MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-054P23
Chromosome	4 (Build37)
Map Location	108,199,345 - 108,200,236
singlet/doublet	singlet
Overlap gene	Zcchc11
Upstream gene	Glis1, Dmrtb1, LOC100039889, LOC433743, 4933424M12Rik, 4930430J20Rik, Magoh, 0610037L13Rik, Cpt2, Slc1a7, Podn, Scp2, Echdc2, Zyg11a, Zyg11b, LOC100040252, 2010305A19Rik, LOC545667, Gpx7, LOC665728, LOC100040110
Downstream gene	Prpf38a, Orc1l, Cc2d1b, Zfyve9, LOC100040326, 3110021N24Rik, Btf3l4, Txndc12, Kti12, Rab3b, Nrd1, Osbpl9, Calr4, Eps15, LOC666144, 4922503N01Rik, Rnf11, 4930522H14Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Glis1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230587 MGI:2386723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dmrtb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56296 MGI:1927125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 31 ESTs, 2 Proteins

name	LOC100039889 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC433743 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 61 ESTs, 6 Proteins

name	4933424M12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67548 MGI:1914798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	4930430J20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78109 MGI:1925359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Magoh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17149 MGI:1330312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610037L13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74098 MGI:1921348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12896 MGI:109176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc1a7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242607 MGI:2444087
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Podn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242608 MGI:2674939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20280 MGI:98254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Echdc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52430 MGI:1289238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zyg11a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230590 MGI:2446208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 2 Proteins

name	Zyg11b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:414872 MGI:2685277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040252 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	2010305A19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69893 MGI:1917143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545667 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	Gpx7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67305 MGI:1914555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665728 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Zcchc11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230594 MGI:2445126
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040110 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Prpf38a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230596 MGI:1916962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Orc1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18392 MGI:1328337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cc2d1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319965 MGI:2443076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfyve9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230597 MGI:2652838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040326 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	3110021N24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73133 MGI:1920383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Btf3l4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70533 MGI:1915312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txndc12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66073 MGI:1913323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kti12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100087 MGI:1923547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69908 MGI:1917158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nrd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230598 MGI:1201386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Osbpl9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100273 MGI:1923784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Calr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108802 MGI:2140435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eps15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13858 MGI:104583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666144 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 327 ESTs, 2 Proteins pseudo : _no_value

name	4922503N01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230603 MGI:2444350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29864 MGI:1352759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930522H14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67646 MGI:1914896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glis1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124377992 GeneID:230587 MGI:2386723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GLIS family zinc finger 1 transcript_id : NM_147221.2

name	Dmrtb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252820 GeneID:56296 MGI:1927125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 31 ESTs, 2 Proteins product : DMRT-like family B with proline-rich C-terminal, 1 transcript_id : XM_205469.7

name	LOC100039889 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252822 GeneID:100039889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100039889 transcript_id : XM_001474196.1

name	LOC433743 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252840 GeneID:433743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 61 ESTs, 6 Proteins product : similar to translocase of outer mitochondrial membrane 22 homolog transcript_id : XM_485426.5

name	4933424M12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252824 GeneID:67548 MGI:1914798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 4933424M12 gene transcript_id : XM_001474219.1

name	4930430J20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252827 GeneID:78109 MGI:1925359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4930430J20 gene transcript_id : XM_001474455.1

name	Magoh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130124 GeneID:17149 MGI:1330312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mago-nashi homolog, proliferation-associated (Drosophila) transcript_id : NM_010760.2

name	0610037L13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130504 GeneID:74098 MGI:1921348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610037L13 gene transcript_id : NM_028754.2

name	Cpt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753513 GeneID:12896 MGI:109176
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carnitine palmitoyltransferase 2 transcript_id : NM_009949.1

name	Slc1a7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122844 GeneID:242607 MGI:2444087
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 1 (glutamate transporter), member 7 transcript_id : NM_146255.1

name	Podn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32526860 GeneID:242608 MGI:2674939
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : podocan transcript_id : NM_172874.2

name	Scp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373930 GeneID:20280 MGI:98254
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sterol carrier protein 2, liver transcript_id : NM_011327.2

