MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-055G01
Chromosome	4 (Build37)
Map Location	3,177,744 - 3,178,863
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100039124, LOC100039141, EG666464
Downstream gene	LOC100039044, LOC631371, LOC666513, Tmem68, Tgs1, Lyn, LOC621858, Rps20, Mos, Plag1, Chchd7, LOC666586, Rdhe2, 4833413O15Rik, Penk1, A830012C17Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039124 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039124
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100039141 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039141
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	EG666464 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666464 MGI:3645324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 62 ESTs, 1 Protein

name	LOC100039044 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039044
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins pseudo : _no_value

name	LOC631371 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631371
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC666513 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666513
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 14 Proteins

name	Tmem68 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72098 MGI:1919348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tgs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116940 MGI:2151797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lyn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17096 MGI:96892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC621858 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621858
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 15 Proteins

name	Rps20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67427 MGI:1914677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mos (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17451 MGI:97052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plag1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56711 MGI:1891916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chchd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66433 MGI:1913683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666586 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666586
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 627 ESTs, 16 Proteins

name	Rdhe2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242285 MGI:2668443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4833413O15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242286 MGI:2685269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Penk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18619 MGI:104629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A830012C17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319308 MGI:2441830
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG666464 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252056 GeneID:666464 MGI:3645324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 62 ESTs, 1 Protein product : predicted gene, EG666464 transcript_id : XM_984031.2

name	LOC666513 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252058 GeneID:666513
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 14 Proteins product : similar to Yamaguchi sarcoma viral (v-yes-1) oncogene homolog transcript_id : XM_984338.2

name	Tmem68 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892404 GeneID:72098 MGI:1919348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 68 transcript_id : NM_028097.3

name	Tgs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50233913 GeneID:116940 MGI:2151797
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trimethylguanosine synthase homolog (S. cerevisiae) transcript_id : NM_054089.3

name	Lyn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859587 GeneID:17096 MGI:96892
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Yamaguchi sarcoma viral (v-yes-1) oncogene homolog transcript_id : NM_010747.1

name	LOC621858 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94371453 GeneID:621858
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 15 Proteins product : similar to high-mobility group box 3 transcript_id : XM_886264.2

name	Rps20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354868 GeneID:67427 MGI:1914677
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S20 transcript_id : NM_026147.4

name	Mos (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111955035 GeneID:17451 MGI:97052
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Moloney sarcoma oncogene transcript_id : NM_020021.2

name	Plag1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402514 GeneID:56711 MGI:1891916
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleiomorphic adenoma gene 1 transcript_id : NM_019969.2

name	Chchd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370747 GeneID:66433 MGI:1913683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil-helix-coiled-coil-helix domain containing 7 transcript_id : NM_181391.2

name	LOC666586 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252060 GeneID:666586
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 625 ESTs, 16 Proteins product : ubiquitin A-52 residue ribosomal protein fusion product 1-like transcript_id : XM_984767.2

name	Rdhe2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32526862 GeneID:242285 MGI:2668443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinal short chain dehydrogenase reductase 2 transcript_id : NM_181989.1

name	4833413O15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123959729 GeneID:242286 MGI:2685269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4833413O15 gene transcript_id : NM_001080710.1

name	Penk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801808 GeneID:18619 MGI:104629
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : preproenkephalin 1 transcript_id : NM_001002927.2

name	A830012C17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252061 GeneID:319308 MGI:2441830
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA A830012C17 gene transcript_id : XM_001472556.1

name	EG666464 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94371447 GeneID:666464 MGI:3645324
definition	codon_start : 1 product : similar to LOC635138 protein protein_id : XP_989125.1

name	LOC666513 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252059 GeneID:666513
definition	codon_start : 1 product : hypothetical protein protein_id : XP_989432.2

name	Tmem68 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312456 CCDS:CCDS17937.1 GeneID:72098 MGI:1919348
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : transmembrane protein 68 protein_id : NP_082373.1

name	Tgs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50233914 CCDS:CCDS17938.1 GeneID:116940 MGI:2151797
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : nuclear receptor coactivator 6 interacting protein protein_id : NP_473430.2

