MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-174D18
Chromosome	4 (Build37)
Map Location	132,732,808 - 132,841,570
singlet/doublet	doublet
Overlap gene	Wasf2, Gpr3, Cd164l2, Fcnc-ps, Map3k6, Sytl1, D4Ertd196e, LOC100041990
Upstream gene	Ythdf2, LOC664903, Gmeb1, Rnu11, Taf12, 9530096D07Rik, LOC100039864, Trspap1, Rcc1, Snhg3, Phactr4, Med18, Sesn2, Atpif1, Dnajc8, Ptafr, Eya3, Xkr8, Smpdl3b, Rpa2, BC013712, LOC100039917, Ppp1r8, Stx12, OTTMUSG00000010099, BC008163, Fgr, Ahdc1, LOC100041932
Downstream gene	LOC100042018, Wdtc1, Slc9a1, 4732473B16Rik, 2300002D11Rik, 1810019J16Rik, Nudc, Nr0b2, Gpatch3, Atpbd1b, Sfn, Zdhhc18, LOC545683, Pigv, Arid1a, Rps6ka1, 4930429E23Rik, LOC100042151, Hmgn2, Dhdds, Lin28, Aim1l, Cd52, Ubxd5, Sh3bgrl3, Ccdc21, EG665186, Catsper4, Cnksr1, Zfp593, Grrp1, Pdik1l
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ythdf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213541 MGI:2444233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664903 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 804 ESTs, 1 Protein

name	Gmeb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56809 MGI:2135604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353373 MGI:2148804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66464 MGI:1913714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9530096D07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242681 MGI:2441753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039864 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039864
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs

name	Trspap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71787 MGI:1919037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rcc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100088 MGI:1913989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snhg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399101 MGI:2684817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phactr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100169 MGI:2140327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Med18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67219 MGI:1914469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sesn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230784 MGI:2651874
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atpif1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11983 MGI:1196457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68598 MGI:1915848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptafr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19204 MGI:106066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eya3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14050 MGI:109339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Xkr8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381560 MGI:2685877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smpdl3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100340 MGI:1916022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpa2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19891 MGI:1339939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC013712 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230787 MGI:2446213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039917 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039917
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Ppp1r8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100336 MGI:2140494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stx12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100226 MGI:1931027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000010099 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100038703 MGI:3649305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein pseudo : _no_value

name	BC008163 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230789 MGI:2385211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14191 MGI:95527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ahdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230793 MGI:2444218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041932 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 276 ESTs

name	Wasf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242687 MGI:1098641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14748 MGI:101908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd164l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69655 MGI:1916905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcnc-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:493918 MGI:3510254
definition	gene_synonym : H-Fcn note : ficolin C pseudogene pseudo : _no_value

name	Map3k6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53608 MGI:1855691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sytl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269589 MGI:1933365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D4Ertd196e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52174 MGI:1098568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041990 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100042018 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 82 ESTs

name	Wdtc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230796 MGI:2685541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc9a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20544 MGI:102462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4732473B16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100342 MGI:2140500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2300002D11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69539 MGI:1916789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810019J16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69073 MGI:1916323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Nudc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18221 MGI:106014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Nr0b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23957 MGI:1346344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpatch3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242691 MGI:2442492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atpbd1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100210 MGI:2140368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55948 MGI:1891831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:503610 MGI:3527792
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545683 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545683
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 202 ESTs, 5 Proteins

name	Pigv (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230801 MGI:2442480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arid1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93760 MGI:1935147
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps6ka1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20111 MGI:104558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930429E23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73898 MGI:1921148
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC100042151 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	Hmgn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15331 MGI:96136
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dhdds (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67422 MGI:1914672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lin28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83557 MGI:1890546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aim1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230806 MGI:1334463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins

name	Cd52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23833 MGI:1346088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubxd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67586 MGI:1914836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh3bgrl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73723 MGI:1920973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70012 MGI:1917262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665186 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665186 MGI:3702974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Catsper4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329954 MGI:3043288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnksr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194231 MGI:2670958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp593 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68040 MGI:1915290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grrp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72690 MGI:1919940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs, 2 Proteins

name	Pdik1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230809 MGI:2385213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ythdf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353711 GeneID:213541 MGI:2444233
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : YTH domain family 2 transcript_id : NM_145393.3

name	LOC664903 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253141 GeneID:664903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 804 ESTs, 1 Protein product : similar to hCG1994130 transcript_id : XM_973351.2

name	Gmeb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9937989 GeneID:56809 MGI:2135604
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucocorticoid modulatory element binding protein 1 transcript_id : NM_020273.1

name	Taf12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364052 GeneID:66464 MGI:1913714
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_025579.2

name	9530096D07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126116578 GeneID:242681 MGI:2441753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9530096D07 gene transcript_id : NM_001081651.1

name	LOC100039864 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253142 GeneID:100039864
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs product : hypothetical protein LOC100039864 transcript_id : XM_001473681.1

name	Trspap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110835713 GeneID:71787 MGI:1919037
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tRNA selenocysteine associated protein 1 transcript_id : NM_027925.3

name	Rcc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129804 GeneID:100088 MGI:1913989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of chromosome condensation 1 transcript_id : NM_133878.2

name	Phactr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387565 GeneID:100169 MGI:2140327
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatase and actin regulator 4 transcript_id : NM_175306.3

name	Med18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46358371 GeneID:67219 MGI:1914469
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 18 homolog (yeast) transcript_id : NM_026039.2

name	Sesn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450288 GeneID:230784 MGI:2651874
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sestrin 2 transcript_id : NM_144907.1

name	Atpif1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982863 GeneID:11983 MGI:1196457
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase inhibitory factor 1 transcript_id : NM_007512.2

name	Dnajc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349981 GeneID:68598 MGI:1915848
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 8 transcript_id : NM_172400.2

name	Ptafr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487078 GeneID:19204 MGI:106066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : platelet-activating factor receptor transcript_id : NM_001081211.1

name	Eya3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877075 GeneID:14050 MGI:109339
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eyes absent 3 homolog (Drosophila) transcript_id : NM_210071.1

name	Eya3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877079 GeneID:14050 MGI:109339
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eyes absent 3 homolog (Drosophila) transcript_id : NM_211357.1

name	Eya3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877073 GeneID:14050 MGI:109339
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eyes absent 3 homolog (Drosophila) transcript_id : NM_010166.2