name	Echdc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349919 GeneID:52430 MGI:1289238
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enoyl Coenzyme A hydratase domain containing 2 transcript_id : NM_026728.2

name	Zyg11a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252841 GeneID:230590 MGI:2446208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 2 Proteins product : zyg-11 homolog A (C. elegans) transcript_id : XM_131619.6

name	Zyg11b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354695 GeneID:414872 MGI:2685277
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zyg-ll homolog B (C. elegans) transcript_id : NM_001033634.2

name	2010305A19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371762 GeneID:69893 MGI:1917143
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010305A19 gene transcript_id : NM_027250.3

name	LOC545667 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252832 GeneID:545667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : hypothetical LOC545667 transcript_id : XM_620088.4

name	Gpx7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366038 GeneID:67305 MGI:1914555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione peroxidase 7 transcript_id : NM_024198.3

name	Zcchc11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83977460 GeneID:230594 MGI:2445126
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCHC domain containing 11 transcript_id : NM_175472.3

name	Prpf38a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385028 GeneID:230596 MGI:1916962
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PRP38 pre-mRNA processing factor 38 (yeast) domain containing A transcript_id : NM_172697.2

name	Orc1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754943 GeneID:18392 MGI:1328337
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : origin recognition complex, subunit 1-like (S.cereviaiae) transcript_id : NM_011015.1

name	Orc1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62460373 GeneID:18392 MGI:1328337
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : origin recognition complex, subunit 1-like (S.cereviaiae) transcript_id : NM_001014425.1

name	Cc2d1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373435 GeneID:319965 MGI:2443076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil and C2 domain containing 1B transcript_id : NM_177045.3

name	Zfyve9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119508809 GeneID:230597 MGI:2652838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, FYVE domain containing 9 transcript_id : NM_183300.2

name	3110021N24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252839 GeneID:73133 MGI:1920383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA 3110021N24 gene transcript_id : XM_897870.3

name	Btf3l4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892989 GeneID:70533 MGI:1915312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : basic transcription factor 3-like 4 transcript_id : NM_027453.2

name	Txndc12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130370 GeneID:66073 MGI:1913323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin domain containing 12 (endoplasmic reticulum) transcript_id : NM_025334.3

name	Kti12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803069 GeneID:100087 MGI:1923547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : KTI12 homolog, chromatin associated (S. cerevisiae) transcript_id : NM_029571.2

name	Rab3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130330 GeneID:69908 MGI:1917158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB3B, member RAS oncogene family transcript_id : NM_023537.5

name	Nrd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31559917 GeneID:230598 MGI:1201386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nardilysin, N-arginine dibasic convertase, NRD convertase 1 transcript_id : NM_146150.2

name	Osbpl9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27597099 GeneID:100273 MGI:1923784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxysterol binding protein-like 9 transcript_id : NM_173350.1

name	Osbpl9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385216 GeneID:100273 MGI:1923784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxysterol binding protein-like 9 transcript_id : NM_133885.2

name	Calr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803566 GeneID:108802 MGI:2140435
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calreticulin 4 transcript_id : NM_001033226.2

name	Eps15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375587 GeneID:13858 MGI:104583
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epidermal growth factor receptor pathway substrate 15 transcript_id : NM_007943.2

name	4922503N01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23510250 GeneID:230603 MGI:2444350
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4922503N01 gene transcript_id : NM_153392.1

name	Rnf11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892912 GeneID:29864 MGI:1352759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 11 transcript_id : NM_013876.3

name	4930522H14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367097 GeneID:67646 MGI:1914896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930522H14 gene transcript_id : NM_026291.2

name	Glis1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124377993 GeneID:230587 MGI:2386723
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003704 - specific RNA polymerase II transcription factor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Glis1 Kruppel-like zinc finger protein; GLI-Kruppel family member GLI6; zinc finger transcription factor Gli5 product : GLIS family zinc finger 1 protein_id : NP_671754.2

name	Dmrtb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252821 GeneID:56296 MGI:1927125
definition	codon_start : 1 product : DMRT-like family B with proline-rich C-terminal, 1 protein_id : XP_205469.7

