MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-217A18
Chromosome	4 (Build37)
Map Location	107,045,206 - 107,168,938
singlet/doublet	doublet
Overlap gene	Tmem48, Glis1
Upstream gene	Usp24, LOC100039616, Pcsk9, Bsnd, Tmem61, Dhcr24, BC055111, Ttc22, Pars2, Ttc4, Gm1027, BC026682, Acot11, Ssbp3, Mrpl37, 2810410C14Rik, Cdcp2, 2210012G02Rik, Tmem59, LOC546840, Lrrc42, 2900042B11Rik, Dio1, Yipf1, LOC652920
Downstream gene	Dmrtb1, LOC100039889, LOC433743, 4933424M12Rik, 4930430J20Rik, Magoh, 0610037L13Rik, Cpt2, Slc1a7, Podn, Scp2, Echdc2, Zyg11a, Zyg11b, LOC100040252, 2010305A19Rik, LOC545667, Gpx7, LOC665728, Zcchc11, LOC100040110
Link	Open Mouse BAC browser

Click to get alignment info.

name	Usp24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329908 MGI:1919936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 166 ESTs, 2 Proteins

name	LOC100039616 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 100 ESTs, 1 Protein

name	Pcsk9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100102 MGI:2140260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bsnd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140475 MGI:2153465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem61 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329909 MGI:3041156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein

name	Dhcr24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74754 MGI:1922004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC055111 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242602 MGI:2681853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttc22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230576 MGI:3045307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pars2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230577 MGI:2386296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ttc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72354 MGI:1919604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1027 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381538 MGI:2685873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein

name	BC026682 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230579 MGI:2657115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acot11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329910 MGI:1913736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssbp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72475 MGI:1919725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mrpl37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56280 MGI:1926268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810410C14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230582 MGI:1919657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdcp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242603 MGI:3045328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210012G02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66526 MGI:1913776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem59 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56374 MGI:1929278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546840 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc42 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77809 MGI:1925059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2900042B11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72938 MGI:1920188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dio1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13370 MGI:94896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Yipf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230584 MGI:1915532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC652920 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:652920
definition	note : replication factor C (activator 1) 5 pseudogene pseudo : _no_value

name	Tmem48 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72787 MGI:1920037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glis1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230587 MGI:2386723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dmrtb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56296 MGI:1927125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 31 ESTs, 2 Proteins

name	LOC100039889 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC433743 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 61 ESTs, 6 Proteins

name	4933424M12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67548 MGI:1914798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	4930430J20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78109 MGI:1925359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Magoh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17149 MGI:1330312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610037L13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74098 MGI:1921348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12896 MGI:109176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc1a7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242607 MGI:2444087
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Podn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242608 MGI:2674939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20280 MGI:98254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Echdc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52430 MGI:1289238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zyg11a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230590 MGI:2446208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 2 Proteins

name	Zyg11b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:414872 MGI:2685277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040252 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	2010305A19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69893 MGI:1917143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545667 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	Gpx7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67305 MGI:1914555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665728 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Zcchc11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230594 MGI:2445126
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040110 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Usp24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252835 GeneID:329908 MGI:1919936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 166 ESTs, 2 Proteins product : ubiquitin specific peptidase 24 transcript_id : XM_001481281.1

name	LOC100039616 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252812 GeneID:100039616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 100 ESTs, 1 Protein product : similar to Usp24 protein transcript_id : XM_001473472.1

name	Pcsk9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956351 GeneID:100102 MGI:2140260
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proprotein convertase subtilisin/kexin type 9 transcript_id : NM_153565.1

name	Bsnd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91598893 GeneID:140475 MGI:2153465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bartter syndrome, infantile, with sensorineural deafness (Barttin) transcript_id : NM_080458.2

name	Tmem61 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252837 GeneID:329909 MGI:3041156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : transmembrane protein 61 transcript_id : XM_001474114.1

name	Dhcr24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114155128 GeneID:74754 MGI:1922004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 24-dehydrocholesterol reductase transcript_id : NM_053272.2

name	BC055111 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801289 GeneID:242602 MGI:2681853
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC055111 transcript_id : NM_183182.2

name	Ttc22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377354 GeneID:230576 MGI:3045307
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetratricopeptide repeat domain 22 transcript_id : NM_177667.3

name	Pars2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948346 GeneID:230577 MGI:2386296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolyl-tRNA synthetase (mitochondrial)(putative) transcript_id : NM_172272.2

name	Pars2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948913 GeneID:230577 MGI:2386296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolyl-tRNA synthetase (mitochondrial)(putative) transcript_id : NM_001083887.1

name	Ttc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794387 GeneID:72354 MGI:1919604
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetratricopeptide repeat domain 4 transcript_id : NM_028209.1

name	Gm1027 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372168 GeneID:381538 MGI:2685873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein product : gene model 1027, (NCBI) transcript_id : XM_978122.1

name	BC026682 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165387 GeneID:230579 MGI:2657115
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC026682 transcript_id : NM_146149.1

name	Acot11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543862 GeneID:329910 MGI:1913736
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA thioesterase 11 transcript_id : NM_025590.3

name	Ssbp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38372896 GeneID:72475 MGI:1919725
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : single-stranded DNA binding protein 3 transcript_id : NM_023672.2

name	Ssbp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38372898 GeneID:72475 MGI:1919725
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : single-stranded DNA binding protein 3 transcript_id : NM_198438.1

name	Mrpl37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128624 GeneID:56280 MGI:1926268
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L37 transcript_id : NM_025500.1

name	2810410C14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341983 GeneID:230582 MGI:1919657
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810410C14 gene transcript_id : NM_175471.2

name	Cdcp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802087 GeneID:242603 MGI:3045328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CUB domain containing protein 2 transcript_id : NM_172873.3