name	Xkr8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235769 GeneID:381560 MGI:2685877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X Kell blood group precursor related family member 8 homolog transcript_id : NM_201368.1

name	Smpdl3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130844 GeneID:100340 MGI:1916022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingomyelin phosphodiesterase, acid-like 3B transcript_id : NM_133888.2

name	Rpa2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625960 GeneID:19891 MGI:1339939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : replication protein A2 transcript_id : NM_011284.3

name	BC013712 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385534 GeneID:230787 MGI:2446213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC013712 transcript_id : NM_001033308.2

name	Ppp1r8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122684 GeneID:100336 MGI:2140494
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 8 transcript_id : NM_146154.1

name	Stx12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387432 GeneID:100226 MGI:1931027
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 12 transcript_id : NM_133887.3

name	BC008163 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704089 GeneID:230789 MGI:2385211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC008163 transcript_id : NM_145553.1

name	Fgr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344961 GeneID:14191 MGI:95527
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Gardner-Rasheed feline sarcoma viral (Fgr) oncogene homolog transcript_id : NM_010208.3

name	Ahdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244059 GeneID:230793 MGI:2444218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AT hook, DNA binding motif, containing 1 transcript_id : NM_146155.3

name	LOC100041932 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253162 GeneID:100041932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 276 ESTs product : hypothetical protein LOC100041932 transcript_id : XM_001477842.1

name	Wasf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367233 GeneID:242687 MGI:1098641
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAS protein family, member 2 transcript_id : NM_153423.4

name	Gpr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83627722 GeneID:14748 MGI:101908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein coupled receptor 3 transcript_id : NM_008154.2

name	Cd164l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115511039 GeneID:69655 MGI:1916905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD164 sialomucin-like 2 transcript_id : NM_027152.1

name	Map3k6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66392594 GeneID:53608 MGI:1855691
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen-activated protein kinase kinase kinase 6 transcript_id : NM_016693.3

name	Sytl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878228 GeneID:269589 MGI:1933365
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin-like 1 transcript_id : NM_031393.1

name	D4Ertd196e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360682 GeneID:52174 MGI:1098568
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 4, ERATO Doi 196, expressed transcript_id : NM_025667.2

name	LOC100042018 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253164 GeneID:100042018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 82 ESTs product : hypothetical protein LOC100042018 transcript_id : XM_001477989.1

name	Wdtc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802322 GeneID:230796 MGI:2685541
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD and tetratricopeptide repeats 1 transcript_id : NM_199306.2

name	Slc9a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842401 GeneID:20544 MGI:102462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 9 (sodium/hydrogen exchanger), member 1 transcript_id : NM_016981.2

name	4732473B16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922607 GeneID:100342 MGI:2140500
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732473B16 gene transcript_id : NM_175307.4

name	2300002D11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922651 GeneID:69539 MGI:1916789
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2300002D11 gene transcript_id : NM_001081156.2

name	1810019J16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922628 GeneID:69073 MGI:1916323
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810019J16 gene transcript_id : NM_001083916.1

name	1810019J16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922645 GeneID:69073 MGI:1916323
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810019J16 gene transcript_id : NM_133707.2

name	Nudc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754909 GeneID:18221 MGI:106014
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear distribution gene C homolog (Aspergillus) transcript_id : NM_010948.1

name	Nr0b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981365 GeneID:23957 MGI:1346344
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 0, group B, member 2 transcript_id : NM_011850.2

name	Gpatch3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802392 GeneID:242691 MGI:2442492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G patch domain containing 3 transcript_id : NM_172876.2

name	Atpbd1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527097 GeneID:100210 MGI:2140368
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP binding domain 1 family, member B transcript_id : NM_133884.1

name	Sfn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134023661 GeneID:55948 MGI:1891831
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stratifin transcript_id : NM_018754.2

name	Zdhhc18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326531 GeneID:503610 MGI:3527792
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 18 transcript_id : NM_001017968.2

name	LOC545683 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253166 GeneID:545683
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 202 ESTs, 5 Proteins product : similar to ribosomal protein transcript_id : XM_620107.4

name	Pigv (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350613 GeneID:230801 MGI:2442480
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class V transcript_id : NM_178698.4

name	Arid1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249108 GeneID:93760 MGI:1935147
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AT rich interactive domain 1A (Swi1 like) transcript_id : NM_001080819.1

name	Rps6ka1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803300 GeneID:20111 MGI:104558
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S6 kinase polypeptide 1 transcript_id : NM_009097.2

name	4930429E23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253144 GeneID:73898 MGI:1921148
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 4930429E23 gene transcript_id : XM_001474031.1

name	LOC100042151 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253167 GeneID:100042151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : hypothetical protein LOC100042151 transcript_id : XM_001478221.1

name	Hmgn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86198321 GeneID:15331 MGI:96136
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : high mobility group nucleosomal binding domain 2 transcript_id : NM_016957.3

name	Dhdds (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381204 GeneID:67422 MGI:1914672
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dehydrodolichyl diphosphate synthase transcript_id : NM_026144.3

name	Lin28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22003877 GeneID:83557 MGI:1890546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lin-28 homolog (C. elegans) transcript_id : NM_145833.1

name	Aim1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372629 GeneID:230806 MGI:1334463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : absent in melanoma 1-like, transcript variant 1 transcript_id : XM_131754.7

name	Cd52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14719423 GeneID:23833 MGI:1346088
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD52 antigen transcript_id : NM_013706.1

name	Ubxd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129822 GeneID:67586 MGI:1914836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UBX domain containing 5 transcript_id : NM_026257.2

name	Sh3bgrl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18017601 GeneID:73723 MGI:1920973
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3 domain binding glutamic acid-rich protein-like 3 transcript_id : NM_080559.1

name	Ccdc21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541891 GeneID:70012 MGI:1917262
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 21 transcript_id : NM_144527.2

name	EG665186 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123959719 GeneID:665186 MGI:3702974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG665186 transcript_id : NM_001080712.1

name	Catsper4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384331 GeneID:329954 MGI:3043288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : channel, sperm associated 4 transcript_id : NM_177866.3

name	Cnksr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486673 GeneID:194231 MGI:2670958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : connector enhancer of kinase suppressor of Ras 1 transcript_id : NM_001081047.1