name	LOC621858 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82801207 GeneID:621858
definition	codon_start : 1 product : similar to high-mobility group box 3 protein_id : XP_891357.1

name	Lyn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859588 CCDS:CCDS17939.1 GeneID:17096 MGI:96892
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005128 - erythropoietin receptor binding [Evidence TAS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA] [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030218 - erythrocyte differentiation [Evidence IMP]; GO:0042541 - hemoglobin biosynthesis [Evidence TAS]; GO:0007242 - intracellular signaling cascade [Evidence IDA]; GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0042531 - positive regulation of tyrosine phosphorylation of STAT protein [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence IDA] [Evidence TAS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0009725 - response to hormone stimulus [Evidence IDA] codon_start : 1 exception : mismatches in translation product : Yamaguchi sarcoma viral (v-yes-1) oncogene homolog protein_id : NP_034877.1

name	Rps20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385652 CCDS:CCDS17940.1 GeneID:67427 MGI:1914677
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0015935 - small ribosomal subunit [Evidence IEA] codon_start : 1 product : ribosomal protein S20 protein_id : NP_080423.1

name	Mos (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111955036 GeneID:17451 MGI:97052
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : c-mos proto-oncogene product : Moloney sarcoma oncogene protein_id : NP_064405.2

name	Plag1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910494 CCDS:CCDS17941.1 GeneID:56711 MGI:1891916
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : C2H2 zinc finger protein PLAG1 product : pleiomorphic adenoma gene 1 protein_id : NP_064353.1

name	Chchd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31088924 GeneID:66433 MGI:1913683
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : coiled-coil-helix-coiled-coil-helix domain containing 7 protein_id : NP_852056.1

name	LOC666586 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94371455 GeneID:666586
definition	codon_start : 1 product : hypothetical protein LOC666586 protein_id : XP_989861.1

name	Rdhe2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32526863 CCDS:CCDS17944.1 GeneID:242285 MGI:2668443
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : short chain dehydrogenase reductase 9; retinal short chain dehydrogenase reductase (Rdhe2) product : epidermal retinal dehydrogenase 2 protein_id : NP_871789.1

name	4833413O15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123959730 GeneID:242286 MGI:2685269
definition	codon_start : 1 product : hypothetical protein LOC242286 protein_id : NP_001074179.1

name	Penk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50950119 CCDS:CCDS17946.1 GeneID:18619 MGI:104629
definition	GO_function : GO:0001515 - opioid peptide activity [Evidence IEA] GO_process : GO:0007610 - behavior [Evidence IMP]; GO:0001662 - behavioral fear response [Evidence IMP]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA]; GO:0019233 - sensory perception of pain [Evidence IMP] codon_start : 1 note : spermatogenic-specific proenkephalin product : preproenkephalin 1 protein_id : NP_001002927.1

name	A830012C17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252062 GeneID:319308 MGI:2441830
definition	codon_start : 1 product : hypothetical protein LOC319308 protein_id : XP_001472606.1

name	LOC100039124 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039124
definition	number : 2 pseudo : _no_value

name	LOC100039124 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039124
definition	number : 1 pseudo : _no_value

name	LOC100039141 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039141
definition	number : 1 pseudo : _no_value

name	LOC631371 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631371
definition	number : 1 pseudo : _no_value

name	LOC631371 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631371
definition	number : 2 pseudo : _no_value

name	LOC631371 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631371
definition	number : 3 pseudo : _no_value

name	LOC631371 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631371
definition	number : 4 pseudo : _no_value

name	LOC100039044 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252057 GeneID:100039044
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins product : similar to COX11 homolog, cytochrome c oxidase assembly protein (yeast) pseudo : _no_value transcript_id : XR_030520.1

