MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-224L20
Chromosome	4 (Build37)
Map Location	115,123,939 - 115,125,045
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC666048, Foxd2, LOC100040736, Foxe3, Cmpk, Stil, Tal1, Pdzk1ip1, Cyp4x1, Cyp4a21-ps, LOC384042, LOC230639, Cyp4a12, LOC546842, Cyp4a12b
Downstream gene	LOC435802, LOC666393, LOC230641, Cyp4a14, Cyp4a10, LOC666168, LOC631037, LOC100040843, Cyp4b1, LOC546843, 4732418C07Rik, 4930544O15Rik, Atpaf1, Mobkl2c, Mknk1, Kncn, 6430628N08Rik, Dmbx1, Faah, Nsun4, Uqcrh, Lrrc41, Rad54l, 1520402A15Rik, Pomgnt1, Tspan1, 1700042G07Rik, LOC433748, Pik3r3, Mast2, LOC631400
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC666048 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666048
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 1 Protein

name	Foxd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17301 MGI:1347471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040736 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040736
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Foxe3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30923 MGI:1353569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmpk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66588 MGI:1913838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stil (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20460 MGI:107477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tal1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21349 MGI:98480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdzk1ip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67182 MGI:1914432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp4x1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81906 MGI:1932403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp4a21-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547220 MGI:1932405
definition	gene_synonym : Cyp4a21; CYP_b; OTTMUSG00000008613 note : cytochrome P450, family 4, subfamily a, polypeptide 21, pseudogene pseudo : _no_value

name	LOC384042 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC230639 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:230639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 Proteins

name	Cyp4a12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277753 MGI:88612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546842 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	Cyp4a12b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13118 MGI:3611747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435802 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435802
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins

name	LOC666393 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666393
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC230641 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:230641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Cyp4a14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13119 MGI:1096550
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp4a10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13117 MGI:88611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666168 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 18 Proteins

name	LOC631037 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631037
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	LOC100040843 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040843
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs, 24 Proteins

name	Cyp4b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13120 MGI:103225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546843 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546843
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	4732418C07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230648 MGI:2442397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930544O15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75173 MGI:1922423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Atpaf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230649 MGI:2180560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mobkl2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100465 MGI:2140623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mknk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17346 MGI:894316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kncn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:654462 MGI:3614952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430628N08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76237 MGI:1923487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Dmbx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140477 MGI:2153518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Faah (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14073 MGI:109609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nsun4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72181 MGI:1919431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uqcrh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66576 MGI:1913826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230654 MGI:2441984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rad54l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19366 MGI:894697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1520402A15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68075 MGI:1915325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 3 Proteins

name	Pomgnt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68273 MGI:1915523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tspan1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66805 MGI:1914055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700042G07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67323 MGI:1914573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs

name	LOC433748 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 103 ESTs, 3 Proteins

name	Pik3r3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18710 MGI:109277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mast2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17776 MGI:894676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC631400 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631400
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 74 ESTs, 21 Proteins pseudo : _no_value

name	LOC666048 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372199 GeneID:666048
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 1 Protein product : similar to C05G5.5 transcript_id : XM_981216.1

name	Foxd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802595 GeneID:17301 MGI:1347471
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box D2 transcript_id : NM_008593.2

name	LOC100040736 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252861 GeneID:100040736
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100040736 transcript_id : XM_001475162.1

name	Foxe3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657097 GeneID:30923 MGI:1353569
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box E3 transcript_id : NM_015758.1

name	Cmpk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981245 GeneID:66588 MGI:1913838
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytidylate kinase transcript_id : NM_025647.2

name	Stil (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356051 GeneID:20460 MGI:107477
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Scl/Tal1 interrupting locus transcript_id : NM_009185.2

name	Tal1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892330 GeneID:21349 MGI:98480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell acute lymphocytic leukemia 1 transcript_id : NM_011527.2

name	Pdzk1ip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802816 GeneID:67182 MGI:1914432
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDZK1 interacting protein 1 transcript_id : NM_026018.2

name	Cyp4x1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51592064 GeneID:81906 MGI:1932403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily x, polypeptide 1 transcript_id : NM_001003947.1

