilinogen synthase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006783 - heme biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006779 - porphyrin biosynthesis [Evidence IEA] codon_start : 1 note : delta-aminolevulinate dehydratase product : aminolevulinate, delta-, dehydratase protein_id : NP_032551.3

name	Pole3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981174 CCDS:CCDS18244.1 GeneID:59001 MGI:1933378
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : NF-YB-like protein; DNA polymerase epsilon, subunit 3 product : DNA polymerase epsilon subunit 3 protein_id : NP_067473.2

name	4933430I17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243978 CCDS:CCDS18245.1 GeneID:214106 MGI:3045314
definition	codon_start : 1 note : bN189G18.7 (novel protein (4933430I17Rik)) product : hypothetical protein LOC214106 protein_id : NP_808275.1

name	Rgs3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126032317 CCDS:CCDS18246.1 GeneID:50780 MGI:1354734
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0009968 - negative regulation of signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; C2 membrane binding, PDZ protein/protein interaction, ATP/GTP binding domains product : regulator of G-protein signaling 3 isoform 1 protein_id : NP_062365.2

name	Rgs3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126032321 GeneID:50780 MGI:1354734
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0009968 - negative regulation of signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; C2 membrane binding, PDZ protein/protein interaction, ATP/GTP binding domains product : regulator of G-protein signaling 3 isoform 2 protein_id : NP_599018.2

name	Rgs3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126032301 GeneID:50780 MGI:1354734
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0009968 - negative regulation of signal transduction [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; C2 membrane binding, PDZ protein/protein interaction, ATP/GTP binding domains product : regulator of G-protein signaling 3 isoform 3 protein_id : NP_001075119.1

name	Zfp618 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252571 GeneID:72701 MGI:1919950
definition	codon_start : 1 product : zinc finger protein 618 protein_id : XP_001473246.1

name	Ambp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680684 CCDS:CCDS18248.1 GeneID:11699 MGI:88002
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0019855 - calcium channel inhibitor activity [Evidence ISS]; GO:0046904 - calcium oxalate binding [Evidence ISS]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0020037 - heme binding [Evidence ISS]; GO:0019862 - IgA binding [Evidence ISS]; GO:0030568 - plasmin inhibitor activity [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA]; GO:0030304 - trypsin inhibitor activity [Evidence ISS] GO_process : GO:0030236 - anti-inflammatory response [Evidence ISS]; GO:0007155 - cell adhesion [Evidence ISS]; GO:0042167 - heme catabolism [Evidence ISS]; GO:0050777 - negative regulation of immune response [Evidence ISS]; GO:0046329 - negative regulation of JNK cascade [Evidence ISS]; GO:0007565 - pregnancy [Evidence ISS]; GO:0018298 - protein-chromophore linkage [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ulinastatin; Urinary Trypsin Inhibitor; polyprotein product : alpha 1 microglobulin/bikunin protein_id : NP_031469.1

name	Kif12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563262 CCDS:CCDS18249.1 GeneID:16552 MGI:1098232
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 note : kinesin 12; N-9 kinesin product : kinesin family member 12 protein_id : NP_034746.1

name	Col27a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116063546 CCDS:CCDS18250.1 GeneID:373864 MGI:2672118
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : procollagen, type XXVII, alpha 1 protein_id : NP_079961.3

name	LOC667278 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667278
definition	number : 1 pseudo : _no_value

name	LOC667278 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667278
definition	number : 2 pseudo : _no_value

name	LOC667278 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667278
definition	number : 3 pseudo : _no_value

name	LOC667278 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667278
definition	number : 4 pseudo : _no_value

name	LOC667278 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667278
definition	number : 5 pseudo : _no_value

name	LOC667278 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667278
definition	number : 6 pseudo : _no_value

name	LOC435785 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435785
definition	number : 4 pseudo : _no_value

name	LOC435785 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435785
definition	number : 3 pseudo : _no_value

name	LOC435785 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435785
definition	number : 2 pseudo : _no_value

name	LOC435785 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435785
definition	number : 1 pseudo : _no_value

name	LOC667295 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667295
definition	number : 6 pseudo : _no_value