name	Zfp593 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13195641 GeneID:68040 MGI:1915290
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 593 transcript_id : NM_024215.1

name	Grrp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253169 GeneID:72690 MGI:1919940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs, 2 Proteins product : glycine/arginine rich protein 1 transcript_id : XM_485455.5

name	Pdik1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254185 GeneID:230809 MGI:2385213
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDLIM1 interacting kinase 1 like transcript_id : NM_146156.2

name	Ythdf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30841028 CCDS:CCDS18719.1 GeneID:213541 MGI:2444233
definition	codon_start : 1 exception : mismatches in translation product : high glucose-regulated protein 8 protein_id : NP_663368.2

name	LOC664903 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94372555 GeneID:664903
definition	codon_start : 1 product : similar to hCG1994130 protein_id : XP_978445.1

name	Gmeb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9937990 CCDS:CCDS18720.1 GeneID:56809 MGI:2135604
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glucocorticoid modulatory element binding protein 1 protein_id : NP_064669.1

name	Taf12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385026 CCDS:CCDS18721.1 GeneID:66464 MGI:1913714
definition	GO_component : GO:0005669 - transcription factor TFIID complex [Evidence ISS] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20 kDa product : TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_079855.1

name	9530096D07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126116579 GeneID:242681 MGI:2441753
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : RAB42, member RAS oncogene family product : RIKEN cDNA 9530096D07 protein_id : NP_001075120.1

name	LOC100039864 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253143 GeneID:100039864
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473731.1

name	Trspap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62821783 CCDS:CCDS18722.1 GeneID:71787 MGI:1919037
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0001514 - selenocysteine incorporation [Evidence IDA] codon_start : 1 product : tRNA selenocysteine associated protein 1 protein_id : NP_082201.2

name	Rcc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527092 CCDS:CCDS18723.1 GeneID:100088 MGI:1913989
definition	GO_process : GO:0051301 - cell division [Evidence IEA] codon_start : 1 product : chromosome condensation 1 protein_id : NP_598639.1

name	Phactr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424978 CCDS:CCDS18724.1 GeneID:100169 MGI:2140327
definition	codon_start : 1 exception : mismatches in translation product : phosphatase and actin regulator 4 protein_id : NP_780515.1

name	Med18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313064 CCDS:CCDS18725.1 GeneID:67219 MGI:1914469
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] codon_start : 1 product : mediator of RNA polymerase II transcription, subunit 18 homolog protein_id : NP_080315.1

name	Sesn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450289 CCDS:CCDS18726.1 GeneID:230784 MGI:2651874
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007050 - cell cycle arrest [Evidence IEA] codon_start : 1 product : sestrin 2 protein_id : NP_659156.1

name	Atpif1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982864 CCDS:CCDS18727.1 GeneID:11983 MGI:1196457
definition	GO_component : GO:0009986 - cell surface [Evidence ISS]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IDA] GO_function : GO:0043532 - angiostatin binding [Evidence ISS]; GO:0051117 - ATPase binding [Evidence ISS]; GO:0042030 - ATPase inhibitor activity [Evidence ISS]; GO:0005516 - calmodulin binding [Evidence ISS]; GO:0004857 - enzyme inhibitor activity [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence ISS] GO_process : GO:0001937 - negative regulation of endothelial cell proliferation [Evidence ISS]; GO:0051346 - negative regulation of hydrolase activity [Evidence ISS]; GO:0045980 - negative regulation of nucleotide metabolism [Evidence IEA]; GO:0051289 - protein homotetramerization [Evidence ISS]; GO:0009268 - response to pH [Evidence ISS] codon_start : 1 product : ATPase inhibitory factor 1 protein_id : NP_031538.2

name	Dnajc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369493 GeneID:68598 MGI:1915848
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : DnaJ (Hsp40) homolog, subfamily C, member 8 protein_id : NP_765988.1

name	Ptafr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487079 GeneID:19204 MGI:106066
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004992 - platelet activating factor receptor activity [Evidence ISS] [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019735 - antimicrobial humoral response (sensu Vertebrata) [Evidence ISS]; GO:0006935 - chemotaxis [Evidence IEA] [Evidence ISS]; GO:0001816 - cytokine production [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] [Evidence ISS]; GO:0006954 - inflammatory response [Evidence ISS] [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : PAF receptor product : platelet-activating factor receptor protein_id : NP_001074680.1

name	Eya3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877076 CCDS:CCDS18729.1 GeneID:14050 MGI:109339
definition	EC_number : 3.1.3.48 GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IDA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : eyes absent 3 homolog isoform 1 protein_id : NP_997592.1

name	Eya3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877074 CCDS:CCDS18730.1 GeneID:14050 MGI:109339
definition	EC_number : 3.1.3.48 GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IDA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : eyes absent 3 homolog isoform 2 protein_id : NP_034296.2

name	Eya3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877080 CCDS:CCDS18731.1 GeneID:14050 MGI:109339
definition	EC_number : 3.1.3.48 GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IDA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : eyes absent 3 homolog isoform 3 protein_id : NP_997596.1

name	Xkr8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235770 CCDS:CCDS18732.1 GeneID:381560 MGI:2685877
definition	codon_start : 1 product : X Kell blood group precursor related family member 8 homolog protein_id : NP_958756.1

name	Smpdl3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527104 CCDS:CCDS18733.1 GeneID:100340 MGI:1916022
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : acid sphingomyelinase-like phosphodiesterase product : sphingomyelin phosphodiesterase, acid-like 3B protein_id : NP_598649.1

name	Rpa2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625961 CCDS:CCDS18734.1 GeneID:19891 MGI:1339939
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 note : 30-kDa protein product : replication protein A2 protein_id : NP_035414.3

name	BC013712 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701808 CCDS:CCDS18735.1 GeneID:230787 MGI:2446213
definition	codon_start : 1 note : basement membrane-induced product : basement membrane-induced protein protein_id : NP_001028480.1

name	Ppp1r8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122685 CCDS:CCDS18736.1 GeneID:100336 MGI:2140494
definition	GO_component : GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008599 - protein phosphatase type 1 regulator activity [Evidence IDA] GO_process : GO:0008283 - cell proliferation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : protein phosphatase 1, regulatory (inhibitor) subunit 8 protein_id : NP_666266.1

name	Stx12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527102 CCDS:CCDS18737.1 GeneID:100226 MGI:1931027
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : syntaxin 13 product : syntaxin 12 protein_id : NP_598648.1