name	LOC230639 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82894546 GeneID:230639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 Proteins product : similar to fatty acid omega-hydroxylase; CYP4A11 transcript_id : XM_144013.5

name	Cyp4a12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86198311 GeneID:277753 MGI:88612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily a, polypeptide 12 transcript_id : NM_177406.3

name	LOC546842 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82894548 GeneID:546842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : similar to cytochrome P450 transcript_id : XM_621635.2

name	Cyp4a12b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86198313 GeneID:13118 MGI:3611747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily a, polypeptide 12B transcript_id : NM_172306.2

name	LOC435802 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82894550 GeneID:435802
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins product : similar to cytochrome P450 transcript_id : XM_487818.2

name	Cyp4a14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681120 GeneID:13119 MGI:1096550
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily a, polypeptide 14 transcript_id : NM_007822.1

name	Cyp4a10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059034 GeneID:13117 MGI:88611
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily a, polypeptide 10 transcript_id : NM_010011.2

name	LOC666168 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252865 GeneID:666168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 18 Proteins product : similar to cytochrome P450, family 4, subfamily a, polypeptide 10 transcript_id : XM_001475399.1

name	LOC631037 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372204 GeneID:631037
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : similar to CYP4B1 transcript_id : XM_982144.1

name	LOC100040843 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252863 GeneID:100040843
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs, 24 Proteins product : similar to cytochrome P450, family 4, subfamily a, polypeptide 10 transcript_id : XM_001476115.1

name	Cyp4b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131158 GeneID:13120 MGI:103225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily b, polypeptide 1 transcript_id : NM_007823.2

name	4732418C07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254241 GeneID:230648 MGI:2442397
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732418C07 gene transcript_id : NM_172698.2

name	4930544O15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372208 GeneID:75173 MGI:1922423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4930544O15 gene transcript_id : XM_485433.4

name	Atpaf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341104 GeneID:230649 MGI:2180560
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP synthase mitochondrial F1 complex assembly factor 1 transcript_id : NM_181040.2

name	Mobkl2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370410 GeneID:100465 MGI:2140623
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MOB1, Mps One Binder kinase activator-like 2C (yeast) transcript_id : NM_175308.3

name	Mknk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371246 GeneID:17346 MGI:894316
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAP kinase-interacting serine/threonine kinase 1 transcript_id : NM_021461.3

name	Kncn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366723 GeneID:654462 MGI:3614952
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinocilin transcript_id : NM_001039124.2

name	6430628N08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372209 GeneID:76237 MGI:1923487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 6430628N08 gene transcript_id : XM_149458.3

name	Dmbx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909342 GeneID:140477 MGI:2153518
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diencephalon/mesencephalon homeobox 1 transcript_id : NM_130865.3

name	Dmbx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909348 GeneID:140477 MGI:2153518
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diencephalon/mesencephalon homeobox 1 transcript_id : NM_001025567.1

name	Faah (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348835 GeneID:14073 MGI:109609
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fatty acid amide hydrolase transcript_id : NM_010173.3

name	Nsun4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802973 GeneID:72181 MGI:1919431
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NOL1/NOP2/Sun domain family, member 4 transcript_id : NM_028142.2

name	Uqcrh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114051412 GeneID:66576 MGI:1913826
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquinol-cytochrome c reductase hinge protein transcript_id : NM_025641.3

name	Lrrc41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859776 GeneID:230654 MGI:2441984
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 41 transcript_id : NM_153521.1

name	Rad54l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982067 GeneID:19366 MGI:894697
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAD54 like (S. cerevisiae) transcript_id : NM_009015.2

name	1520402A15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372210 GeneID:68075 MGI:1915325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 3 Proteins product : RIKEN cDNA 1520402A15 gene transcript_id : XM_204182.3

name	Pomgnt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27777637 GeneID:68273 MGI:1915523
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase transcript_id : NM_029786.1

name	Pomgnt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22267451 GeneID:68273 MGI:1915523
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase transcript_id : NM_026651.1

name	Tspan1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384879 GeneID:66805 MGI:1914055
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 1 transcript_id : NM_133681.3

name	1700042G07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252867 GeneID:67323 MGI:1914573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs product : RIKEN cDNA 1700042G07 gene transcript_id : XM_001475594.1