name	LOC100039889 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252823 GeneID:100039889
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474246.1

name	LOC433743 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82894454 GeneID:433743
definition	codon_start : 1 product : hypothetical protein protein_id : XP_485426.3

name	4933424M12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252825 GeneID:67548 MGI:1914798
definition	codon_start : 1 product : hypothetical protein LOC67548 protein_id : XP_001474269.1

name	4930430J20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252828 GeneID:78109 MGI:1925359
definition	codon_start : 1 product : hypothetical protein LOC78109 protein_id : XP_001474505.1

name	Magoh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754616 CCDS:CCDS18441.1 GeneID:17149 MGI:1330312
definition	GO_component : GO:0005634 - nucleus [Evidence NAS] GO_function : GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0007292 - female gamete generation [Evidence NAS]; GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : mago-nashi homolog, proliferation-associated protein_id : NP_034890.1

name	0610037L13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539639 CCDS:CCDS18442.1 GeneID:74098 MGI:1921348
definition	codon_start : 1 product : hypothetical protein LOC74098 protein_id : NP_083030.1

name	Cpt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753514 CCDS:CCDS18443.1 GeneID:12896 MGI:109176
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004095 - carnitine O-palmitoyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : CPT II product : carnitine palmitoyltransferase 2 protein_id : NP_034079.1

name	Slc1a7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122845 CCDS:CCDS18444.1 GeneID:242607 MGI:2444087
definition	GO_function : GO:0017153 - sodium:dicarboxylate symporter activity [Evidence IEA] codon_start : 1 product : solute carrier family 1 (glutamate transporter), member 7 protein_id : NP_666367.1

name	Podn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32526861 CCDS:CCDS18445.1 GeneID:242608 MGI:2674939
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : podocan protein_id : NP_766462.2

name	Scp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45476581 CCDS:CCDS18446.1 GeneID:20280 MGI:98254
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005777 - peroxisome [Evidence TAS] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005498 - sterol carrier activity [Evidence IEA]; GO:0004770 - sterol carrier protein X-related thiolase activity [Evidence TAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006637 - acyl-CoA metabolism [Evidence TAS]; GO:0006869 - lipid transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0007031 - peroxisome organization and biogenesis [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : nonspecific lipid transfer protein product : sterol carrier protein 2, liver protein_id : NP_035457.1

name	Echdc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312020 CCDS:CCDS18447.1 GeneID:52430 MGI:1289238
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : enoyl Coenzyme A hydratase domain containing 2 protein_id : NP_081004.1

name	Zyg11a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252842 GeneID:230590 MGI:2446208
definition	codon_start : 1 product : hypothetical protein protein_id : XP_131619.5

name	Zyg11b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702061 CCDS:CCDS18448.1 GeneID:414872 MGI:2685277
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zyg-ll homolog B protein_id : NP_001028806.1

name	2010305A19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076933 CCDS:CCDS18449.1 GeneID:69893 MGI:1917143
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69893 protein_id : NP_081526.1

name	LOC545667 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252833 GeneID:545667
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620088.4

name	Gpx7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195626 CCDS:CCDS18450.1 GeneID:67305 MGI:1914555
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006979 - response to oxidative stress [Evidence IEA] codon_start : 1 product : glutathione peroxidase 7 protein_id : NP_077160.1

name	Zcchc11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83977461 CCDS:CCDS18451.1 GeneID:230594 MGI:2445126
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] codon_start : 1 product : zinc finger, CCHC domain containing 11 protein_id : NP_780681.2

name	Prpf38a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370014 CCDS:CCDS18452.1 GeneID:230596 MGI:1916962
definition	codon_start : 1 exception : mismatches in translation product : PRP38 pre-mRNA processing factor 38 (yeast) domain containing A protein_id : NP_766285.1

name	Orc1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754944 CCDS:CCDS18453.1 GeneID:18392 MGI:1328337
definition	GO_component : GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence TAS]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence TAS] codon_start : 1 exception : mismatches in translation function : involved in initiation of DNA replication note : isoform A is encoded by transcript variant A product : origin recognition complex, subunit 1 isoform A protein_id : NP_035145.1