name	BC008163 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704090 CCDS:CCDS18738.1 GeneID:230789 MGI:2385211
definition	codon_start : 1 product : hypothetical protein LOC230789 protein_id : NP_663528.1

name	Fgr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542816 CCDS:CCDS18739.1 GeneID:14191 MGI:95527
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : proto-oncogene tyrosine-protein kinase Fgr protein_id : NP_034338.2

name	Ahdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244060 GeneID:230793 MGI:2444218
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : AT hook, DNA binding motif, containing 1 protein_id : NP_666267.3

name	LOC100041932 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253163 GeneID:100041932
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477892.1

name	Wasf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510313 CCDS:CCDS18742.1 GeneID:242687 MGI:1098641
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005769 - early endosome [Evidence IDA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005199 - structural constituent of cell wall [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IMP]; GO:0030048 - actin filament-based movement [Evidence IMP]; GO:0001667 - ameboidal cell migration [Evidence IMP]; GO:0001525 - angiogenesis [Evidence IMP]; GO:0006928 - cell motility [Evidence IMP]; GO:0006897 - endocytosis [Evidence IDA]; GO:0030032 - lamellipodium biogenesis [Evidence IMP]; GO:0016601 - Rac protein signal transduction [Evidence IMP] codon_start : 1 product : WAS protein family, member 2 protein_id : NP_700472.1

name	Gpr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680065 CCDS:CCDS18743.1 GeneID:14748 MGI:101908
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G-protein coupled receptor 3 protein_id : NP_032180.1

name	Cd164l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115511040 GeneID:69655 MGI:1916905
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : D164 sialomucin-like 2 product : CD164 sialomucin-like 2 protein_id : NP_081428.1

name	Map3k6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66392595 CCDS:CCDS18744.1 GeneID:53608 MGI:1855691
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : apoptosis signal-regulating kinase 2 product : mitogen-activated protein kinase kinase kinase 6 protein_id : NP_057902.3

name	Sytl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878229 GeneID:269589 MGI:1933365
definition	GO_component : GO:0019897 - extrinsic to plasma membrane [Evidence IDA]; GO:0042470 - melanosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA]; GO:0008021 - synaptic vesicle [Evidence IEA] GO_function : GO:0042043 - neurexin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence IPI] codon_start : 1 exception : unclassified translation discrepancy product : synaptotagmin-like 1 protein_id : NP_113570.1

name	D4Ertd196e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313398 GeneID:52174 MGI:1098568
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC52174 protein_id : NP_079943.1

name	LOC100042018 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253165 GeneID:100042018
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478039.1

name	Wdtc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556280 CCDS:CCDS18746.1 GeneID:230796 MGI:2685541
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : WD and tetratricopeptide repeats 1 protein_id : NP_955010.1

name	Slc9a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567404 GeneID:20544 MGI:102462
definition	GO_component : GO:0016323 - basolateral plasma membrane [Evidence TAS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0015297 - antiporter activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015385 - sodium:hydrogen antiporter activity [Evidence IDA]; GO:0015299 - solute:hydrogen antiporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006885 - regulation of pH [Evidence IDA]; GO:0006814 - sodium ion transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : Na+/H+ antiporter; Na+/H+, amiloride sensitive; slow-wave epilepsy; solute carrier family 9, member 1 product : solute carrier family 9 (sodium/hydrogen exchanger), member 1 protein_id : NP_058677.1

name	4732473B16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424982 CCDS:CCDS18748.1 GeneID:100342 MGI:2140500
definition	codon_start : 1 product : hypothetical protein LOC100342 protein_id : NP_780516.1

name	2300002D11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487219 GeneID:69539 MGI:1916789
definition	codon_start : 1 product : hypothetical protein LOC69539 protein_id : NP_001074625.1

name	1810019J16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922629 GeneID:69073 MGI:1916323
definition	codon_start : 1 product : hypothetical protein LOC69073 protein_id : NP_001077385.1

name	1810019J16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922646 GeneID:69073 MGI:1916323
definition	codon_start : 1 product : hypothetical protein LOC69073 protein_id : NP_598468.2

name	Nudc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754910 CCDS:CCDS18750.1 GeneID:18221 MGI:106014
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 product : nuclear distribution gene C homolog protein_id : NP_035078.1

name	Nr0b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754886 CCDS:CCDS18751.1 GeneID:23957 MGI:1346344
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : small heterodimer partner product : nuclear receptor subfamily 0, group B, member 2 protein_id : NP_035980.1

name	Gpatch3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370332 CCDS:CCDS18752.1 GeneID:242691 MGI:2442492
definition	codon_start : 1 product : G patch domain containing 3 protein_id : NP_766464.1

name	Atpbd1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527098 CCDS:CCDS18753.1 GeneID:100210 MGI:2140368
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ATP binding domain 1 family, member B protein_id : NP_598645.1

name	Sfn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134023662 CCDS:CCDS18754.1 GeneID:55948 MGI:1891831
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0019904 - protein domain specific binding [Evidence IEA] GO_process : GO:0030216 - keratinocyte differentiation [Evidence IMP]; GO:0000079 - regulation of cyclin-dependent protein kinase activity [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0043588 - skin development [Evidence IMP] codon_start : 1 note : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, sigma polypeptide; 14-3-3 sigma protein product : stratifin protein_id : NP_061224.2

name	Zdhhc18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326532 GeneID:503610 MGI:3527792
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, DHHC domain containing 18 protein_id : NP_001017968.2

name	LOC545683 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:63517178 GeneID:545683
definition	codon_start : 1 product : similar to ribosomal protein protein_id : XP_620107.1

name	Pigv (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542474 CCDS:CCDS18755.1 GeneID:230801 MGI:2442480
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006506 - GPI anchor biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : phosphatidylinositol glycan, class V product : phosphatidylinositol glycan class V protein_id : NP_848813.2

name	Arid1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249109 GeneID:93760 MGI:1935147
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0016514 - SWI/SNF complex [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006325 - establishment and/or maintenance of chromatin architecture [Evidence IPI] codon_start : 1 note : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1; Swi1 like product : AT rich interactive domain 1A protein_id : NP_001074288.1