name	2210012G02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723248 GeneID:66526 MGI:1913776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210012G02 gene transcript_id : NM_025617.2

name	Tmem59 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981330 GeneID:56374 MGI:1929278
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 59 transcript_id : NM_029565.2

name	LOC546840 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:124486898 GeneID:546840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : similar to low density lipoprotein receptor A domain containing 1 transcript_id : NM_001081272.1

name	Lrrc42 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872223 GeneID:77809 MGI:1925059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 42 transcript_id : NM_029985.2

name	2900042B11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368205 GeneID:72938 MGI:1920188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900042B11 gene transcript_id : NM_028394.2

name	Dio1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110825975 GeneID:13370 MGI:94896
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deiodinase, iodothyronine, type I transcript_id : NM_007860.3

name	Yipf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379932 GeneID:230584 MGI:1915532
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Yip1 domain family, member 1 transcript_id : NM_145550.2

name	Tmem48 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345807 GeneID:72787 MGI:1920037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 48 transcript_id : NM_028355.3

name	Glis1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124377992 GeneID:230587 MGI:2386723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GLIS family zinc finger 1 transcript_id : NM_147221.2

name	Dmrtb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252820 GeneID:56296 MGI:1927125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 31 ESTs, 2 Proteins product : DMRT-like family B with proline-rich C-terminal, 1 transcript_id : XM_205469.7

name	LOC100039889 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252822 GeneID:100039889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100039889 transcript_id : XM_001474196.1

name	LOC433743 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252840 GeneID:433743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 61 ESTs, 6 Proteins product : similar to translocase of outer mitochondrial membrane 22 homolog transcript_id : XM_485426.5

name	4933424M12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252824 GeneID:67548 MGI:1914798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 4933424M12 gene transcript_id : XM_001474219.1

name	4930430J20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252827 GeneID:78109 MGI:1925359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4930430J20 gene transcript_id : XM_001474455.1

name	Magoh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130124 GeneID:17149 MGI:1330312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mago-nashi homolog, proliferation-associated (Drosophila) transcript_id : NM_010760.2

name	0610037L13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130504 GeneID:74098 MGI:1921348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610037L13 gene transcript_id : NM_028754.2

name	Cpt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753513 GeneID:12896 MGI:109176
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carnitine palmitoyltransferase 2 transcript_id : NM_009949.1

name	Slc1a7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122844 GeneID:242607 MGI:2444087
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 1 (glutamate transporter), member 7 transcript_id : NM_146255.1

name	Podn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32526860 GeneID:242608 MGI:2674939
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : podocan transcript_id : NM_172874.2

name	Scp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373930 GeneID:20280 MGI:98254
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sterol carrier protein 2, liver transcript_id : NM_011327.2

name	Echdc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349919 GeneID:52430 MGI:1289238
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enoyl Coenzyme A hydratase domain containing 2 transcript_id : NM_026728.2

name	Zyg11a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252841 GeneID:230590 MGI:2446208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 2 Proteins product : zyg-11 homolog A (C. elegans) transcript_id : XM_131619.6

name	Zyg11b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354695 GeneID:414872 MGI:2685277
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zyg-ll homolog B (C. elegans) transcript_id : NM_001033634.2

name	2010305A19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371762 GeneID:69893 MGI:1917143
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010305A19 gene transcript_id : NM_027250.3

name	LOC545667 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252832 GeneID:545667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : hypothetical LOC545667 transcript_id : XM_620088.4

name	Gpx7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366038 GeneID:67305 MGI:1914555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione peroxidase 7 transcript_id : NM_024198.3

name	Zcchc11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83977460 GeneID:230594 MGI:2445126
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCHC domain containing 11 transcript_id : NM_175472.3