name	Orc1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62460374 GeneID:18392 MGI:1328337
definition	GO_component : GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence TAS]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence TAS] codon_start : 1 exception : mismatches in translation note : isoform B is encoded by transcript variant B product : origin recognition complex, subunit 1 isoform B protein_id : NP_001014425.1

name	Cc2d1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892935 CCDS:CCDS18454.1 GeneID:319965 MGI:2443076
definition	codon_start : 1 product : coiled-coil and C2 domain containing 1B protein_id : NP_796019.1

name	Zfyve9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119508810 GeneID:230597 MGI:2652838
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0046332 - SMAD binding [Evidence ISS] GO_process : GO:0017015 - regulation of transforming growth factor beta receptor signaling pathway [Evidence ISS] codon_start : 1 note : MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor product : zinc finger, FYVE domain containing 9 protein_id : NP_899123.2

name	3110021N24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82894472 GeneID:73133 MGI:1920383
definition	codon_start : 1 product : hypothetical protein LOC73133 protein_id : XP_902963.1

name	Btf3l4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789195 CCDS:CCDS18456.1 GeneID:70533 MGI:1915312
definition	codon_start : 1 note : novel protein similar to basic transcription factor 3 Btf3 product : basic transcription factor 3-like 4 protein_id : NP_081729.1

name	Txndc12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384700 CCDS:CCDS18457.1 GeneID:66073 MGI:1913323
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA]; GO:0019153 - protein-disulfide reductase (glutathione) activity [Evidence IEA] codon_start : 1 note : ortholog of endoplasmic reticulum thioredoxin superfamily member, 18 kDa TLP19 product : endoplasmic reticulum protein ERp19 protein_id : NP_079610.1

name	Kti12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270210 CCDS:CCDS18458.1 GeneID:100087 MGI:1923547
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : KTI12 homolog, chromatin associated protein_id : NP_083847.1

name	Rab3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963723 CCDS:CCDS18459.1 GeneID:69908 MGI:1917158
definition	GO_component : GO:0031045 - dense core granule [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0017157 - regulation of exocytosis [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB3B, member RAS oncogene family protein_id : NP_076026.1

name	Nrd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559918 CCDS:CCDS18460.1 GeneID:230598 MGI:1201386
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0016919 - nardilysin activity [Evidence IEA] [Evidence ISS]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : nardilysin, N-arginine dibasic convertase, NRD convertase 1 protein_id : NP_666262.2

name	Osbpl9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527100 GeneID:100273 MGI:1923784
definition	codon_start : 1 note : isoform a is encoded by transcript variant a product : oxysterol binding protein-like 9 isoform a protein_id : NP_598646.1

name	Osbpl9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27597100 GeneID:100273 MGI:1923784
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2 product : oxysterol binding protein-like 9 isoform b protein_id : NP_775485.1

name	Calr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370292 CCDS:CCDS18461.1 GeneID:108802 MGI:2140435
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005529 - sugar binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : calreticulin 4 protein_id : NP_001028398.1

name	Eps15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679671 CCDS:CCDS18462.1 GeneID:13858 MGI:104583
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : epidermal growth factor pathway substrate 15 product : epidermal growth factor receptor pathway substrate 15 protein_id : NP_031969.1

name	4922503N01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510251 CCDS:CCDS18463.1 GeneID:230603 MGI:2444350
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC230603 protein_id : NP_700441.1

name	Rnf11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305435 CCDS:CCDS18464.1 GeneID:29864 MGI:1352759
definition	GO_component : GO:0000151 - ubiquitin ligase complex [Evidence IPI] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IPI] codon_start : 1 product : ring finger protein 11 protein_id : NP_038904.1

name	4930522H14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312856 CCDS:CCDS18465.1 GeneID:67646 MGI:1914896
definition	codon_start : 1 product : hypothetical protein LOC67646 protein_id : NP_080567.1

name	LOC100040252 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040252
definition	number : 3 pseudo : _no_value