clone name	MSMg01-494C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-327G23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-264E14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-136H09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-170D09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-116G20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-122I03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-233N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409F02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-322A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475B01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-446C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119M03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-405J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490O09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-396O20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-503B10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-437L15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-305A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007K12
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-055G01.b	B6Ng01-055G01.g
ACC	DH877842	DH877843
length	1,108	1,166
definition	DH877842\|Mus musculus domesticus DNA, BAC clone: B6Ng01-055G01, 5' end.	DH877843\|Mus musculus domesticus DNA, BAC clone: B6Ng01-055G01, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcctaaattaatagtggattcttgccttccgagactgctgtgtatt tttgtttttattttttaattttcataccatgtattttgatcaggttttcc ccttccccactgtctcccaacatggagtcctgatgagactggcatatact tgagaggatgaggggtcctttagtggctaactctaggcatgagatctagg ctaaatcacagcaactctgttcaaggttcaggaaacctcagaaaaagaca ggctggaattgcagtaccaatttatagtgaagcctgaaagttggggatgg gatcagaagtctgagaccatgctacatactcaagtctgttgtctatgggt gatggagcagcagattcataccccagtgcaggtgaacagaacttagactt ctgtgcaagcttctccactctttctgtatccactccatccaaagatgctg cctgtgaagtaggcaccatcccactccttcctgagccatgttccagttgt ttctggaaattccctcacaagtgtatttcaaactacttaaagtgacaaac agatttaaccatcacaggggggtactgtcccagaagtgtcttctaaggta acagatttgactagctggggtttaagcagaggacaggatttctttctatt tagaaaacaagagaatggggttaaaattagaaaaaaatagaggagaggtt gtgtgcagattatatgtagttatgtctgtttgaacaactcagctttcatc ctactctgaaccactgcactcagccagccttattatcagatacaaagagc ctgtgataaaaatgtaacatatgtacacagtttagtcacactatcacagc acagtggatttagaagaagcttatcatgccaaacagcagtttctcatgga ggcaacacatatgtagggacttgttttatgtcacatgcactcatggatca cactgctgtgctccctttgaaaaagccaaaaactctatagctttaatctt tggactctggcagggcataatttgttttccacatgtacagaggcttaaca ggaagtatttcagaagttctgagacccaactaataatatgaatatctgat gatttaaa	gaattcagtctttgagggattctgtcaatgaagacctagaggcaatagag aagtccattgaaactttagaaaaatctttgacctccctgtctgaggtagt tttgcagaacaggagaggtcttgatttgttgttcctaaaggaaggaagac tgtgtgctgcccttaaagaagagtgctgcttctatgcagatcatacagga atagttagagactctatgcagaaactgagagaaagattagagcgaaggaa atgggaacaggatgctcaatgggggtggtttgagtcgtggtttgaatcac gaccatcttagataacttctttgatttccgctgtcgccggaccaatcctt atgatatgcttagctttagttttcggcccttgtataataaatagaggaat ggctttcatccagagtagaattgatacagtaaaactcatggtttttcaaa ggcaatatcaacctataattcaggtagatgaagagttaggggacaccaat ctctaaaattctatgattagaattagtctaaacagaagaagaggggaata aaaggaaataaaacttgagacctgtgattcatgtaatgtatgtcaaatag cccaaagagttgtttgtgagctttgaaacttagggctgagaacatagcag aacagaccaggacatgcccaggcaggcccatcaccttcctatctcccacc cctctgacccaagttaaatgttaacaggctgctgatgtttaaatggacga atcatgtgaaaccgcaccaattcctccccagccccactccttttctataa aaacccctagcttccaagcctcgtggttgaatccactgtctcctgtgtga gatacattttgacccggagcatggctttgtttccaaagattgtgctgtgc tttaacagaaatacagacctgggtaataggtaggtagagtcacactgaga tatgctgtcaagactgaatgagagcacgcaactgtatgaatggccctaca caccgctttagacggcagaccaaatgggagtgtgtttagtaccaatccgt tgtaatggggcatcctgaagcacctagtaagctaacaggacggctgagtt atgtagctgcatgaagcttagaaatactctatgtaatcctttacggtcta tgagttggagagactc