name	LOC667295 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667295
definition	number : 5 pseudo : _no_value

name	LOC667295 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667295
definition	number : 4 pseudo : _no_value

name	LOC667295 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667295
definition	number : 3 pseudo : _no_value

name	LOC667295 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667295
definition	number : 2 pseudo : _no_value

name	LOC667295 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667295
definition	number : 1 pseudo : _no_value

name	LOC667242 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252548 GeneID:667242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins product : similar to novel member of the major urinary protein (Mup) gene family pseudo : _no_value transcript_id : XR_030627.1

name	LOC100039019 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252534 GeneID:100039019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 21 Proteins product : similar to Predicted gene, OTTMUSG00000007485 pseudo : _no_value transcript_id : XR_030567.1

name	LOC621093 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252555 GeneID:621093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 24 Proteins product : similar to novel member of the major urinary protein (Mup) gene family pseudo : _no_value transcript_id : XR_030662.1

name	LOC621127 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252538 GeneID:621127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins product : similar to Predicted gene, OTTMUSG00000007485 pseudo : _no_value transcript_id : XR_030587.1

name	LOC384021 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252560 GeneID:384021
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins product : similar to novel member of the major urinary protein (Mup) gene family pseudo : _no_value transcript_id : XR_030697.1

clone name	MSMg01-276B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533J13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-352L22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-482L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094J05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-135I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069A14
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-051C16.b	B6Ng01-051C16.g
ACC	DH874890	DH874891
length	681	1,060
definition	DH874890\|Mus musculus domesticus DNA, BAC clone: B6Ng01-051C16, 5' end.	DH874891\|Mus musculus domesticus DNA, BAC clone: B6Ng01-051C16, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcttttagctagcctttctgttaaaagatgtttgtctccctggttg gtggcccactggaaagagaggagggagatggggatgtaattgagatgtaa agtaaagaaaaagaaattaaaattttaaaaaaagtgttcattacttaaaa ccgttttctccacggtggcagatctcagtgctaccagccactcatgcctc tctgtccttccatagagttctgactcagcaatttgatgtatcccttaatg ccttgagtttagtagcatgcagttttgatcttggctcaggtcaagaagat catgaaccaggtgttccagtcactgaggggagagtttgagctggaggaat cttatgatggagggaccattctgaggaccatcatgcatacaattaaggta catccagaaagctgtcaggggcttcactggagtgggcactcatacaagtg atgggaacccctgaaatggcatatgtccacatgggtgtgtccagccagcc tcttcccacagaagagagagtgagttgggtggcagctgtgcttctgagga caaggacctgtcagtacatgctgtcttcctgtcagtgtcacctcctcctt ggcttttgaacagatggtgacgctgcagctgttgaaccatcaggaggaag aggaggaagaggaagaggaggaggaagagga	gaattctcacctgaggaataccgaatggcagagaagcacctgaaaaaaat gttcaacatccttaatcatcagggaaaagcaaatcaaaacaaccctgaga ttccacctcacaccagtcagaatggctaagatcaaaatttcaggtgacag cagatgctggcgaggatgtggagaaagaggaacactcctccattgttggt gggattgcaagtttgtacaaccactctggaaatcagtctggcggttccct tagaaaattggacatagtactaccgggtgatccagcaatacctcttctgg gcatatatccaaaacatgtcccaaccggtatgaaggacacatgctccact aagttcatagcagccttatttataatagccagaagctggaaagaagccag atgcccctcaacagaggaatggatacagaaaatgtggtacatttacacaa tggagtactactcagctattaaaaagaatgaatttatgaaattcctaggc