name	LOC100040252 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040252
definition	number : 2 pseudo : _no_value

name	LOC100040252 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040252
definition	number : 1 pseudo : _no_value

name	LOC665728 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665728
definition	number : 1 pseudo : _no_value

name	LOC100040110 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040110
definition	number : 1 pseudo : _no_value

name	LOC100040326 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040326
definition	number : 1 pseudo : _no_value

name	LOC100040326 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040326
definition	number : 2 pseudo : _no_value

name	LOC666144 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252843 GeneID:666144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 327 ESTs, 2 Proteins product : similar to orf pseudo : _no_value transcript_id : XR_032061.1

clone name	MSMg01-491J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289O02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-136O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383N08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-144C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453J10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-272H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-210N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256E05
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-054P23.b	B6Ng01-054P23.g
ACC	DH877584	DH877585
length	991	1,165
definition	DH877584\|Mus musculus domesticus DNA, BAC clone: B6Ng01-054P23, 5' end.	DH877585\|Mus musculus domesticus DNA, BAC clone: B6Ng01-054P23, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattctaccttatttatttatttacagaaattaaactgtaaagaaataa ttgaaaatttggcgaaaattcttaagaggcatccaggtaaaatttcatat ctttatttcaaaaaaagactttctggcattataaaaattatttagctttc ttaagtttttgttccccaaccctcaggtttaagaaacattctgcctataa ctactgccaaagtgcctattgtaaaatttgaacacaggagaagtggacta gaaggtgatatcagtttatataacacattggtaagtttttcttttaggcc cagccatctataattatactttaaaatttttacttgaaaattatttttat attttaagtatatagttatattaaaatataactacatccttttccttgtg tttttttgctttgttttgttttgttttttcttttcttgagcctgacggtg gtggtgcacacctgcagacctaacagttggtaacagttgggaggtagagg caggttggatctcttgagtttgaggccagccatgactacacagagaaacc ctgtcttgagaaacaaaacaaaacaaaacaaaaaatttcagatcccatgc ccatttctgaatggattggtttttgctttgttcttactgtattttgaatt ctttatatattctgaatattaatcctttgtaatctttacagatgacaaat gtcccctgttctgtggaatctctcctcagttggttgtttcttagttgctt agaagctttttagtttcatgaggtcctcaattgttggattaactcctggg caagtggggtcctaattaagaaagtcttctcctggagctagtgagatggc tcagtggttaagaacactgagtgctcttccaaaggtcctccattcaattc ccagcaaccacatggtggctcacaaccatctgcaatgggatctgatgccc tcttctgtgtgtctgaagacagctacagtgtactcatatac	gaattcacagagatccaccttccccatcttggtctagttattcttgttgt gttacaaaccacccccaaatttgatgttgtaaagcagttcttttatcatg cttgctgactcctctagctaaggagtcttttttttttttttaagatttat tttatgtatatgagtacactgtagctgtctttagacacaccagaagaagg