name	LOC433748 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252869 GeneID:433748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 103 ESTs, 3 Proteins product : similar to 1190005P17Rik protein transcript_id : XM_905120.3

name	Pik3r3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130676 GeneID:18710 MGI:109277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 3 (p55) transcript_id : NM_181585.5

name	Mast2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112363077 GeneID:17776 MGI:894676
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule associated serine/threonine kinase 2 transcript_id : NM_008641.2

name	Mast2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112363073 GeneID:17776 MGI:894676
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule associated serine/threonine kinase 2 transcript_id : NM_001042743.1

name	LOC666048 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94372200 GeneID:666048
definition	codon_start : 1 product : hypothetical protein protein_id : XP_986310.1

name	Foxd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679839 CCDS:CCDS18482.1 GeneID:17301 MGI:1347471
definition	GO_function : GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : involved in embryogenesis and somatogenesis note : mesoderm/mesenchyme forkhead 2 product : forkhead box D2 protein_id : NP_032619.1

name	LOC100040736 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252862 GeneID:100040736
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475212.1

name	Foxe3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657098 CCDS:CCDS18483.1 GeneID:30923 MGI:1353569
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] [Evidence ISS] GO_process : GO:0048468 - cell development [Evidence IMP]; GO:0001654 - eye development [Evidence IMP]; GO:0050679 - positive regulation of epithelial cell proliferation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : dysgenetic lens product : forkhead box E3 protein_id : NP_056573.1

name	Cmpk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981246 CCDS:CCDS18484.1 GeneID:66588 MGI:1913838
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0019201 - nucleotide kinase activity [Evidence IEA]; GO:0016776 - phosphotransferase activity, phosphate group as acceptor [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : UMP-CMP kinase protein_id : NP_079923.2

name	Stil (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677973 CCDS:CCDS18485.1 GeneID:20460 MGI:107477
definition	codon_start : 1 exception : mismatches in translation product : Tal1 interrupting locus protein_id : NP_033211.1

name	Tal1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755716 CCDS:CCDS18486.1 GeneID:21349 MGI:98480
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0045165 - cell fate commitment [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030218 - erythrocyte differentiation [Evidence IDA] [Evidence IMP]; GO:0030097 - hemopoiesis [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : T-cell acute lymphocytic leukemia 1 protein_id : NP_035657.1

name	Pdzk1ip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385522 CCDS:CCDS18487.1 GeneID:67182 MGI:1914432
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : membrane-associated protein 17 (Map17) product : membrane-associated protein 17 protein_id : NP_080294.1

name	Cyp4x1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51592065 CCDS:CCDS18488.1 GeneID:81906 MGI:1932403
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 function : monooxygenase note : cytochrome P450, 4x1 product : cytochrome P450, family 4, subfamily x, polypeptide 1 protein_id : NP_001003947.1

name	LOC230639 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82894547 GeneID:230639
definition	codon_start : 1 product : similar to fatty acid omega-hydroxylase; CYP4A11 protein_id : XP_144013.5

name	Cyp4a12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86198312 CCDS:CCDS18489.1 GeneID:277753 MGI:88612
definition	GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : novel protein similar to cytochrome P450, family 4, subfamily a, polypeptide 12 (Cyp4a12) product : cytochrome P450, family 4, subfamily a, polypeptide 12 protein_id : NP_803125.2

name	LOC546842 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82894549 GeneID:546842
definition	codon_start : 1 product : similar to cytochrome P450 protein_id : XP_621635.2

name	Cyp4a12b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86198314 CCDS:CCDS18490.1 GeneID:13118 MGI:3611747
definition	GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : cytochrome P450, family 4, subfamily a, polypeptide 12 product : cytochrome P450, family 4, subfamily a family protein_id : NP_758510.2

name	LOC435802 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82894551 GeneID:435802
definition	codon_start : 1 product : similar to cytochrome P450 protein_id : XP_487818.2

name	Cyp4a14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681121 CCDS:CCDS18491.1 GeneID:13119 MGI:1096550
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0018685 - alkane 1-monooxygenase activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : cytochrome P450, 4a14 product : cytochrome P450, family 4, subfamily a, polypeptide 14 protein_id : NP_031848.1