aaatggatggacctggagggcatcatcctgagtgaggtaacccaatcaca aaggaactcacacaatatgtactcactgataagtggacattagcccaaaa cttaggatacccaagatataagatacaatttgccaaatgcatgaaactct agaagaatgaagaccaaagtgtggacactgtgccccttcttaaaattggg aaaaaacacccatggaaggacccagatatagctgtctcttgaaagactat gccaaggcctagcaaacacagaagtggatgctcacagtcagctattggat gaatcacagggctcccaatggaggagctagagaaagtacccaaggaggta aagggacctgcaaccctatagatggaataacattatgaactaaccagtac cccggagctcttgaccctagctacatatgtatcaaaagatggcctagtca gccatcactggaaagagagcccattggacacataaactttattatgcccc actacaggggaatgccagggccaaaaaatgaagatgggtggggtagggaa atgtgggggg
quality values	Open. Hide. 61 43 35 38 61 61 61 44 55 49 49 55 61 61 49 61 61 61 61 61 61 61 59 59 59 61 61 61 59 59 41 55 30 59 59 59 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 59 61 59 61 61 61 61 55 55 55 59 61 61 61 61 61 59 59 61 61 61 55 44 59 61 61 61 59 59 59 61 61 59 61 61 61 61 61 59 35 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 55 52 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 55 55 43 31 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 53 53 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 57 57 48 53 53 39 57 42 53 52 57 53 57 57 57 53 57 57 57 57 57 57 57 57 53 53 45 57 57 57 53 57 57 57 57 57 53 52 53 23 37 53 34 53 57 53 57 47 47 57 57 57 45 53 46 43 52 53 52 30 41 57 53 57 57 45 57 53 53 53 53 53 57 52 53 53 53 53 57 47 47 45 53 57 52 57 57 53 53 57 36 57 53 57 50 53 57 57 57 53 57 41 43 45 45 53 37 53 34 20 57 52 38 50 53 57 30 38 18 12 28 36 53 53 53 33 38 53 52 50 37 52 42 38 39 57 52 50 52 43 46 39 57 24 57 52 27 43 53 38 39 57 14 40 53 33 22 53 44 53 47 15 43 57 38 46 38 41 31 46 19 13 8	Open. Hide. 61 61 43 49 61 61 61 49 52 52 52 52 59 37 23 32 59 59 49 61 59 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 59 59 61 61 59 59 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 59 59 59 55 44 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 59 59 59 61 61 61 61 61 61 61 61 61 59 61 59 55 59 61 61 61 61 61 59 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 55 55 61 61 61 61 61 61 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 47 47 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 52 57 46 53 53 53 57 50 53 53 53 53 53 57 57 57 57 53 52 57 52 57 53 47 47 57 53 57 57 57 53 53 53 53 53 53 57 57 53 53 57 57 53 57 53 57 43 57 53 53 53 57 53 53 57 57 57 43 57 57 57 52 53 53 57 57 52 57 44 53 38 42 57 52 52 52 53 53 57 34 53 57 53 52 57 57 50 38 57 38 34 47 47 47 46 52 53 53 41 32 38 53 41 57 53 37 27 37 53 45 50 57 57 57 52 31 38 35 53 53 41 52 45 38 52 57 57 41 38 39 53 44 53 53 34 57 53 24 57 31 31 47 50 57 33 52 27 50 36 35 52 38 52 47 28 57 47 37 34 35 52 39 57 44 53 36 39 20 19 39 42 43 42 37 41 57 52 37 25 52 46 57 37 44 57 57 57 57 33 37 32 46 17 34 33 41 53 57 40 37 19 53 29 11 33 30 33 29 36 30 37 48 47 29 37 53 44 40 53 48 44 48 35 44 40 53 44 23 31 17 37 37 41 38 27 27 29 29 21 41 9 39 32 48 25 30 29 47 32 27 31 47 29 35 48 48 29 35 25 20 30 21 31 30 32 23 28 30 30 33 34 37 23 29 29 29 28 21 20 24 11 26 20 28 29 27 30 29 34 29 25 18 51 30 14 36 28 47 41 28 29 28 29 30 29 22 24 31 18 29 29 29 29 31 21 46 51 36 28 29 29 24 36 29 15 29 29 36 29 19 31 19 29 51 29 27 51 29 29 13 30 26 29 24 26 27 29 41 29 31 23 29 28 25 31 27 39 35 29 24 21 23 28 29 24 25 33 16 16 19 27 30 14 22 28 30 23 24 28 29 27 25 34 39 36 24 21 21 33 14 23 29 21 6 25 11 16 18 30 22 23 28 31 31 33 23 33 15 31 28 28 33 31 23 29 23 28 51 51 26 7 29 19 33 31 16 23 31 28 13 27 33 19 21 14 25 17 34 27 23 22 22 19 13 10 44 27 15 32 21 19 20 9 26 18 16 25 22 19 28 20 15 9 12 7 14 6 31 28 10 25 44 19 11 7 7 11 23 34 31 30 30 12 10 13 21 22 20 8 19 30 44 11 18 18 15 22 11 22 17 20 33 24 8 18 26 35 35 44 44 13 18 15 13 6 5 22 15 22 35 12 8 8 19 14 7 6 4 7 31 5 4 10 18 8 5 4 8 30 30 31 21 22