quality values	Open. Hide. 61 42 28 33 61 61 61 53 53 61 50 61 61 61 61 61 47 43 43 61 61 47 38 61 61 61 61 49 43 49 33 28 28 28 19 34 52 59 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 28 37 59 61 61 59 59 55 59 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 59 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 55 61 61 52 61 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 42 61 61 61 61 61 61 61 52 61 61 61 53 61 61 53 61 61 61 61 61 61 61 61 61 43 61 61 57 57 57 47 47 53 45 57 57 52 57 57 53 57 57 57 57 57 57 57 47 53 53 53 57 53 57 53 53 40 57 57 57 57 53 53 53 53 53 57 57 57 57 53 47 57 52 53 57 52 57 53 42 57 29 57 47 38 50 50 57 39 38 57 57 50 53 57 57 45 53 39 35 57 57 53 37 41 57 57 47 50 42 43 53 57 37 57 45 42 57 57 57 47 32 52 34 57 57 32 42 53 53 47 53 57 57 57 57 57 52 52 47 50 57 52 38 53 35 41 23 41 27 53 52 50 57 38 52 41 33 27 52 20 52 33 24 45 53 52 31 53 40 40 53 38 38 52 50 44 50 53 38 57 52 42 48 32 40 24 52 42 50 39 47 14 53 37 57 50 50 27 42 40 42 36 36 37 37 42 40 40 52 21 34 41 27 37 41 53 43 36 42 52 40 37 33 26 38 27 36 32 40 32 39 37 40 44 41 37 29 21 24 47 23 31 37 30 57 37 29 48 31 40 44 30 57 36 37 37 34 29 57 57 57 24 27 40 21 34 27 32 30 38 32 48 39 29 25 37 17 45 29 45 48 51 30 36 31 31 39 20 36 27 32 29 29 32 35 22 35 18 14 41 25 38 29 13 13 30 30 15 21 51 26 11 25 33 51 26 48 31 21 39 33 30 21 29 34 18 28 33 22 21 18 51 32 24 22 29 29 29 18 13 51 16 28 14 16 12 28 29 36 25 13 37 18 13 11 13 23 33 26 28 17 15 34 34 31 19 51 46 24 24 28 13 20 23 41 51 17 24 28 28 28 29 16 6 11 27 29 22 19 27 21 22 14 14 29 18 18 36 17 8 24 20 29 21 30 25 28 29 16 24 12 13 18 30 19 9 30 7 24 6 42 51 51 39 12 19 28 12 51 38 38 33 7 17 16 21 13 8 13 22 20 26 38 38 7 8 30 20 20 51 25 7 14 27 8 5 6 15 26 28 23 27 39 33 29 8 6 8 13 25 29 44 13 30 4 44 30 9 32 17 7 14 8 11 14 5 7 8 7 7 8 12 19 22 13 14 14 17 9 27 8 8 7 12 5 20 6 11 37 17 13 6 5 23 29 7 5 7 8 29 8 18 4 8 4 3 5 5 21 16 13 9 5 8 5 19 15 4 3 10 10 7 23 11 11 12 10 7 4 8 23 24 11 18 12 24 15 3	Open. Hide. 61 47 50 55 61 40 35 26 37 43 28 49 49 28 41 38 61 61 49 38 61 61 61 61 61 59 49 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 59 61 61 43 55 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 49 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 55 61 61 61 61 61 61 61 61 61 55 55 52 55 55 55 61 52 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 50 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 53 61 61 61 50 61 61 61 61 61 61 61 61 61 61 43 61 61 61 61 61 61 61 61 52 61 61 61 53 61 61 61 61 61 53 45 47 39 61 61 61 53 61 29 30 52 53 50 42 61 50 30 61 61 61 50 61 61 47 38 39 43 57 57 52 53 53 53 57 53 38 57 57 53 57 38 52 57 36 21 57 57 53 50 57 53 45 52 53 57 53 53 53 47 47 47 53 53 53 32 57 57 38 53 53 57 38 53 53 45 45 52 52 40 53 52 21 47 47 43 50 38 47 46 47 37 30 53 47 38 38 53 53 34 53 38 30 47 47 43 23 19 46 28 57 50 34 53 52 38 53 50 52 47 38 47 31 47 50 40 45 37 57 39 45 45 57 57 51 41 53 50 52 53 35 33 36 37 50 35 41 29 36 57 30 35 42 24 35 13 52 41 32 16 43 24 50 45 50 41 37 34 21 47 14 57 40 53 57 22 26 43 37 36 36 28 30 12 31 35 27 32 50 40 32 28 57 34 29 53 27 37 30 52 52 30 37 52 53 36 44 37 27 39 37 39 24 26 28 53 53 44 8 31 52 33 32 16 57 57 33 29 22 22 33 29 57 57 47 37 33 44 45 41 33 40 21 27 27 33 39 33 12 47 32 25 37 36 37 29 10 29 25 29 29 30 31 31 30 32 39 19 31 17 39 21 30 28 33 38 30 40 22 32 26 28 38 23 41 17 27 24 16 22 51 46 12 24 29 16 36 27 21 16 31 18 29 8 11 24 34 9 17 47 44 27 25 29 33 22 29 26 45 17 11 41 29 15 21 25 28 22 20 35 17 12 21 30 51 23 17 6 21 16 16 29 46 27 25 16 28 13 14 41 15 20 29 30 51 43 25 39 17 23 31 22 33 29 21 28 30 17 43 20 36 6 10 19 11 26 16 28 23 28 31 16 34 13 51 10 29 13 29 31 17 28 18 44 20 14 14 31 29 28 19 23 30 10 5 9 12 7 6 9 9 13 21 15 19 11 15 5 10 19 12 41 21 5 9 6 21 16 6 5 12 12 6 14 8 23 6 12 13 28 36 23 6 5 29 20 14 24 11 16 8 35 19 33 9 31 25 8 9 44 10 16 12 5 15 7 6 4 14 18 8 26 9 14 24 12 6 4 4 6 5 5 6 13 18 18 9 9 10 22 38 32 28 6 5 11 8 14 6 13 6 7 5 20 24 7 7 12 16 7 4 23 29 8 6 10 11 6 4 3 4 7 15 8 9 15 5 10 13 5 29 7 23 5 3 7 7 21 23 7 5 16 3 5 7 10 15 24 9 9 4 3 4 5 8 21 8 23 5 5 19 7 9 23 5 15 10 16 4 5 4 5 24 26 5 3 2 11 11 5 11 6 8 9 17 12 3 6 6 16 3 5 8 9 5 6 6 5 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_3177744_3178863
seq2: B6Ng01-055G01.b_47_1154