cattggatcccattatagatggttgtgagccaccatgtggttgctaggat ttgaattcaggacctctggaagagcagtcagtgctcctaaccaccaagcc atctctccagccccctggctagggaatcttggtaggatactacagagagt ttgacactgctccatgacatttggtatgacttaaagacacaaaattattt cctggaaatgagataaaattccctgaaaaatttttcacatatatgtctag gggctgggatgattcggagacgagtgtcgcagtggcaaagcagaagctgc attgcctttgtgccctgcctggaaactcatgtagtgtcccttcacaacac tccagtgctgacagcagggagacacgactgcacattctcaggaaggaata ggaaggggcattgtaggggagtgtgcaagacaggcagtattgtgtcttta cataataattggctatatgtggccatgagttggtgtatttttacccccag gagtgcagttggattatattgctatagtgttttgtttgtttgtcttctga gacagtgtctcactatgtagccttggctgatctggaacttgacatgcaaa ctgtcataccgttgaattcacaaaactctgcttgctggctaagcactgaa acagtttttaaaccaaaatcattttaacagtaaggatgatgttgacttat atgttaatactgtactaagtagaatgcagatgattactgaaatgtgtgta tatagtaaaatacatgttactaccttaaataaactaacattctgctctag cactatcaagctgaaaataagttacagcacattttaaacttcttactgat ttacaggggaaactgacaagatgaactacagtctctgacttttagatgcc tgactatgtttgcaagataactttgccttatggctatgcttctgttcacc tcgaagtctgcatca
quality values	Open. Hide. 57 42 21 38 61 61 61 52 61 61 61 61 61 61 61 61 53 61 55 61 61 61 55 61 61 47 26 61 43 41 29 34 34 23 28 28 49 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 44 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 59 55 44 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 44 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 37 37 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 53 53 57 57 57 53 43 57 57 53 52 50 57 47 53 53 53 53 57 57 53 47 35 45 57 57 57 53 57 53 57 53 52 57 57 47 38 53 57 47 47 57 57 57 57 47 47 47 57 57 57 45 50 52 45 53 53 52 53 57 50 53 52 57 57 57 47 47 50 43 57 52 53 57 45 53 50 53 53 52 52 53 53 53 53 47 47 45 38 41 45 53 47 53 50 53 50 57 57 57 33 43 46 50 53 53 57 53 43 47 30 52 53 33 53 52 30 28 57 50 38 57 53 47 24 33 41 47 57 45 35 43 50 52 45 57 42 50 37 34 53 53 53 45 34 43 50 42 42 41 42 31 39 34 31 53 53 30 41 39 42 42 40 50 32 47 52 38 42 34 30 50 29 50 52 31 34 29 57 57 57 50 40 36 50 57 37 40 35 41 36 44 17 37 25 33 40 42 37 33 34 36 37 43 36 41 31 27 23 20 40 29 42 37 53 35 47 40 52 57 53 37 37 40 27 40 47 57 57 53 28 31 40 40 37 37 34 43 37 40 21 53 57 44 37 34 32 31 31 29 41 29 41 32 35 34 40 18 37 37 33 31 39 38 39 33 34 20 46 30 23 38 27 30 21 27 31 44 36 39 31 27 16 48 27 22 24 32 36 37 32 16 30 32 19 36 34 29 30 29 29 28 48 29 22 36 24 28 24 15 11 25 24 26 29 29 23 23 17 29 12 37 26 28 23 22 19 29 20 22 15 25 24 35 39 38 13 33 33 25 35 29 17 28 28 17 12 22 23 34 23 28 29 17 18 27 13 32 24 29 23 25 19 14 34 28 27 22 18 28 34 29 30 24 26 22 10 22 7 16 9 21 12 10 22 31 29 33 28 17 12 10 19 29 31 20 9 6 31 15 28 7 13 21 29 27 14 29 21 11 9 26	Open. Hide. 61 49 55 61 61 59 49 61 38 38 52 28 23 59 59 37 43 59 61 61 61 61 61 61 61 49 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 44 55 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 52 59 44 61 59 59 59 52 59 61 61 59 59 59 61 59 59 59 59 59 59 61 49 59 52 59 45 59 59 59 45 52 43 59 