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_61965873_61966553
seq2: B6Ng01-051C16.b_47_727 (reverse)

seq1  TCCTCTTCCTCCTCCTCTTCCTCTTCCTCCTCTTCCTCCTGATGGTTCAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCTTCCTCCTCCTCTTCCTCTTCCTCCTCTTCCTCCTGATGGTTCAA  50

seq1  CAGCTGCAGCGTCACCATCTGTTCAAAAGCCAAGGAGGAGGTGACACTGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTGCAGCGTCACCATCTGTTCAAAAGCCAAGGAGGAGGTGACACTGA  100

seq1  CAGGAAGACAGCATGTACTGACAGGTCCTTGTCCTCAGAAGCACAGCTGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAAGACAGCATGTACTGACAGGTCCTTGTCCTCAGAAGCACAGCTGC  150

seq1  CACCCAACTCACTCTCTCTTCTGTGGGAAGAGGCTGGCTGGACACACCCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCCAACTCACTCTCTCTTCTGTGGGAAGAGGCTGGCTGGACACACCCA  200

seq1  TGTGGACATATGCCATTTCAGGGGTTCCCATCACTTGTATGAGTGCCCAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGACATATGCCATTTCAGGGGTTCCCATCACTTGTATGAGTGCCCAC  250

seq1  TCCAGTGAAGCCCCTGACAGCTTTCTGGATGTACCTTAATTGTATGCATG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGTGAAGCCCCTGACAGCTTTCTGGATGTACCTTAATTGTATGCATG  300

seq1  ATGGTCCTCAGAATGGTCCCTCCATCATAAGATTCCTCCAGCTCAAACTC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGTCCTCAGAATGGTCCCTCCATCATAAGATTCCTCCAGCTCAAACTC  350

seq1  TCCCCTCAGTGACTGGAACACCTGGTTCATGATCTTCTTGACCTGAGCCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCTCAGTGACTGGAACACCTGGTTCATGATCTTCTTGACCTGAGCCA  400

seq1  AGATCAAAACTGCATGCTACTAAACTCAAGGCATTAAGGGATACATCAAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATCAAAACTGCATGCTACTAAACTCAAGGCATTAAGGGATACATCAAA  450

seq1  TTGCTGAGTCAGAACTCTATGGAAGGACAGAGAGGCATGAGTGGCTGGTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTGAGTCAGAACTCTATGGAAGGACAGAGAGGCATGAGTGGCTGGTA  500

seq1  GCACTGAGATCTGCCACCGTGGAGAAAACGGTTTTAAGTAATGAACACTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTGAGATCTGCCACCGTGGAGAAAACGGTTTTAAGTAATGAACACTT  550

seq1  TTTTTAAAATTTTAATTTCTTTTTCTTTACTTTACATCTCAATTACATCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTAAAATTTTAATTTCTTTTTCTTTACTTTACATCTCAATTACATCC  600

seq1  CCATCTCCCTCCTCTCTTTCCAGTGGGCCACCAACCAGGGAGACAAACAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATCTCCCTCCTCTCTTTCCAGTGGGCCACCAACCAGGGAGACAAACAT  650

seq1  CTTTTAACAGAAAGGCTAGCTAAAAGAATTC  681
      |||||||||||||||||||||||||||||||
seq2  CTTTTAACAGAAAGGCTAGCTAAAAGAATTC  681

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information