seq1  GAATTCCTAAATTAATAGTGGATTCTTGCCTTCCGAGACTGCTGTGTATT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTAAATTAATAGTGGATTCTTGCCTTCCGAGACTGCTGTGTATT  50

seq1  TTTGTTTTTATTTTTTAATTTTCATACCATGTATTTTGATCAGGTTTTCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTTTTTATTTTTTAATTTTCATACCATGTATTTTGATCAGGTTTTCC  100

seq1  CCTTCCCCACTGTCTCCCAACATGGAGTCCTGATGAGACTGGCATATACT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCCCCACTGTCTCCCAACATGGAGTCCTGATGAGACTGGCATATACT  150

seq1  TGAGAGGATGAGGGGTCCTTTAGTGGCTAACTCTAGGCATGAGATCTAGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGAGGATGAGGGGTCCTTTAGTGGCTAACTCTAGGCATGAGATCTAGG  200

seq1  CTAAATCACAGCAACTCTGTTCAAGGTTCAGGAAACCTCAGAAAAAGACA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAATCACAGCAACTCTGTTCAAGGTTCAGGAAACCTCAGAAAAAGACA  250

seq1  GGCTGGAATTGCAGTACCAATTTATAGTGAAGCCTGAAAGTTGGGGATGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGGAATTGCAGTACCAATTTATAGTGAAGCCTGAAAGTTGGGGATGG  300

seq1  GATCAGAAGTCTGAGACCATGCTACATACTCAAGTCTGTTGTCTATGGGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCAGAAGTCTGAGACCATGCTACATACTCAAGTCTGTTGTCTATGGGT  350