name	Usp24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252836 GeneID:329908 MGI:1919936
definition	codon_start : 1 exception : unclassified translation discrepancy note : overriding stop codons product : similar to ubiquitin specific protease 24 protein_id : XP_001481331.1 transl_except : (pos:106036879..106036881,aa:OTHER) transl_except : (pos:106036897..106036899,aa:OTHER) transl_except : (pos:106036948..106036950,aa:OTHER) transl_except : (pos:106040711..106040713,aa:OTHER) transl_except : (pos:106041344..106041346,aa:OTHER) transl_except : (pos:106041362..106041364,aa:OTHER) transl_except : (pos:106041374..106041376,aa:OTHER) transl_except : (pos:106041434..106041436,aa:OTHER) transl_except : (pos:106041443..106041445,aa:OTHER) transl_except : (pos:106042678..106042680,aa:OTHER) transl_except : (pos:106042690..106042692,aa:OTHER) transl_except : (pos:106042771..106042773,aa:OTHER) transl_except : (pos:106042795..106042797,aa:OTHER) transl_except : (pos:106043668..106043670,aa:OTHER) transl_except : (pos:106043695..106043697,aa:OTHER) transl_except : (pos:106045326..106045328,aa:OTHER) transl_except : (pos:106045347..106045349,aa:OTHER) transl_except : (pos:106046268..106046270,aa:OTHER) transl_except : (pos:106046286..106046288,aa:OTHER) transl_except : (pos:106046358..106046360,aa:OTHER) transl_except : (pos:106046364..106046366,aa:OTHER) transl_except : (pos:106046385..106046387,aa:OTHER) transl_except : (pos:106046397..106046399,aa:OTHER) transl_except : (pos:106046645..106046647,aa:OTHER) transl_except : (pos:106048283..106048285,aa:OTHER) transl_except : (pos:106048295..106048297,aa:OTHER) transl_except : (pos:106048340..106048342,aa:OTHER) transl_except : (pos:106049948..106049950,aa:OTHER) transl_except : (pos:106049951..106049953,aa:OTHER) transl_except : (pos:106049987..106049989,aa:OTHER) transl_except : (pos:106049996..106049998,aa:OTHER) transl_except : (pos:106050175..106050177,aa:OTHER) transl_except : (pos:106050220..106050222,aa:OTHER) transl_except : (pos:106051663..106051665,aa:OTHER) transl_except : (pos:106051684..106051686,aa:OTHER) transl_except : (pos:106051835..106051837,aa:OTHER) transl_except : (pos:106051841..106051843,aa:OTHER) transl_except : (pos:106051901..106051903,aa:OTHER) transl_except : (pos:106052696..106052698,aa:OTHER) transl_except : (pos:106053035..106053037,aa:OTHER) transl_except : (pos:106053065..106053067,aa:OTHER) transl_except : (pos:106053116..106053118,aa:OTHER) transl_except : (pos:106058032..106058034,aa:OTHER) transl_except : (pos:106058122..106058124,aa:OTHER) transl_except : (pos:106060092..106060094,aa:OTHER) transl_except : (pos:106060330..106060332,aa:OTHER) transl_except : (pos:106060357..106060359,aa:OTHER) transl_except : (pos:106061137..106061139,aa:OTHER) transl_except : (pos:106061149..106061151,aa:OTHER) transl_except : (pos:106062891..106062893,aa:OTHER) transl_except : (pos:106069865..106069867,aa:OTHER) transl_except : (pos:106069916..106069918,aa:OTHER) transl_except : (pos:106071702..106071704,aa:OTHER) transl_except : (pos:106071711..106071713,aa:OTHER) transl_except : (pos:106073594..106073596,aa:OTHER) transl_except : (pos:106074654..106074656,aa:OTHER) transl_except : (pos:106074669..106074671,aa:OTHER) transl_except : (pos:106074705..106074707,aa:OTHER) transl_except : (pos:106076540..106076542,aa:OTHER) transl_except : (pos:106076573..106076575,aa:OTHER) transl_except : (pos:106076579..106076581,aa:OTHER) transl_except : (pos:106079042..106079044,aa:OTHER) transl_except : (pos:106079069..106079071,aa:OTHER) transl_except : (pos:106079697..106079699,aa:OTHER) transl_except : (pos:106080573..106080575,aa:OTHER) transl_except : (pos:106081924..106081926,aa:OTHER) transl_except : (pos:106081987..106081989,aa:OTHER) transl_except : (pos:106082220..106082222,aa:OTHER) transl_except : (pos:106082226..106082228,aa:OTHER) transl_except : (pos:106082265..106082267,aa:OTHER) transl_except : (pos:106082274..106082276,aa:OTHER) transl_except : (pos:106082277..106082279,aa:OTHER) transl_except : (pos:106082750..106082752,aa:OTHER) transl_except : (pos:106083448..106083450,aa:OTHER) transl_except : (pos:106084010..106084012,aa:OTHER) transl_except : (pos:106084019..106084021,aa:OTHER) transl_except : (pos:106084777..106084779,aa:OTHER) transl_except : (pos:106086212..106086214,aa:OTHER) transl_except : (pos:106086263..106086265,aa:OTHER) transl_except : (pos:106086272..106086274,aa:OTHER) transl_except : (pos:106086987..106086989,aa:OTHER) transl_except : (pos:106087020..106087022,aa:OTHER) transl_except : (pos:106088683..106088685,aa:OTHER) transl_except : (pos:106090820..106090822,aa:OTHER) transl_except : (pos:106090865..106090867,aa:OTHER) transl_except : (pos:106093040..106093042,aa:OTHER) transl_except : (pos:106093616..106093618,aa:OTHER) transl_except : (pos:106097985..106097987,aa:OTHER) transl_except : (pos:106098027..106098029,aa:OTHER) transl_except : (pos:106101100..106101102,aa:OTHER) transl_except : (pos:106101124..106101126,aa:OTHER) transl_except : (pos:106103152..106103154,aa:OTHER) transl_except : (pos:106103194..106103196,aa:OTHER) transl_except : (pos:106104222..106104224,aa:OTHER) transl_except : (pos:106109357..106109359,aa:OTHER) transl_except : (pos:106109378..106109380,aa:OTHER) transl_except : (pos:106111398..106111400,aa:OTHER) transl_except : (pos:106111401..106111403,aa:OTHER) transl_except : (pos:106111413..106111415,aa:OTHER)

name	LOC100039616 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252813 GeneID:100039616
definition	codon_start : 1 product : similar to Usp24 protein protein_id : XP_001473522.1

name	Pcsk9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956352 CCDS:CCDS18418.1 GeneID:100102 MGI:2140260
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0042802 - identical protein binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004289 - subtilase activity [Evidence IDA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0043086 - negative regulation of enzyme activity [Evidence IEA]; GO:0030182 - neuron differentiation [Evidence IDA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 note : convertase subtilisin; neural apoptosis regulated convertase 1 product : proprotein convertase subtilisin/kexin type 9 protein_id : NP_705793.1

name	Bsnd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91598894 CCDS:CCDS18419.1 GeneID:140475 MGI:2153465
definition	GO_component : GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0043234 - protein complex [Evidence IDA] GO_function : GO:0005254 - chloride channel activity [Evidence IDA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006873 - cell ion homeostasis [Evidence ISS]; GO:0030644 - chloride ion homeostasis [Evidence NAS]; GO:0030007 - potassium ion homeostasis [Evidence NAS]; GO:0007605 - sensory perception of sound [Evidence NAS] codon_start : 1 note : barttin product : Bartter syndrome, infantile, with sensorineural deafness (Barttin) protein_id : NP_536706.2

name	Tmem61 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252838 GeneID:329909 MGI:3041156
definition	codon_start : 1 product : similar to Transmembrane protein 61 protein_id : XP_001474164.1