name	Cyp4a10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059035 CCDS:CCDS18492.1 GeneID:13117 MGI:88611
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] [Evidence IDA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence TAS] [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006631 - fatty acid metabolism [Evidence TAS] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 4a10 product : cytochrome P450, family 4, subfamily a, polypeptide 10 protein_id : NP_034141.2

name	LOC666168 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252866 GeneID:666168
definition	codon_start : 1 product : similar to cytochrome P450, family 4, subfamily a, polypeptide 10 protein_id : XP_001475449.1

name	LOC631037 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94372205 GeneID:631037
definition	codon_start : 1 product : similar to CYP4B1 protein_id : XP_987238.1

name	LOC100040843 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252864 GeneID:100040843
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476165.1

name	Cyp4b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681123 CCDS:CCDS18493.1 GeneID:13120 MGI:103225
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, subfamily IV B, polypeptide 1 product : cytochrome P450, family 4, subfamily b, polypeptide 1 protein_id : NP_031849.1

name	4732418C07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254242 CCDS:CCDS18494.1 GeneID:230648 MGI:2442397
definition	codon_start : 1 product : hypothetical protein LOC230648 protein_id : NP_766286.2

name	4930544O15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51709407 GeneID:75173 MGI:1922423
definition	codon_start : 1 product : hypothetical protein LOC75173 protein_id : XP_485433.1

name	Atpaf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794370 CCDS:CCDS18496.1 GeneID:230649 MGI:2180560
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006461 - protein complex assembly [Evidence IEA] codon_start : 1 product : ATP synthase mitochondrial F1 complex assembly factor 1 protein_id : NP_851383.1

name	Mobkl2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424984 CCDS:CCDS18497.1 GeneID:100465 MGI:2140623
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : MOB1, Mps One Binder kinase activator-like 2C protein_id : NP_780517.1

name	Mknk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946850 CCDS:CCDS18498.1 GeneID:17346 MGI:894316
definition	GO_function : GO:0005524 - ATP binding [Evidence IDA] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IDA] [Evidence IEA]; GO:0006950 - response to stress [Evidence NAS] codon_start : 1 product : MAP kinase-interacting serine/threonine kinase 1 protein_id : NP_067436.1

name	Kncn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84993776 CCDS:CCDS18499.1 GeneID:654462 MGI:3614952
definition	codon_start : 1 product : kinocilin protein_id : NP_001034213.1

name	6430628N08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20841478 GeneID:76237 MGI:1923487
definition	codon_start : 1 product : hypothetical protein LOC76237 protein_id : XP_149458.1

name	Dmbx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70909343 GeneID:140477 MGI:2153518
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence ISS] [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEP] [Evidence ISS] GO_process : GO:0007417 - central nervous system development [Evidence IEP] [Evidence ISS]; GO:0016481 - negative regulation of transcription [Evidence IEP] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; orthodenticle 3; homeobox gene Atx; orthodenticle homolog 3; diencephalon/mesencephalon-expressed brain homeobox 1 product : orthodenticle homolog 3 isoform a protein_id : NP_570935.3

name	Dmbx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70909349 CCDS:CCDS18500.1 GeneID:140477 MGI:2153518
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence ISS] [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEP] [Evidence ISS] GO_process : GO:0007417 - central nervous system development [Evidence IEP] [Evidence ISS]; GO:0016481 - negative regulation of transcription [Evidence IEP] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; orthodenticle 3; homeobox gene Atx; orthodenticle homolog 3; diencephalon/mesencephalon-expressed brain homeobox 1 product : orthodenticle homolog 3 isoform b protein_id : NP_001020738.1

name	Faah (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542795 CCDS:CCDS18501.1 GeneID:14073 MGI:109609
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004040 - amidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : amide hydrolase; fatty acid amide hydrolase protein product : fatty acid amide hydrolase protein_id : NP_034303.2

name	Nsun4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312358 CCDS:CCDS18502.1 GeneID:72181 MGI:1919431
definition	codon_start : 1 note : likely ortholog of H. sapiens NOL1/NOP2/Sun domain family, member 4 (NSUN4) product : NOL1/NOP2/Sun domain family, member 4 protein_id : NP_082418.1