seq1  GATGGAGCAGCAGATTCATACCCCAGTGCAGGTGAACAGAACTTAGACTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGGAGCAGCAGATTCATACCCCAGTGCAGGTGAACAGAACTTAGACTT  400

seq1  CTGTGCAAGCTTCTCCACTCTTTCTGTATCCACTCCATCCAAAGATGCTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGCAAGCTTCTCCACTCTTTCTGTATCCACTCCATCCAAAGATGCTG  450

seq1  CCTGTGAAGTAGGCACCATCCCACTCCTTCCTGAGCCATGTTCCAGTTGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTGAAGTAGGCACCATCCCACTCCTTCCTGAGCCATGTTCCAGTTGT  500

seq1  TTCTGGAAATTCCCTCACAAGTGTATTTCAAACTACTTAAAGTGACAAAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGGAAATTCCCTCACAAGTGTATTTCAAACTACTTAAAGTGACAAAC  550

seq1  AGATTTAACCATCACAGGGGGGTACTGTCCCAGAAGTGTCTTCTAAGGTA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATTTAACCATCACAGGGGGGTACTGTCCCAGAAGTGTCTTCTAAGGTA  600

seq1  ACAGATTTGACTAGCTGGGGTTTAAGCAGAGGACAGGATTTCTTTCTATT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGATTTGACTAGCTGGGGTTTAAGCAGAGGACAGGATTTCTTTCTATT  650

seq1  TAGAAAACAAGAGAATGGGGTTAAAATTAGAAAAAAATAGAGGAGAGGTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAAAACAAGAGAATGGGGTTAAAATTAGAAAAAAATAGAGGAGAGGTT  700

seq1  GTGTGCAGATTATATGTAGTTATGTCTGTTTGAACAACTCAGCTTTCATC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGCAGATTATATGTAGTTATGTCTGTTTGAACAACTCAGCTTTCATC  750

seq1  CTACTCTGAACCACTGCACTCAGCCAGCCTTATTATCAGATACAAAGAGC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTCTGAACCACTGCACTCAGCCAGCCTTATTATCAGATACAAAGAGC  800

seq1  CTGTGATAAAAATGTAACATATGTACACAGTTTAGTCACACTATCACAGC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGATAAAAATGTAACATATGTACACAGTTTAGTCACACTATCACAGC  850

seq1  ACAGTGGATTTAGAAGAAGCTTATCATGCCAAACAGCAG-TTCTCATGGA  899
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  ACAGTGGATTTAGAAGAAGCTTATCATGCCAAACAGCAGTTTCTCATGGA  900

seq1  GGCAACACATATGTAGGGACTTGTTTTATGTCACATGCACTCATGGATTC  949
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  GGCAACACATATGTAGGGACTTGTTTTATGTCACATGCACTCATGGA-TC  949

seq1  ACACTGCTGTGCTCCCTTGGAAAAAAGCCAAAAAACTCTATAGCTTTATT  999
      |||||||||||||||||| | |||||||| |||||||||||||||||| |
seq2  ACACTGCTGTGCTCCCTTTG-AAAAAGCC-AAAAACTCTATAGCTTTAAT  997

seq1  CTTTGGACTCTGGCAGGGGCATAATTTGGTTTCCACATGTACAGAGGCTT  1049
      ||||||||||||||| |||||||||||| |||||||||||||||||||||
seq2  CTTTGGACTCTGGCA-GGGCATAATTTGTTTTCCACATGTACAGAGGCTT  1046

seq1  AACAAGTAGTTATTTCAGAAGTTCTGAAGAACCACAACTAATAAATTAAT  1099
      |||| | || |||||||||||||||| |||  | ||||||||||    ||
seq2  AACAGGAAG-TATTTCAGAAGTTCTG-AGA--CCCAACTAATAA---TAT  1089

seq1  GAATTATCTGATGATTATAAA  1120
      ||| |||||||||||| ||||
seq2  GAA-TATCTGATGATT-TAAA  1108

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information