name	Dhcr24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114155129 CCDS:CCDS18420.1 GeneID:74754 MGI:1922004
definition	GO_function : GO:0016628 - oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor [Evidence ISS] GO_process : GO:0042987 - amyloid precursor protein catabolism [Evidence IMP]; GO:0006695 - cholesterol biosynthesis [Evidence ISS] [Evidence IMP]; GO:0008203 - cholesterol metabolism [Evidence IMP]; GO:0006118 - electron transport [Evidence IEA]; GO:0030539 - male genitalia development [Evidence IMP]; GO:0016044 - membrane organization and biogenesis [Evidence IMP]; GO:0031639 - plasminogen activation [Evidence IMP]; GO:0008104 - protein localization [Evidence IMP]; GO:0043588 - skin development [Evidence ISS]; GO:0016125 - sterol metabolism [Evidence IMP]; GO:0009888 - tissue development [Evidence IMP] codon_start : 1 note : seladin-1; 3-beta-hydroxysterol delta-24 reductase product : 24-dehydrocholesterol reductase precursor protein_id : NP_444502.2

name	BC055111 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147230 GeneID:242602 MGI:2681853
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC242602 protein_id : NP_899005.1

name	Ttc22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244092 CCDS:CCDS18422.1 GeneID:230576 MGI:3045307
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : tetratricopeptide repeat domain 22 protein_id : NP_808335.1

name	Pars2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948914 GeneID:230577 MGI:2386296
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0004820 - glycine-tRNA ligase activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004827 - proline-tRNA ligase activity [Evidence IEA] GO_process : GO:0006426 - glycyl-tRNA aminoacylation [Evidence IEA]; GO:0006433 - prolyl-tRNA aminoacylation [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006418 - tRNA aminoacylation for protein translation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; class II tRNA synthetase product : prolyl-tRNA synthetase (mitochondrial)(putative) isoform 2 protein_id : NP_001077356.1

name	Pars2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948347 CCDS:CCDS18423.1 GeneID:230577 MGI:2386296
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0004820 - glycine-tRNA ligase activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004827 - proline-tRNA ligase activity [Evidence IEA] GO_process : GO:0006426 - glycyl-tRNA aminoacylation [Evidence IEA]; GO:0006433 - prolyl-tRNA aminoacylation [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006418 - tRNA aminoacylation for protein translation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; class II tRNA synthetase product : prolyl-tRNA synthetase (mitochondrial)(putative) isoform 1 protein_id : NP_758476.2

name	Ttc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794388 CCDS:CCDS18424.1 GeneID:72354 MGI:1919604
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : tetratricopeptide repeat domain 4 protein_id : NP_082485.1

name	Gm1027 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94372169 GeneID:381538 MGI:2685873
definition	codon_start : 1 product : hypothetical protein protein_id : XP_983216.1

name	BC026682 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165388 CCDS:CCDS18425.1 GeneID:230579 MGI:2657115
definition	codon_start : 1 product : hypothetical protein LOC230579 protein_id : NP_666261.1

name	Acot11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165404 CCDS:CCDS18426.1 GeneID:329910 MGI:1913736
definition	GO_component : GO:0005737 - cytoplasm [Evidence IC] GO_function : GO:0016291 - acyl-CoA thioesterase activity [Evidence TAS]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence NAS]; GO:0007242 - intracellular signaling cascade [Evidence NAS]; GO:0009266 - response to temperature stimulus [Evidence IEP] codon_start : 1 product : thioesterase, adipose associated protein_id : NP_079866.2

name	Ssbp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38372897 CCDS:CCDS18427.1 GeneID:72475 MGI:1919725
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003697 - single-stranded DNA binding [Evidence ISS] [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; Lck-associated signal transducer product : single-stranded DNA-binding protein isoform a protein_id : NP_076161.2

name	Ssbp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38372899 CCDS:CCDS18428.1 GeneID:72475 MGI:1919725
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003697 - single-stranded DNA binding [Evidence ISS] [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; Lck-associated signal transducer product : single-stranded DNA-binding protein isoform b protein_id : NP_940840.1

name	Mrpl37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128625 CCDS:CCDS18429.1 GeneID:56280 MGI:1926268
definition	GO_component : GO:0005761 - mitochondrial ribosome [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 note : ribosomal protein, mitochondrial, L2 product : mitochondrial ribosomal protein L37 protein_id : NP_079776.1

name	2810410C14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425208 GeneID:230582 MGI:1919657
definition	GO_function : GO:0004128 - cytochrome-b5 reductase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC230582 protein_id : NP_780680.1

name	Cdcp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370326 CCDS:CCDS18430.1 GeneID:242603 MGI:3045328
definition	codon_start : 1 product : CUB domain containing protein 2 protein_id : NP_766461.1

name	2210012G02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385072 CCDS:CCDS18431.1 GeneID:66526 MGI:1913776
definition	GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66526 protein_id : NP_079893.1

name	Tmem59 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981331 CCDS:CCDS18432.1 GeneID:56374 MGI:1929278
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : thymic dendritic cell-derived factor 1 protein_id : NP_083841.3

name	LOC546840 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:124486899 GeneID:546840
definition	codon_start : 1 product : similar to low density lipoprotein receptor A domain containing 1 protein_id : NP_001074741.1

name	Lrrc42 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859742 CCDS:CCDS18434.1 GeneID:77809 MGI:1925059
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 42 protein_id : NP_084261.1

name	2900042B11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625938 CCDS:CCDS18435.1 GeneID:72938 MGI:1920188
definition	GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : hypothetical protein LOC72938 protein_id : NP_082670.1

name	Dio1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110825976 CCDS:CCDS18436.1 GeneID:13370 MGI:94896
definition	EC_number : 1.97.1.10 GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008430 - selenium binding [Evidence IEA]; GO:0004800 - thyroxine 5'-deiodinase activity [Evidence IEA] GO_process : GO:0042446 - hormone biosynthesis [Evidence IEA] codon_start : 1 product : deiodinase, iodothyronine, type I protein_id : NP_031886.3 transl_except : (pos:complement(106970305..106970307),aa:Sec)