name	Rps6ka1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677811 CCDS:CCDS18758.1 GeneID:20111 MGI:104558
definition	GO_component : GO:0005819 - spindle [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 function : phosphorylates S6 product : ribosomal protein S6 kinase polypeptide 1 protein_id : NP_033123.1

name	4930429E23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253145 GeneID:73898 MGI:1921148
definition	codon_start : 1 product : hypothetical protein LOC73898 protein_id : XP_001474081.1

name	LOC100042151 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253168 GeneID:100042151
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478271.1

name	Hmgn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393534 CCDS:CCDS18759.1 GeneID:15331 MGI:96136
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006323 - DNA packaging [Evidence IEA] codon_start : 1 note : high mobility group protein 17 product : high mobility group nucleosomal binding domain 2 protein_id : NP_058653.1

name	Dhdds (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754093 CCDS:CCDS18760.1 GeneID:67422 MGI:1914672
definition	codon_start : 1 product : dehydrodolichyl diphosphate synthase protein_id : NP_080420.2

name	Lin28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003878 CCDS:CCDS18761.1 GeneID:83557 MGI:1890546
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : testis expressed gene 17 product : RNA-binding protein LIN-28 protein_id : NP_665832.1

name	Aim1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82895232 GeneID:230806 MGI:1334463
definition	codon_start : 1 product : similar to absent in melanoma 1-like isoform 1 protein_id : XP_131754.6

name	Cd52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14719424 GeneID:23833 MGI:1346088
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : CD52 antigen protein_id : NP_038734.1

name	Ubxd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385766 CCDS:CCDS18763.1 GeneID:67586 MGI:1914836
definition	codon_start : 1 product : socius protein_id : NP_080533.1

name	Sh3bgrl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18017602 GeneID:73723 MGI:1920973
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : SH3 domain binding glutamic acid-rich protein-like 3 protein_id : NP_542126.1

name	Ccdc21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541892 CCDS:CCDS18765.1 GeneID:70012 MGI:1917262
definition	codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 21 protein_id : NP_653110.2

name	EG665186 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123959720 GeneID:665186 MGI:3702974
definition	codon_start : 1 product : uromodulin precursor-like protein_id : NP_001074181.1

name	Catsper4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244466 CCDS:CCDS18766.1 GeneID:329954 MGI:3043288
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006811 - ion transport [Evidence IEA] codon_start : 1 note : cation channel of sperm 4 product : channel, sperm associated 4 protein_id : NP_808534.1

name	Cnksr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486674 GeneID:194231 MGI:2670958
definition	GO_component : GO:0005938 - cell cortex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0030674 - protein binding, bridging [Evidence ISS] GO_process : GO:0007265 - Ras protein signal transduction [Evidence ISS]; GO:0007266 - Rho protein signal transduction [Evidence ISS] codon_start : 1 product : connector enhancer of kinase suppressor of Ras 1 protein_id : NP_001074516.1

name	Zfp593 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195642 GeneID:68040 MGI:1915290
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 593 protein_id : NP_077177.1

name	Grrp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253170 GeneID:72690 MGI:1919940
definition	codon_start : 1 product : glycine/arginine rich protein 1 protein_id : XP_485455.4

name	Pdik1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122689 CCDS:CCDS18768.1 GeneID:230809 MGI:2385213
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0051301 - cell division [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : PDLIM1 interacting kinase 1 like protein_id : NP_666268.1

name	LOC100039917 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039917
definition	number : 2 pseudo : _no_value

name	LOC100039917 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039917
definition	number : 1 pseudo : _no_value

name	OTTMUSG00000010099 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038703
definition	number : 1 pseudo : _no_value

name	LOC100041990 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041990
definition	number : 1 pseudo : _no_value

name	Rnu11 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872156 GeneID:353373 MGI:2148804
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : U11 small nuclear RNA transcript_id : NR_002865.1

name	Snhg3 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:118442851 GeneID:399101 MGI:2684817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA host gene (non-protein coding) 3 transcript_id : NR_003270.1