name	Uqcrh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539599 GeneID:66576 MGI:1913826
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005746 - mitochondrial electron transport chain [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008121 - ubiquinol-cytochrome-c reductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006122 - mitochondrial electron transport, ubiquinol to cytochrome c [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ubiquinol cytochrome c reductase hinge protein; mitochondrial hinge protein; cytochrome C1, nonheme 11 kDa protein; complex III subunit VIII product : ubiquinol-cytochrome c reductase hinge protein protein_id : NP_079917.1

name	Lrrc41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77377293 GeneID:230654 MGI:2441984
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : Muf1 protein protein_id : NP_705741.2

name	Rad54l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982068 CCDS:CCDS18504.1 GeneID:19366 MGI:894697
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RAD54 like protein_id : NP_033041.2

name	1520402A15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94372211 GeneID:68075 MGI:1915325
definition	codon_start : 1 product : hypothetical protein LOC68075 protein_id : XP_204182.3

name	Pomgnt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22267452 CCDS:CCDS18506.1 GeneID:68273 MGI:1915523
definition	GO_component : GO:0000139 - Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence ISS] GO_function : GO:0003827 - alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity [Evidence IEA]; GO:0047223 - beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity [Evidence ISS]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006487 - protein amino acid N-linked glycosylation [Evidence IEA]; GO:0006493 - protein amino acid O-linked glycosylation [Evidence ISS] [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; O-mannosyl N-acetylglucosaminyltransferase product : O-mannosyl N-acetylglucosaminyltransferase isoform 1 protein_id : NP_080927.1

name	Pomgnt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27777638 CCDS:CCDS18507.1 GeneID:68273 MGI:1915523
definition	GO_component : GO:0000139 - Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence ISS] GO_function : GO:0003827 - alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity [Evidence IEA]; GO:0047223 - beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity [Evidence ISS]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006487 - protein amino acid N-linked glycosylation [Evidence IEA]; GO:0006493 - protein amino acid O-linked glycosylation [Evidence ISS] [Evidence IMP] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; O-mannosyl N-acetylglucosaminyltransferase product : O-mannosyl N-acetylglucosaminyltransferase isoform 2 protein_id : NP_084062.1

name	Tspan1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526840 CCDS:CCDS18508.1 GeneID:66805 MGI:1914055
definition	codon_start : 1 product : tetraspan 1 protein_id : NP_598442.1

name	1700042G07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252868 GeneID:67323 MGI:1914573
definition	codon_start : 1 product : hypothetical protein LOC67323 protein_id : XP_001475644.1

name	LOC433748 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82894656 GeneID:433748
definition	codon_start : 1 product : similar to 1190005P17Rik protein protein_id : XP_910213.1

name	Pik3r3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31712016 CCDS:CCDS18509.1 GeneID:18710 MGI:109277
definition	GO_component : GO:0005942 - phosphoinositide 3-kinase complex [Evidence IPI] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0046935 - phosphatidylinositol 3-kinase regulator activity [Evidence IDA]; GO:0035014 - phosphoinositide 3-kinase regulator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 3 (p55) protein_id : NP_853616.1

name	Mast2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112363078 GeneID:17776 MGI:894676
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0015630 - microtubule cytoskeleton [Evidence IDA] [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence ISS] [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence IDA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IDA] [Evidence IEA]; GO:0045075 - regulation of interleukin-12 biosynthesis [Evidence IDA]; GO:0048515 - spermatid differentiation [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; microtubule associated testis specific serine/threonine protein kinase product : microtubule associated serine/threonine kinase 2 isoform 2 protein_id : NP_032667.2

name	Mast2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112363074 GeneID:17776 MGI:894676
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0015630 - microtubule cytoskeleton [Evidence IDA] [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence ISS] [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence IDA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IDA] [Evidence IEA]; GO:0045075 - regulation of interleukin-12 biosynthesis [Evidence IDA]; GO:0048515 - spermatid differentiation [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; microtubule associated testis specific serine/threonine protein kinase product : microtubule associated serine/threonine kinase 2 isoform 1 protein_id : NP_001036208.1