name	Yipf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704084 CCDS:CCDS18437.1 GeneID:230584 MGI:1915532
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : Yip1 domain family, member 1 protein_id : NP_663525.1

name	Tmem48 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077005 CCDS:CCDS18438.1 GeneID:72787 MGI:1920037
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : transmembrane protein 48 protein_id : NP_082631.1

name	Glis1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124377993 GeneID:230587 MGI:2386723
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003704 - specific RNA polymerase II transcription factor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Glis1 Kruppel-like zinc finger protein; GLI-Kruppel family member GLI6; zinc finger transcription factor Gli5 product : GLIS family zinc finger 1 protein_id : NP_671754.2

name	Dmrtb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252821 GeneID:56296 MGI:1927125
definition	codon_start : 1 product : DMRT-like family B with proline-rich C-terminal, 1 protein_id : XP_205469.7

name	LOC100039889 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252823 GeneID:100039889
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474246.1

name	LOC433743 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82894454 GeneID:433743
definition	codon_start : 1 product : hypothetical protein protein_id : XP_485426.3

name	4933424M12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252825 GeneID:67548 MGI:1914798
definition	codon_start : 1 product : hypothetical protein LOC67548 protein_id : XP_001474269.1

name	4930430J20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252828 GeneID:78109 MGI:1925359
definition	codon_start : 1 product : hypothetical protein LOC78109 protein_id : XP_001474505.1

name	Magoh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754616 CCDS:CCDS18441.1 GeneID:17149 MGI:1330312
definition	GO_component : GO:0005634 - nucleus [Evidence NAS] GO_function : GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0007292 - female gamete generation [Evidence NAS]; GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : mago-nashi homolog, proliferation-associated protein_id : NP_034890.1

name	0610037L13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539639 CCDS:CCDS18442.1 GeneID:74098 MGI:1921348
definition	codon_start : 1 product : hypothetical protein LOC74098 protein_id : NP_083030.1

name	Cpt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753514 CCDS:CCDS18443.1 GeneID:12896 MGI:109176
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004095 - carnitine O-palmitoyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : CPT II product : carnitine palmitoyltransferase 2 protein_id : NP_034079.1

name	Slc1a7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122845 CCDS:CCDS18444.1 GeneID:242607 MGI:2444087
definition	GO_function : GO:0017153 - sodium:dicarboxylate symporter activity [Evidence IEA] codon_start : 1 product : solute carrier family 1 (glutamate transporter), member 7 protein_id : NP_666367.1

name	Podn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32526861 CCDS:CCDS18445.1 GeneID:242608 MGI:2674939
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : podocan protein_id : NP_766462.2

name	Scp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45476581 CCDS:CCDS18446.1 GeneID:20280 MGI:98254
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005777 - peroxisome [Evidence TAS] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005498 - sterol carrier activity [Evidence IEA]; GO:0004770 - sterol carrier protein X-related thiolase activity [Evidence TAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006637 - acyl-CoA metabolism [Evidence TAS]; GO:0006869 - lipid transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0007031 - peroxisome organization and biogenesis [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : nonspecific lipid transfer protein product : sterol carrier protein 2, liver protein_id : NP_035457.1

name	Echdc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312020 CCDS:CCDS18447.1 GeneID:52430 MGI:1289238
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : enoyl Coenzyme A hydratase domain containing 2 protein_id : NP_081004.1

name	Zyg11a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252842 GeneID:230590 MGI:2446208
definition	codon_start : 1 product : hypothetical protein protein_id : XP_131619.5

name	Zyg11b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702061 CCDS:CCDS18448.1 GeneID:414872 MGI:2685277
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zyg-ll homolog B protein_id : NP_001028806.1

name	2010305A19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076933 CCDS:CCDS18449.1 GeneID:69893 MGI:1917143
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69893 protein_id : NP_081526.1

name	LOC545667 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252833 GeneID:545667
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620088.4

name	Gpx7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195626 CCDS:CCDS18450.1 GeneID:67305 MGI:1914555
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006979 - response to oxidative stress [Evidence IEA] codon_start : 1 product : glutathione peroxidase 7 protein_id : NP_077160.1

name	Zcchc11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83977461 CCDS:CCDS18451.1 GeneID:230594 MGI:2445126
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] codon_start : 1 product : zinc finger, CCHC domain containing 11 protein_id : NP_780681.2

name	LOC100040252 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040252
definition	number : 3 pseudo : _no_value

name	LOC100040252 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040252
definition	number : 2 pseudo : _no_value

name	LOC100040252 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040252
definition	number : 1 pseudo : _no_value

name	LOC665728 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665728
definition	number : 1 pseudo : _no_value

name	LOC100040110 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040110
definition	number : 1 pseudo : _no_value