clone name	MSMg01-466C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498P16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-496L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294F19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-174D18.b	B6Ng01-174D18.g
ACC	GA002369	GA002370
length	984	1,033
definition	B6Ng01-174D18.b	B6Ng01-174D18.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(132,840,586 - 132,841,570)	(132,732,808 - 132,733,826)
sequence	gaattcctctttcagggaactccatctcacttccagccctcatgtggtgg ctcagaaccatctgtaactctagttccaggggatccaacgtgctcttctg gcctctaaggacactaagcacacacacagtgcacagataaacatacaggc aaaataacaaaaatgttaagtcattgtcttagcatgcccaaggccctggg tttttatcttcactaaaacactacattttcttatgttagtactcctgata tgtgtttcagcttttcggtatgcctggcattgggctggccactagctcaa taagaatgcacacaatagacctcgttcctggttcctgattcctggttcct gactgttcctgccagctcagagcttccagattatctgggagttgtggaat agcaagttaggggattgtatttggcccctgagcattggccttcaatggga aacaagatccccttaggtactgttcaatcgatgtctccgaccgtgtgtca ggctcaggcctaaggatagcaatgtggacacggggcaggcagaaggctgt tggtattcagggttaaggcaggaagattggaaagagacactgcagggtga gcttaggcttctaaagcagcagggatgcccctcttagactgacccccagc ttcctggaagtgccttttatgctttttattgttgcacaaaaagcactttt agtaagtcaacttccgcataccaaaacctcttatctgatctaagggatgt ctagaaggaaccaccacctaagcaattctcagccctgggagaacgtctgg gtttgccagacagtctccagactaagttacagaaaggctctgagaatcct tcaaaggaacaagcccacaaagttcttagtaacattcctgacaaaggctg cttccagctggacgtggtggcgcacacctttaatcccagcactcgggagg cagaggcaggcgtatttctgagtccagagacgcc	gaattctctgtgtgtgaagtgggaggttcacagagcagtgtcttgggtcg aggaatgctcctgtaattagacgatctgttccgtgtggaagcctcacgtg cgccaatagtctagctacccagcaccccaccgcgctcttcccaaagggaa gcaaagtaagcatgttctcagagacgctggctgacgcgtcatccctgata cacatttaattgtgctgcaagcccccaggtccaagatcagggcacacatt acttctgcagtctccagagtattgggagatttgcgagctttgtgagcaca cggtgtgagctcacggtgtgtgcacacggtgtgaacgtacagtgacacaa atggtagctggagccgttcttatatatatgtaaaatttctttaattggct atattagtgagactgccttgggaaggtgatttgcatgtggtttggattcc attctgaatcaagctgactgtttccttgaagctgaggtgtgggagaggca gatgttaggaccagccctgggtttgcctagtgctgccccagctcccataa gcacctctgtggcaatgccactttagtgatcctccttagcaaaggcactt ggtataaattatttctgacactcacccctgctgtcacatcactgccccta gaaaaggcagaggactatccgaagcttgcattcccctctggcgtgatagg ccctaccttgagccaaggaggcagagctgtgtgaccaggtgatgtatgga gtctgagactccctaagccttcacctagcataggccctgtctcagttgat ccagggcttaatgagcctggatggggcatcacagaagaataaaccccatt ggcagtgcctgtcgcacacaaagaaccctgacggcagtctcagcatcata gctgtagcttggcagtgagtgtcatcacgaggaagcttgctaaagcgttt ctgctttttgtcaccccagatggtctaggtgcattagagccagccataca cttggttcctttctccacaggaacatagaacgt
quality values	Open. Hide. 58 38 28 37 58 45 58 54 58 58 58 58 28 13 52 49 54 39 58 54 58 62 47 45 62 62 62 33 38 47 62 62 62 41 17 11 56 27 14 9 8 10 6 11 9 11 10 11 49 47 62 43 44 44 59 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 50 30 18 13 13 18 18 9 9 13 10 10 10 13 10 18 34 48 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 59 59 62 62 59 62 62 62 62 62 59 62 54 54 56 59 59 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 46 50 48 48 43 43 54 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 46 50 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 59 62 62 62 59 59 62 62 62 62 62 62 62 56 62 59 56 46 43 36 40 34 34 49 56 62 62 62 62 62 62 62 62 59 59 59 59 59 62 62 59 43 39 36 43 43 34 23 23 34 51 59 56 56 54 54 59 56 62 56 62 62 59 59 59 59 59 59 62 59 62 59 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 34 30 19 34 30 43 62 62 62 47 62 56 62 62 62 44 62 56 56 62 50 44 39 56 44 56 56 51 56 56 56 62 62 56 56 62 47 56 31 42 23 38 30 38 62 62 51 62 45 43 38 62 56 42 47 32 56 41 56 50 47 43 43 56 47 56 56 56 33 62 47 47 47 37 47 43 62 47 50 50 62 62 62 56 47 33 62 62 33 52 41 31 34 52 33 47 47 38 42 62 62 48 52 43 62 62 62 62 62 62 62 62 52 62 48 58 54 58 15 21 10 9 13 13 36 52 42 18 33 21 7 41 25 43 46 54 47 52 52 54 58 50 36 35 46 33 58 54 54 58 37 26 35 33 23 33 35 42 42 49 52 41 42 54 50 52 54 58 46 52 54 39 58 52 58 58 36 39 35 52 45 42 51 58 51 40 40 46 49 51 28 45 43 47 48 50 50 50 49 58 21 28 30 26 30 35 47 41 30 50 46 47 40 51 50 58 50 40 48 48 46 50 41 47 52 52 52 49 51 50 35 24 50 51 13 40 39 46 52 39 36 46 38 47 49 50 46 39 52 40 32 50 18 58 35 31 30 53 50 52 52 29 28 35 31 14 58 53 29 18 37 37 35 37 35 47 32 25 26 50 21 46 18 31 21 29 28 42 34 39 12 31 40 49 41 34 53 47 25 13 54 11 16 37 40 33 40 33 54 31 30 37 35 35 32 34 22 26 37 15 7 8 21 42 37 33 30 20 33 53 23 45 22 25 31 41 51 24 31 39 10 53 33 15 15 54 27 29 32 40 18 25 6 32 34 45 22 34 20 40 27 20 29 31 29 28 20 31 52 27 33 34 25 47 32 24 11 6 27 35 25 14 8 9 29 31 29 10 41 26 16 8 10 9 11 8 15 30 31 32 21 46 46 14 8 44 21 29 33 35 33 35 21 7 32 31 18 31 18 22 31 24 28 22 20 9 18 46 17 21 26 27 23 30 28 32 37 43 46 31 16 9 12 23 28 25 23 21 22 9 6 24 22 18 18 20 7 6 25 27 15 6 11 6 9 21 14 12 31 6 9 7 11 11 43 31 18 29 16 22 7 34 19 11 8 5 14 12 33 35 23 32 24	Open. Hide. 62 49 51 47 62 62 62 62 62 62 62 62 11 13 12 10 10 10 11 13 10 9 13 13 9 22 18 28 27 46 62 59 56 62 59 54 54 48 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 59 62 59 18 18 18 13 23 11 10 13 10 9 21 10 23 9 10 36 38 54 54 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 56 49 62 59 59 45 34 45 51 59 62 62 62 62 42 54 59 62 62 62 62 62 62 62 59 59 62 54 54 54 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 56 62 54 56 62 59 59 59 43 48 59 59 56 56 59 51 59 48 54 51 62 59 59 62 59 56 59 51 46 40 49 59 54 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 32 28 56 51 62 62 62 59 62 59 59 62 62 54 62 62 62 62 62 62 48 35 48 25 23 23 28 25 31 40 51 56 48 56 50 59 56 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 43 62 62 62 62 62 62 59 59 59 51 44 56 62 62 62 62 62 62 62 62 59 62 59 59 59 59 59 62 62 56 62 62 62 62 51 62 62 62 62 62 62 62 62 62 62 62 59 43 51 51 62 59 59 62 62 62 62 62 62 62 62 56 62 62 62 62 47 62 62 62 56 56 62 54 56 62 62 56 51 56 62 56 62 62 56 56 56 44 51 56 56 56 51 56 50 40 56 51 56 39 51 39 56 41 56 51 62 62 62 62 62 56 54 43 51 62 56 47 42 56 62 62 56 62 51 47 62 56 62 62 62 62 56 62 62 38 47 56 62 56 62 22 15 34 18 20 25 62 37 62 62 62 62 43 26 54 56 50 62 62 56 62 47 49 52 48 62 52 52 47 47 49 42 50 52 52 52 52 62 62 62 62 52 42 42 52 52 47 43 52 62 52 48 29 31 22 31 38 32 54 62 52 42 52 16 37 13 15 19 40 18 58 34 16 54 54 54 32 54 23 42 52 23 41 39 35 40 23 22 28 38 39 41 50 39 54 53 52 54 44 16 41 52 42 37 49 50 29 52 27 42 40 42 50 26 14 25 37 42 54 30 48 50 35 33 37 41 32 17 34 19 32 27 54 15 33 52 25 54 37 38 28 11 10 35 28 24 12 13 28 22 25 41 46 31 50 29 37 47 24 40 46 52 41 29 22 39 34 26 7 28 12 19 31 30 15 20 29 10 26 20 19 29 26 31 27 9 22 25 33 24 10 10 10 16 23 28 50 13 25 32 31 26 6 15 23 30 28 31 20 26 19 18 54 37 29 31 19 8 11 9 16 18 18 17 24 11 23 33 19 35 39 28 9 22 28 28 31 26 27 31 39 12 37 17 6 20 27 22 7 50 35 27 42 37 28 20 33 37 35 11 12 9 9 14 29 22 25 25 41 33 19 9 13 22 17 21 19 13 23 24 15 28 11 12 40 18 39 42 37 25 17 35 16 20 17 10 7 10 16 17 8 25 15 9 17 14 6 31 13 10 31 30 22 13 14 11 19 16 22 33 13 18 8 17 14 23 10 13 28 9 25 31 16 20 24 29 12 17 9 19 18 22 6 17 29 23 17 11 6 5 9 12 29 21 7 9 31 19 32 31 23 21 20 31 16 9 13 12 8 6 16 21 13 18 15 19 4 33 7 41 27 7 30 9 28 6 9 16 21 22 8 13 9 11 6 31 11 31 13 34 7 30 30 32 12 18 31 13 6 9 10 12 28 18 28 14 31 14 40 26 7 9 15 31 29 12 14 11 13 26 15 16 10 10 15 9 10 34 10 16 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_132840586_132841570
seq2: B6Ng01-174D18.b_42_1025 (reverse)