59 59 59 59 59 59 59 59 52 61 59 45 59 44 59 59 49 30 59 59 43 59 59 49 61 49 45 59 59 61 59 59 61 59 59 59 59 59 59 59 59 59 43 61 59 59 59 44 50 59 44 59 59 52 59 59 49 59 59 45 49 59 36 59 52 52 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 49 43 59 59 52 59 52 59 52 59 59 59 59 36 59 36 45 39 28 59 59 59 52 52 59 59 59 59 59 59 52 59 59 61 59 61 59 59 61 59 59 59 45 59 52 52 52 52 52 59 43 59 59 61 61 61 61 59 61 59 59 59 61 61 61 61 59 59 52 59 52 49 61 59 52 55 52 55 61 52 52 55 52 52 55 52 35 55 35 52 52 49 55 55 61 61 55 52 55 55 61 52 55 55 55 52 55 61 61 55 52 61 61 61 61 61 52 55 55 55 61 55 55 55 52 52 55 52 61 55 50 61 55 61 55 61 55 61 55 55 55 50 50 55 50 55 55 61 55 55 50 55 55 43 61 55 55 55 55 61 55 55 55 55 55 55 61 61 55 55 55 61 61 61 55 55 55 61 50 55 50 61 55 55 61 61 50 50 50 52 50 50 61 61 61 61 53 61 61 50 53 47 50 53 39 52 50 35 43 61 43 50 50 29 53 32 50 53 50 50 35 50 52 52 61 61 61 61 61 53 61 50 53 50 35 61 61 42 53 53 53 53 50 61 53 61 52 53 53 53 61 61 52 61 53 61 61 61 61 53 61 61 61 61 61 61 53 52 52 50 45 50 53 53 53 50 50 57 47 46 53 53 53 53 53 45 52 45 53 53 42 53 53 53 42 34 45 50 53 52 53 52 53 52 48 53 53 53 43 57 57 47 32 47 38 45 53 45 53 50 53 53 47 32 53 45 53 53 50 42 50 45 36 53 53 53 24 41 53 39 38 47 45 53 57 50 32 57 57 53 47 33 37 52 53 47 47 53 57 57 53 57 34 53 53 33 53 45 47 46 34 52 30 52 42 57 50 53 45 45 40 47 53 57 40 57 45 45 53 53 53 42 47 29 50 36 57 38 53 39 37 47 57 57 30 50 53 38 50 37 52 36 57 37 24 57 31 34 50 53 36 52 37 47 52 35 53 34 33 31 57 57 52 53 27 33 19 24 26 33 35 36 46 37 25 30 39 35 34 35 44 37 45 53 37 28 44 40 32 34 44 44 53 35 33 32 34 40 40 25 53 22 57 57 43 30 21 57 40 38 21 57 48 48 28 34 28 25 30 30 29 40 28 38 26 30 30 25 37 30 30 29 30 27 30 34 34 34 44 32 34 29 29 37 24 25 29 48 28 29 29 29 29 27 29 30 33 31 35 28 27 25 24 26 29 27 33 30 21 27 48 28 30 29 29 28 33 28 33 32 29 31 25 17 16 23 33 29 27 34 34 29 29 27 46 51 29 24 29 28 28 35 28 27 31 29 24 22 23 32 29 29 26 33 24 29 28 29 27 29 26 36 27 28 27 34 34 51 51 51 33 13 22 20 21 23 18 35 36 19 27 34 25 29 51 51 33 6 15 29 22 29 28 28 11 15 14 28 24 25 26 19 36 20 28 19 28 22 22 24 21 24 17 29 31 19 22 28 14 19 19 22 14 34 19 26 33 31 26 22 15 24 24 13 17 6 4 7 12 21 9 18 11 34 33 14 28 17 27 12 13 4 23 27 15 30 19 21 21 34 12 14 33 11 11 17 28 19 30 36 36 25 6 6 28 13 26 16 7 19 12 30 26 19 16 18 12 9 16 31 13 4 4 4 6 15 11 36 4 10 17 23 8 18 11 29 22 11 9 12 25 9 15 23 7 13 11 5 6 10 10 19 16 13 4 2 4 5 2 2 5 23 12 26 17 6 7 6 23 16 7 9 10 24 18 18 13 4 23 16 12 23 10 27 6 17 13 20 12 20 13 13 25 12 11 8 9 9 24 30 14 4 21 14 10 17 9 18 5 6 16 6 18 5 6 6 13 6 14 6 5 1 4 2 4 8 7 4 3 5 5 19 29 29 19 4 7 12 13 15 4 6 20 12 20 5 7 1 1 11 3 2 3 1 3 5 6 19 4 3 4 11 5 1 4 3 4 3 4 6 3 5 5 4 14 3 2 2 4 13 4 15 7 10 3 9 3 4 5 4 7 15 10 11 7 18 17 10 8 16 7 13 1 2 2 3 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_108199345_108200236
seq2: B6Ng01-054P23.b_49_940