clone name	MSMg01-538P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066B08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-217A18.b	B6Ng01-217A18.g
ACC	GA033573	GA033574
length	961	882
definition	B6Ng01-217A18.b	B6Ng01-217A18.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(107,045,206 - 107,046,151)	(107,168,066 - 107,168,938)
sequence	gaattcactctgtagaccaggctggcttcaaagtcagtgaaacttgactt tgaataaataatactcaaattatttatttgagtttgcctctgcctcctga gtgctgggattaaaggcgttcactcttgtttttaaagcctcactggtcac ttggctcgttctgtaggagtaggccctatgtgccgtgcactgggcaggtc tgagggagcacagagggccatctttgacccagtgtggaggctgcctagag gagctgatggctcatcagactttgaaggaggagttgtgttaggcagacaa agaagagaaatgatttttctaggaagatggagcttgaaagaacattgaga gacatggcagggtttgccacgttaggaagttagtcacataattggctttg gggacatttttgatggggaagaggaggtgttagccacatctttcctaaaa tgccaagccccctgttgcccacactgccatggcttttccttgggtgacct aaaggaaggttattacctgctgtgtcagggagcccagggctgccggggct caggcacaaacgccctttaccctttcccacagctgtccaccacgccactt ccaaagagctctttggattgttggagaggtcctaaaactacctgtgtagg agcgagtatggaggctcagtgggttacagagaaccagctctaacctctgc acatacctcactgcaaacaaatgactggatgtaatgaaaatgcctattca gagttgggtgtagtggcgcacatgtccgtgatagcgctataaacactttg atatttcatttattgttaagtttcgtccttgttgcttatttttcacagat gggactctttaatgaatcttcaaatgttgaaattaaaggcaatttgggag ctatccttctaaaattatttattttatgttacttaagaaaaaacgtcaga gttgggcattt	gaattcccaaatacaatgctttcttttgtgtggctgtggtcatgatgttt tgccacagcaatagaaaagtaactaagatgcctgccaagcactttattaa ccagccaagcattgtttgaggacaagtcggcaggacagggtggatgctgc aagatgaggtcaaagggcacaatgaaaggcatggttactgtcaccactgc aagcaagtagttacaaaccactgcagtgtggctcacactgcaagggtttg tgagtgactagactcggccccagagaagctaagatggaggagggaaaact aaacaagacattacagggaacttacccaagtgagcatgatgctggcccgg ccaagtcatacccctgccctcattgtcaaggtagagccaacaaatcttca gggtgagtcagatgtaaggcatagaagagcaaagacaaggccatgaggga atagcaggaacagagagacagggctagggcgcctggcagcttgattagga atgagttaggctagagatatttgctagagaagtctgtagttcagaggtga ggccaaaggaggaaaaaacaaattggcgattaagcaaattatatgtaaag atgagtgtatgacaaagatccttaggaggggccttgtagacaaggacggc agccgtgcagcctgtgaccctgtgaaaaagaggctgaagagtaggcagtg ggggaaagagatgctacccacggagagggaaacgatgtgtcctgaacaca aaccaatttagttgtgtcaagagccctgggtgtgatcaacttgagcctct gctggtgagaagttcgtgtacgattgaggcccttcatttctggtgacacg ctcaaggacaggagcctggccagaaccaactt
quality values	Open. Hide. 31 17 34 35 58 25 23 54 58 58 58 58 54 54 62 47 46 27 31 62 62 62 62 62 62 62 62 62 41 30 32 31 27 22 51 15 35 38 32 24 32 32 32 32 45 46 35 43 62 62 62 62 35 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 59 62 62 51 51 50 43 36 56 59 56 42 42 43 54 62 62 62 62 62 62 62 62 62 54 59 59 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 49 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 56 62 62 56 62 56 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 54 62 56 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 54 62 62 62 62 62 52 54 40 58 54 35 54 52 52 54 58 54 58 58 58 58 58 58 46 52 52 46 52 52 54 52 52 54 41 54 42 52 48 58 54 54 58 58 37 37 45 42 58 52 58 58 37 54 54 58 52 34 40 36 44 54 58 54 54 58 58 42 58 58 54 54 47 35 58 54 41 45 46 54 58 50 58 50 58 35 51 58 40 49 51 52 50 50 53 40 42 51 51 58 37 51 50 37 37 51 58 30 45 37 50 28 50 46 53 58 38 48 50 49 37 53 50 40 37 42 43 42 50 41 33 32 32 50 30 58 23 51 46 22 53 39 34 46 58 53 39 32 50 48 35 46 53 33 50 36 37 40 40 50 40 49 29 32 37 41 40 50 41 39 31 58 54 49 32 58 41 42 53 34 27 39 58 53 34 22 52 31 58 35 39 52 53 54 54 40 41 52 37 22 33 40 28 29 42 22 39 38 26 19 21 50 51 50 35 51 29 33 37 37 54 24 35 37 41 26 41 32 28 52 33 32 54 30 30 34 41 22 18 26 41 35 37 52 35 45 42 53 40 31 14 24 10 45 31 45 40 31 32 8 52 11 33 22 6 31 19 31 18 23 27 9 15 53 40 41 33 52 35 53 24 14 13 14 47 38 12 6 7 34 16 47 32 11 7 46 46 26 28 23 23 18 14 32 34 30 16 45 19 26 16 21 11 7 32 33 18 30 30 26 27 31 27 11 6 18 36 25 51 35 24 37 18 28 30 32 46 31 24 8 8 41 26 29 30 31 30 26 31 42 27 19 40 15 25 14 42 25 16 20 12 11 23 27 42 17 11 46 46 34 27 31 27 24 31 16 27 22 21 31 15 14 16 36 23 21 14 33 25 31 7 16 8 28 23 33 38 39 28 30 23 14 37 20 18 17 6 19 31 21 30 26 22 6 7 7 6	Open. Hide. 62 47 39 42 62 62 62 47 42 47 62 26 22 34 17 22 22 28 27 32 28 32 32 45 56 59 59 59 59 59 62 62 59 59 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 34 49 43 36 50 46 34 54 54 54 62 56 56 56 62 62 59 62 62 56 59 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 59 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 59 62 56 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 51 62 62 62 62 59 62 62 62 59 51 59 56 24 56 56 56 62 56 56 56 51 62 51 49 56 56 62 56 62 56 54 62 62 54 47 47 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 51 62 47 62 62 47 56 62 62 62 62 62 62 62 62 62 54 62 56 62 62 62 62 62 56 56 56 62 62 62 62 47 47 54 62 47 62 62 41 47 62 62 62 62 62 62 47 62 62 62 62 47 62 62 62 56 62 54 62 62 62 62 62 56 43 62 50 62 62 42 52 54 47 49 62 62 52 62 62 52 52 42 62 42 41 39 62 54 31 47 42 47 42 43 43 35 54 54 43 54 62 52 52 52 52 49 49 50 54 39 45 54 58 48 47 47 54 39 45 39 54 46 54 52 48 54 41 54 54 58 49 58 58 54 20 58 58 54 54 40 58 58 52 54 54 24 31 29 41 52 27 50 33 54 46 43 39 41 42 37 34 24 13 34 36 15 54 52 42 29 34 16 18 41 34 33 19 37 38 37 42 33 48 45 39 39 50 38 50 37 37 50 41 51 51 50 40 27 35 50 46 50 33 22 39 20 52 50 50 50 40 50 51 58 58 58 49 17 58 13 32 32 53 50 44 42 34 49 12 29 29 16 35 37 25 31 30 42 50 44 42 44 43 50 41 26 35 20 18 13 43 50 53 26 30 58 22 15 16 9 10 15 13 33 17 40 40 30 36 31 25 13 39 32 37 37 32 33 33 37 49 49 31 22 24 14 18 18 28 18 24 10 12 9 9 9 18 27 18 13 8 32 49 35 22 39 10 22 27 42 37 33 45 8 14 15 34 28 15 20 9 21 28 28 32 24 35 26 23 7 12 46 28 34 31 21 29 17 31 32 19 9 25 23 30 33 25 31 13 21 8 13 26 8 32 29 12 25 25 12 7 7 10 14 27 27 15 14 26 12 10 25 31 12 16 52 31 33 29 42 29 12 21 31 28 16 19 10 26 30 18 10 16 13 17 30 24 19 23 9 14 6 18 23 29 28 9 12 10 11 14 29 34 30 16 31 16 29 10 31