name	LOC384042 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384042
definition	number : 1 pseudo : _no_value

name	LOC666393 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666393
definition	number : 1 pseudo : _no_value

name	LOC230641 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:230641
definition	number : 1 pseudo : _no_value

name	LOC230641 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:230641
definition	number : 2 pseudo : _no_value

name	LOC546843 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546843
definition	number : 1 pseudo : _no_value

name	LOC546843 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546843
definition	number : 2 pseudo : _no_value

name	LOC631400 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252871 GeneID:631400
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 74 ESTs, 21 Proteins product : similar to H3 histone, family 3B pseudo : _no_value transcript_id : XR_032826.1

clone name	MSMg01-300E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-203A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506E13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-488J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355L15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-524O24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-476E13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-517M11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-467F24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-318E11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-190B03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-175D18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-539C02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-361H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-158I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-132A02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-406A19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-262C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445B09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-359B17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-160E21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-269L14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-083O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-198N12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-092F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065K11
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-224L20.b	B6Ng01-224L20.g
ACC	GA039113	GA039114
length	1,153	1,088
definition	B6Ng01-224L20.b	B6Ng01-224L20.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcacctgaggaataccgaatggcagagaagcacctgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctgagat tccacctcacaccagtgagaatggctaagatcaaaaattcaggtgacagc agatgctggcgaggatgtggagaaagaggaacactcctccattgttggtg ggattgcaggcttgtacaaccactctggaaatcagtctggcgcttcctca gaaaattggacatagtactaccggaggatccagcaatacctctcctgggc atatatccagaagaagccccaactggtaagaaggacacatgctccactat gttcatagcagccttatttataatagccagaaactggaaagaacccagat gcccctcaacagaggaatggatacagaaaatgtggtacatctacacaatg gagtactactcagctattaaaaagaatgaatttatgaaattcctagccaa atggatggacctggagagcatcatcctgagtgaggtaacccaatcacaaa ggaactcacacaatatgtactcactgataagtggatactagcccaaaacc taggattcccaagatataagatacaatttcctaaacacatgaaactcaag aaaaatgaagactgaagtgtggacactatgcccctccttagaagtgggaa caaaacacccatggaaggagtttacagaaacaaagtatggagctgagatg aaaggatggaccatgtagagactgccatatccagggatccaccccataat cagcttccaaatgctgacaccattgcatacactagcaagattttactgaa aggacccagatgtagctgtctctttgttgagactatttcctgggccctag caaaccacagaagtggatgctcacagtcaagctattggaagggatcacag ggctccccaatggatggagctagagaaggtactcaaggagctaaagggga ttcctcaacctctttaggttggaacaacattatgaacttatccagtaccc