seq1  GAATTCTACCTTATTTATTTATTTACAGAAATTAAACTGTAAAGAAATAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTACCTTATTTATTTATTTACAGAAATTAAACTGTAAAGAAATAA  50

seq1  TTGAAAATTTGGCGAAAATTCTTAAGAGGCATCCAGGTAAAATTTCATAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAAAATTTGGCGAAAATTCTTAAGAGGCATCCAGGTAAAATTTCATAT  100

seq1  CTTTATTTCAAAAAAAGACTTTCTGGCATTATAAAAATTATTTAGCTTTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTATTTCAAAAAAAGACTTTCTGGCATTATAAAAATTATTTAGCTTTC  150

seq1  TTAAGTTTTTGTTCCCCAACCCTCAGGTTTAAGAAACATTCTGCCTATAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAGTTTTTGTTCCCCAACCCTCAGGTTTAAGAAACATTCTGCCTATAA  200

seq1  CTACTGCCAAAGTGCCTATTGTAAAATTTGAACACAGGAGAAGTGGACTA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTGCCAAAGTGCCTATTGTAAAATTTGAACACAGGAGAAGTGGACTA  250

seq1  GAAGGTGATATCAGTTTATATAACACATTGGTAAGTTTTTCTTTTAGGCC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGTGATATCAGTTTATATAACACATTGGTAAGTTTTTCTTTTAGGCC  300

seq1  CAGCCATCTATAATTATACTTTAAAATTTTTACTTGAAAATTATTTTTAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCATCTATAATTATACTTTAAAATTTTTACTTGAAAATTATTTTTAT  350

seq1  ATTTTAAGTATATAGTTATATTAAAATATAACTACATCCTTTTCCTTGTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTAAGTATATAGTTATATTAAAATATAACTACATCCTTTTCCTTGTG  400

seq1  TTTTTTTGCTTTGTTTTGTTTTGTTTTTTCTTTTCTTGAGCCTGACGGTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTGCTTTGTTTTGTTTTGTTTTTTCTTTTCTTGAGCCTGACGGTG  450

seq1  GTGGTGCACACCTGCAGACCTAACAGTTGGTAACAGTTGGGAGGTAGAGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTGCACACCTGCAGACCTAACAGTTGGTAACAGTTGGGAGGTAGAGG  500

seq1  CAGGTTGGATCTCTTGAGTTTGAGGCCAGCCATGACTACACAGAGAAACC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGTTGGATCTCTTGAGTTTGAGGCCAGCCATGACTACACAGAGAAACC  550

seq1  CTGTCTTGAGAAACAAAACAAAACAAAACAAAAAATTTCAGATCCCATGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCTTGAGAAACAAAACAAAACAAAACAAAAAATTTCAGATCCCATGC  600

seq1  CCATTTCTGAATGGATTGGTTTTTGCTTTGTTCTTACTGTATTTTGAATT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATTTCTGAATGGATTGGTTTTTGCTTTGTTCTTACTGTATTTTGAATT  650

seq1  CTTTATATATTCTGAATATTAATCCTTTGTAATCTTTACAGATGACAAAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTATATATTCTGAATATTAATCCTTTGTAATCTTTACAGATGACAAAT  700

seq1  GTCCCCTGTTCTGTGGAATCTCTCCTCAGTTGGTTGTTTCTTAGTTGCTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCCCTGTTCTGTGGAATCTCTCCTCAGTTGGTTGTTTCTTAGTTGCTT  750

seq1  AGAAGCTTTTTAGTTTCATGAGGTCCTCAATTGTTGGATTAACTCCTGGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGCTTTTTAGTTTCATGAGGTCCTCAATTGTTGGATTAACTCCTGGG  800

seq1  CAAGTGGGGTCCTAATTAAGAAAGTCTTCTCCTGGAGCTAGTGAGATGGC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGTGGGGTCCTAATTAAGAAAGTCTTCTCCTGGAGCTAGTGAGATGGC  850

seq1  TCAGTGGTTAAGAACACTGAGTGCTCTTCCAAAGGTCCTCCA  892
      ||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTGGTTAAGAACACTGAGTGCTCTTCCAAAGGTCCTCCA  892

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information