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_107045206_107046151
seq2: B6Ng01-217A18.b_48_1007

seq1  GAATTCACTCTGTAGACCAGGCTGGCTTCAAAGTCAGTGAAACTTGACTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTCTGTAGACCAGGCTGGCTTCAAAGTCAGTGAAACTTGACTT  50

seq1  TGAATAAATAATACTCAAATTATTTATTTGAGTTTGCCTCTGCCTCCTGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATAAATAATACTCAAATTATTTATTTGAGTTTGCCTCTGCCTCCTGA  100

seq1  GTGCTGGGATTAAAGGCGTTCACTCTTGTTTTTAAAGCCTCACTGGTCAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTGGGATTAAAGGCGTTCACTCTTGTTTTTAAAGCCTCACTGGTCAC  150

seq1  TTGGCTCGTTCTGTAGGAGTAGGCCCTATGTGCCGTGCACTGGGCAGGTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGCTCGTTCTGTAGGAGTAGGCCCTATGTGCCGTGCACTGGGCAGGTC  200

seq1  TGAGGGAGCACAGAGGGCCATCTTTGACCCAGTGTGGAGGCTGCCTAGAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGGAGCACAGAGGGCCATCTTTGACCCAGTGTGGAGGCTGCCTAGAG  250

seq1  GAGCTGATGGCTCATCAGACTTTGAAGGAGGAGTTGTGTTAGGCAGACAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCTGATGGCTCATCAGACTTTGAAGGAGGAGTTGTGTTAGGCAGACAA  300

seq1  AGAAGAGAAATGATTTTTCTAGGAAGATGGAGCTTGAAAGAACATTGAGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGAGAAATGATTTTTCTAGGAAGATGGAGCTTGAAAGAACATTGAGA  350

seq1  GACATGGCAGGGTTTGCCACGTTAGGAAGTTAGTCACATAATTGGCTTTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACATGGCAGGGTTTGCCACGTTAGGAAGTTAGTCACATAATTGGCTTTG  400

seq1  GGGACATTTTTGATGGGGAAGAGGAGGTGTTAGCCACATCTTTCCTAAAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGACATTTTTGATGGGGAAGAGGAGGTGTTAGCCACATCTTTCCTAAAA  450

seq1  TGCCAAGCCCCCTGTTGCCCACACTGCCATGGCTTTTCCTTGGGTGACCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCAAGCCCCCTGTTGCCCACACTGCCATGGCTTTTCCTTGGGTGACCT  500

seq1  AAAGGAAGGTTATTACCTGCTGTGTCAGGGAGCCCAGGGCTGCCGGGGCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGAAGGTTATTACCTGCTGTGTCAGGGAGCCCAGGGCTGCCGGGGCT  550

seq1  CAGGCACAAACGCCCTTTACCCTTTCCCACAGCTGTCCACCACGCCACTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCACAAACGCCCTTTACCCTTTCCCACAGCTGTCCACCACGCCACTT  600

seq1  CCAAAGAGCTCTTTGGATTGTTGGAGAGGTCCTAAAACTACCTGTGTAGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAAGAGCTCTTTGGATTGTTGGAGAGGTCCTAAAACTACCTGTGTAGG  650

seq1  AGCGAGTATGGAGGCTCAGTGGGTTACAGAGAACCAGCTCTAACCTCTGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCGAGTATGGAGGCTCAGTGGGTTACAGAGAACCAGCTCTAACCTCTGC  700

seq1  ACATACCTCACTGCAAACAAATGACTGGATGTAATGAAAATGCCTATTCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATACCTCACTGCAAACAAATGACTGGATGTAATGAAAATGCCTATTCA  750

seq1  GAGTTGGGTGTAGTGGCGCACATGTCCGTGATAGCGCTATAAACAC-TTG  799
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  GAGTTGGGTGTAGTGGCGCACATGTCCGTGATAGCGCTATAAACACTTTG  800