seq1  GGCGTCTCTGAACTCAGAAATCCGCCTGCCTCTGCCTCCCGAGTGCTGGG  50
      |||||||||| |||||||||| ||||||||||||||||||||||||||||
seq2  GGCGTCTCTGGACTCAGAAATACGCCTGCCTCTGCCTCCCGAGTGCTGGG  50

seq1  ATTAAAGGTGTGCGCCACCACGTCCAGCTTGAAGCAGCCTTTTGTCAGGG  100
      ||||||||||||||||||||||||||||| ||||||||| ||||||| ||
seq2  ATTAAAGGTGTGCGCCACCACGTCCAGCTGGAAGCAGCC-TTTGTCA-GG  98

seq1  ATTGTTACTAAG-ACTTTGTGGGCTTGTTCCTTTGAAGGATTCTCAGAGC  149
      | |||||||||| |||||||||||||||||||||||||||||||||||||
seq2  AATGTTACTAAGAACTTTGTGGGCTTGTTCCTTTGAAGGATTCTCAGAGC  148

seq1  CTTTCTGTAACTTAGTCTGGAGACCTGTCTGGCAAA-CCAGACGTTCTCC  198
      ||||||||||||||||||||||| |||||||||||| |||||||||||||
seq2  CTTTCTGTAACTTAGTCTGGAGA-CTGTCTGGCAAACCCAGACGTTCTCC  197

seq1  CAGGGCTGAGAATTGCTTAGGTGGTGGTTCCTTCTAGACATCCCTTAGAT  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGCTGAGAATTGCTTAGGTGGTGGTTCCTTCTAGACATCCCTTAGAT  247

seq1  CAGATAAGAGGTTTTGGTATGCGGAAGTTGACTTACTAAAAGTGCTTTTT  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGATAAGAGGTTTTGGTATGCGGAAGTTGACTTACTAAAAGTGCTTTTT  297

seq1  GTGCAACAATAAAAAGCATAAAAGGCACTTCCAGGAAGCTGGGGGTCAGT  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCAACAATAAAAAGCATAAAAGGCACTTCCAGGAAGCTGGGGGTCAGT  347

seq1  CTAAGAGGGGCATCCCTGCTGCTTTAGAAGCCTAAGCTCACCCTGCAGTG  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAGAGGGGCATCCCTGCTGCTTTAGAAGCCTAAGCTCACCCTGCAGTG  397

seq1  TCTCTTTCCAATCTTCCTGCCTTAACCCTGAATACCAACAGCCTTCTGCC  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTTTCCAATCTTCCTGCCTTAACCCTGAATACCAACAGCCTTCTGCC  447

seq1  TGCCCCGTGTCCACATTGCTATCCTTAGGCCTGAGCCTGACACACGGTCG  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCCCGTGTCCACATTGCTATCCTTAGGCCTGAGCCTGACACACGGTCG  497

seq1  GAGACATCGATTGAACAGTACCTAAGGGGATCTTGTTTCCCATTGAAGGC  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGACATCGATTGAACAGTACCTAAGGGGATCTTGTTTCCCATTGAAGGC  547

seq1  CAATGCTCAGGGGCCAAATACAATCCCCTAACTTGCTATTCCACAACTCC  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATGCTCAGGGGCCAAATACAATCCCCTAACTTGCTATTCCACAACTCC  597

seq1  CAGATAATCTGGAAGCTCTGAGCTGGCAGGAACAGTCAGGAACCAGGAAT  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGATAATCTGGAAGCTCTGAGCTGGCAGGAACAGTCAGGAACCAGGAAT  647

seq1  CAGGAACCAGGAACGAGGTCTATTGTGTGCATTCTTATTGAGCTAGTGGC  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAACCAGGAACGAGGTCTATTGTGTGCATTCTTATTGAGCTAGTGGC  697

seq1  CAGCCCAATGCCAGGCATACCGAAAAGCTGAAACACATATCAGGAGTACT  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCCAATGCCAGGCATACCGAAAAGCTGAAACACATATCAGGAGTACT  747

seq1  AACATAAGAAAATGTAGTGTTTTAGTGAAGATAAAAACCCAGGGCCTTGG  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATAAGAAAATGTAGTGTTTTAGTGAAGATAAAAACCCAGGGCCTTGG  797

seq1  GCATGCTAAGACAATGACTTAACATTTTTGTTATTTTGCCTGTATGTTTA  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGCTAAGACAATGACTTAACATTTTTGTTATTTTGCCTGTATGTTTA  847