seq1  ATA-TTCA-TTATTG-TAAGTTTCGTCTTTGTGGCTTATTTTTCACAGAT  846
      ||| |||| |||||| ||||||||||| |||| |||||||||||||||||
seq2  ATATTTCATTTATTGTTAAGTTTCGTCCTTGTTGCTTATTTTTCACAGAT  850

seq1  -GGACTC-TTAATGAATC-TCAAATGTTGAAA-TAAAGGCAATTT-GGAG  891
       |||||| |||||||||| ||||||||||||| |||||||||||| ||||
seq2  GGGACTCTTTAATGAATCTTCAAATGTTGAAATTAAAGGCAATTTGGGAG  900

seq1  CTAT-CTTCT-AAATTATTTATTTTATGTTACTTA--GAAAAACGTCAGA  937
      |||| ||||| ||||||||||||||||||||||||   ||||||||||||
seq2  CTATCCTTCTAAAATTATTTATTTTATGTTACTTAAGAAAAAACGTCAGA  950

seq1  GTT-GGCATT  946
      ||| ||||||
seq2  GTTGGGCATT  960

seq1: chr4_107168066_107168938
seq2: B6Ng01-217A18.g_68_949 (reverse)

seq1  AAGTT-GTTCT-GCCAGGCTCCTGTCC-TGAGCGTGTCACCAG-AATGAA  46
      ||||| ||||| ||||||||||||||| ||||||||||||||| ||||||
seq2  AAGTTGGTTCTGGCCAGGCTCCTGTCCTTGAGCGTGTCACCAGAAATGAA  50

seq1  GGGCCCTCATCGTACACG-ACCTCTCACCAGCAGAGGCTC-AGTTGATCA  94
      |||||   |||||||||| || |||||||||||||||||| |||||||||
seq2  GGGCCTCAATCGTACACGAACTTCTCACCAGCAGAGGCTCAAGTTGATCA  100

seq1  CACCCA-GGCTCTTGACAC-ACTAATTTGGTTTGTGTTCAGGACACATCG  142
      |||||| |||||||||||| ||||| ||||||||||||||||||||||||
seq2  CACCCAGGGCTCTTGACACAACTAAATTGGTTTGTGTTCAGGACACATCG  150

seq1  TTTCCCTCTCCGT-GGTAGCATCTCTTTCCCCCACTGCCTACTCTTCAGC  191
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  TTTCCCTCTCCGTGGGTAGCATCTCTTTCCCCCACTGCCTACTCTTCAGC  200

seq1  CTCTTTTTCACAGGGTCACAGGCTGCACGGCTGCCGTCCTTGTCTACAAG  241
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTTTTCACAGGGTCACAGGCTGCACGGCTGCCGTCCTTGTCTACAAG  250

seq1  GCCCCTCCTAAGGATCTTTGTCATACACTCATCTTTACATATAATTTGCT  291
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCCTCCTAAGGATCTTTGTCATACACTCATCTTTACATATAATTTGCT  300

seq1  TAATCGCCAATTTGTTTTTTCCTCCTTTGGCCTCACCTCTGAACTACAGA  341
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATCGCCAATTTGTTTTTTCCTCCTTTGGCCTCACCTCTGAACTACAGA  350

seq1  CTTCTCTAGCAAATATCTCTAGCCTAACTCATTCCTAATCAAGCTGCCAG  391
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTCTAGCAAATATCTCTAGCCTAACTCATTCCTAATCAAGCTGCCAG  400

seq1  GCGCCCTAGCCCTGTCTCTCTGTTCCTGCTATTCCCTCATGGCCTTGTCT  441
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGCCCTAGCCCTGTCTCTCTGTTCCTGCTATTCCCTCATGGCCTTGTCT  450

seq1  TTGCTCTTCTATGCCTTACATCTGACTCACCCTGAAGATTTGTTGGCTCT  491
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTCTTCTATGCCTTACATCTGACTCACCCTGAAGATTTGTTGGCTCT  500

seq1  ACCTTGACAATGAGGGCAGGGGTATGACTTGGCCGGGCCAGCATCATGCT  541
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTTGACAATGAGGGCAGGGGTATGACTTGGCCGGGCCAGCATCATGCT  550

seq1  CACTTGGGTAAGTTCCCTGTAATGTCTTGTTTAGTTTTCCCTCCTCCATC  591
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTTGGGTAAGTTCCCTGTAATGTCTTGTTTAGTTTTCCCTCCTCCATC  600

seq1  TTAGCTTCTCTGGGGCCGAGTCTAGTCACTCACAAACCCTTGCAGTGTGA  641
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGCTTCTCTGGGGCCGAGTCTAGTCACTCACAAACCCTTGCAGTGTGA  650

seq1  GCCACACTGCAGTGGTTTGTAACTACTTGCTTGCAGTGGTGACAGTAACC  691
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCACACTGCAGTGGTTTGTAACTACTTGCTTGCAGTGGTGACAGTAACC  700

seq1  ATGCCTTTCATTGTGCCCTTTGACCTCATCTTGCAGCATCCACCCTGTCC  741
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCCTTTCATTGTGCCCTTTGACCTCATCTTGCAGCATCCACCCTGTCC  750

seq1  TGCCGACTTGTCCTCAAACAATGCTTGGCTGGTTAATAAAGTGCTTGGCA  791
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCGACTTGTCCTCAAACAATGCTTGGCTGGTTAATAAAGTGCTTGGCA  800

seq1  GGCATCTTAGTTACTTTTCTATTGCTGTGGCAAAACATCATGACCACAGC  841
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATCTTAGTTACTTTTCTATTGCTGTGGCAAAACATCATGACCACAGC  850

seq1  CACACAAAAGAAAGCATTGTATTTGGGAATTC  873
      ||||||||||||||||||||||||||||||||
seq2  CACACAAAAGAAAGCATTGTATTTGGGAATTC  882

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information