seq1  TCTGTGCACTGTGTGTGTGCTTAGTGTCCTTAGAGGCCAGAAGAGCACGT  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTGCACTGTGTGTGTGCTTAGTGTCCTTAGAGGCCAGAAGAGCACGT  897

seq1  TGGATCCCCTGGAACTAGAGTTACAGATGGTTCTGAGCCACCACATGAGG  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGATCCCCTGGAACTAGAGTTACAGATGGTTCTGAGCCACCACATGAGG  947

seq1  GCTGGAAGTGAGATGGAGTTCCCTGAAAGAGGAATTC  985
      |||||||||||||||||||||||||||||||||||||
seq2  GCTGGAAGTGAGATGGAGTTCCCTGAAAGAGGAATTC  984

seq1: chr4_132732808_132733826
seq2: B6Ng01-174D18.g_70_1102

seq1  GAATTCTCTGTGTGTGAAGTGGGAGGTTCACAGAGCAGTGTCTTGGGTCG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTGTGTGTGAAGTGGGAGGTTCACAGAGCAGTGTCTTGGGTCG  50

seq1  AGGAATGCTCCTGTAATTAGACGATCTGTTCCGTGTGGAAGCCTCACGTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAATGCTCCTGTAATTAGACGATCTGTTCCGTGTGGAAGCCTCACGTG  100

seq1  CGCCAATAGTCTAGCTACCCAGCACCCCACCGCGCTCTTCCCAAAGGGAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCCAATAGTCTAGCTACCCAGCACCCCACCGCGCTCTTCCCAAAGGGAA  150

seq1  GCAAAGTAAGCATGTTCTCAGAGACGCTGGCTGACGCGTCATCCCTGATA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAAGTAAGCATGTTCTCAGAGACGCTGGCTGACGCGTCATCCCTGATA  200

seq1  CACATTTAATTGTGCTGCAAGCCCCCAGGTCCAAGATCAGGGCACACATT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATTTAATTGTGCTGCAAGCCCCCAGGTCCAAGATCAGGGCACACATT  250

seq1  ACTTCTGCAGTCTCCAGAGTATTGGGAGATTTGCGAGCTTTGTGAGCACA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTCTGCAGTCTCCAGAGTATTGGGAGATTTGCGAGCTTTGTGAGCACA  300

seq1  CGGTGTGAGCTCACGGTGTGTGCACACGGTGTGAACGTACAGTGACACAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGTGTGAGCTCACGGTGTGTGCACACGGTGTGAACGTACAGTGACACAA  350

seq1  ATGGTAGCTGGAGCCGTTCTTATATATATGTAAAATTTCTTTAATTGGCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGTAGCTGGAGCCGTTCTTATATATATGTAAAATTTCTTTAATTGGCT  400

seq1  ATATTAGTGAGACTGCCTTGGGAAGGTGATTTGCATGTGGTTTGGATTCC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTAGTGAGACTGCCTTGGGAAGGTGATTTGCATGTGGTTTGGATTCC  450

seq1  ATTCTGAATCAAGCTGACTGTTTCCTTGAAGCTGAGGTGTGGGAGAGGCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTGAATCAAGCTGACTGTTTCCTTGAAGCTGAGGTGTGGGAGAGGCA  500

seq1  GATGTTAGGACCAGCCCTGGGTTTGCCTAGTGCTGCCCCAGCTCCCATAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGTTAGGACCAGCCCTGGGTTTGCCTAGTGCTGCCCCAGCTCCCATAA  550

seq1  GCACCTCTGTGGCAATGCCACTTTAGTGATCCTCCTTAGCAAAGGCACTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACCTCTGTGGCAATGCCACTTTAGTGATCCTCCTTAGCAAAGGCACTT  600

seq1  GGTATAAATTATTTCTGACACTCACCCCTGCTGTCACATCACTGCCCCTA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTATAAATTATTTCTGACACTCACCCCTGCTGTCACATCACTGCCCCTA  650

seq1  GAAAAGGCAGAGGACTATCCGAAGCTTGCATTCCCCTCTGGCGTGATAGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAAGGCAGAGGACTATCCGAAGCTTGCATTCCCCTCTGGCGTGATAGG  700

seq1  CCCTACCTTGAGCCAAGGAGGCAGAGCTGTGTGACCAGGTGATGTATGGA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTACCTTGAGCCAAGGAGGCAGAGCTGTGTGACCAGGTGATGTATGGA  750

seq1  GTCTGAGACT-CCTAAGCCTTCACCTAGCATAGGCCCTGTCTCAGTTGAT  799
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  GTCTGAGACTCCCTAAGCCTTCACCTAGCATAGGCCCTGTCTCAGTTGAT  800

seq1  CCAGGGCTTAGTGAGCCTGGATGGGGCATCACAG-AGAATAAA-CCCATT  847
      |||||||||| ||||||||||||||||||||||| |||||||| ||||||
seq2  CCAGGGCTTAATGAGCCTGGATGGGGCATCACAGAAGAATAAACCCCATT  850

seq1  GGCAGTGCCTGTCGCACACAAAG-ACCCTGACGGCAG-CACAGCAGCAGA  895
      ||||||||||||||||||||||| ||||||||||||| | ||||| || |
seq2  GGCAGTGCCTGTCGCACACAAAGAACCCTGACGGCAGTCTCAGCATCATA  900

seq1  GCTGTAGC-TGGCAGTGAGTG-CAGCACGAGGAAGC-TGCAGAGGCG-TT  941
      |||||||| |||||||||||| || ||||||||||| |||  | ||| ||
seq2  GCTGTAGCTTGGCAGTGAGTGTCATCACGAGGAAGCTTGCTAAAGCGTTT  950

seq1  CTGC-TTCTGTCACCCCAGAAGG-CCAAGTGCATAGAAGCCAGCCATACA  989
      |||| || |||||||||||| || | | ||||||   |||||||||||||
seq2  CTGCTTTTTGTCACCCCAGATGGTCTAGGTGCATTAGAGCCAGCCATACA  1000

seq1  C-TGGTTCC-TTCTCCACAGG-ACAAAGAACGT  1019
      | ||||||| ||||||||||| ||| |||||||
seq2  CTTGGTTCCTTTCTCCACAGGAACATAGAACGT  1033

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information