cttgagcctcttgaacttcttggcttgctatattgtatcaaaaagatggg cctaatctggccattccatctggaaaaggaagagtccaattggtacacgc caa	gaattcaaagctgttagatttgatcacagggctcatcagatcatattttc ctatagttatgagcaggtaccttgcagcaaatgtctgtgtatgtgtgagc tctctctgtgtgtttctaggcttcagaaatgaaatggtcagcttctagtg atgagacatttctctttattcatgatagcttggtcctcatagctgatatg gggatttctgctaaggtgtgtatgctgcccaatcagtacactttaaagtg tctgtgtccatatctccctgtatcttctaagttgcacagtaaccaggttc attccttaccaccccatagttcaatatttgcttttcttcttcctctcaac agcttttattatttacttatttatttattggttatatgtataaccatggg tgtgtgtatggataggcatgctcatgtgagtgttggtacccagggaggtc aacaatattgctgagctagctctggagctagcgttatgggtcctctttaa gagcagtaagactcttaactacaaagccatcttaccatctccccagatgg acattattttattttttacttttctgggtgttttcaaaatcctctcattc tttttggactcaccacaactctctgtgtgaaaaaaaatcttgtgtctgtc ttgctgctctctgtcatgtctgagacctcgtaaaactttagcagctgata ttaggaatactcatgtgtataatactagattactagggtgtctctgaaga tgatgggaccttccttaggagtttgggctccagaaatgtgaaggtcacca aaccaactcaagccagtgatgtttaggttcttgtctctcaaatttgagga ataaaatgtataggccatagaggatgagctttagagcttttgtaaatatt gtatatattttttttcatttttgtaatgagtgtaaaggagaagaaggaga gagagacgagagacagagagagacgagatagaggatgacgacgagagaca gagagatggtagcttccaaatagcagagggtacatcagtgtatccaggga agtttttttaaaaaaagaacttatgcaaaaaaaaaaaa
quality values	Open. Hide. 58 29 25 37 58 54 58 41 41 54 58 58 54 47 47 62 49 33 32 56 47 62 62 62 62 62 62 62 51 47 23 39 14 21 21 15 21 21 21 22 28 37 25 46 59 59 62 62 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 59 62 54 54 59 62 62 59 62 56 50 32 43 54 59 59 59 62 54 62 62 62 62 62 62 62 54 59 59 59 62 62 62 62 62 62 62 62 62 59 62 59 62 59 59 62 59 59 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 56 59 62 62 62 62 62 62 62 62 59 59 62 59 59 59 62 49 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 56 62 62 59 62 59 59 59 56 56 59 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 59 38 37 56 59 59 62 59 56 62 59 62 62 62 47 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 54 56 56 62 56 62 62 44 56 62 50 56 56 56 56 62 56 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 56 62 51 62 62 62 62 62 62 62 56 62 62 62 62 56 62 62 62 62 62 62 56 62 54 56 62 56 62 62 62 56 62 62 62 62 54 62 62 62 62 47 42 47 47 56 56 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 54 62 54 52 62 62 52 52 54 62 39 52 52 54 42 58 54 54 52 54 54 48 58 58 58 52 54 54 58 37 52 47 58 40 54 58 52 43 42 52 42 39 52 52 54 58 58 50 47 52 52 41 54 26 35 35 58 44 48 54 52 54 42 44 50 52 58 25 39 41 35 54 52 54 35 42 52 46 54 54 58 54 42 54 47 52 54 54 52 28 43 25 52 54 52 51 49 51 53 42 22 26 33 58 33 36 58 40 53 51 50 46 27 50 27 46 39 45 50 47 51 47 30 52 37 50 23 22 32 42 52 41 35 47 48 50 49 50 33 36 47 36 31 19 40 42 27 39 26 54 15 42 51 28 6 42 50 50 50 32 46 36 39 25 27 31 23 15 19 7 43 24 19 32 40 13 29 39 32 35 50 25 18 33 23 50 32 23 32 24 22 24 39 43 16 47 52 37 49 10 39 25 32 39 52 41 43 51 26 34 39 58 39 35 39 16 20 50 32 32 38 50 29 23 32 35 53 35 40 23 39 38 33 18 23 27 20 37 42 19 29 47 45 29 37 50 51 33 26 25 24 21 25 31 23 37 25 51 11 17 29 18 47 42 24 26 21 41 37 53 21 17 42 32 33 33 31 39 20 30 38 33 29 32 45 32 28 20 28 11 19 25 20 8 45 34 31 32 21 26 32 31 47 38 32 32 45 29 52 29 19 16 31 29 39 15 20 20 28 21 15 18 34 14 8 6 31 24 31 8 6 7 40 22 31 19 22 12 7 40 23 30 10 6 46 51 31 11 40 9 13 17 13 28 22 42 12 7 7 10 11 19 14 46 32 10 6 13 27 19 21 27 21 22 27 15 28 23 28 22 27 8 11 6 30 13 9 8 10 15 19 8 8 5 11 20 23 31 25 30 32 21 12 32 14 8 26 19 31 31 7 6 14 21 30 25 27 6 24 9 23 18 26 31 22 11 10 6 32 29 7 22 32 25 37 9 10 6 14 13 9 9 19 12 21 28 38 6 13 31 38 9 24 8 10 7 8 29 25 10 10 27 14 10 11 11 5 5 6 11 27 10 10 16 26 8 25 13 10 11 21 6 12 43 8 32 15 20 20 24 22 9 7 5 33 22 13 14 29 6 32 34 39 15 14 11 9 20 6 5 5 7 13 22 29 21 17 19 5 6 7 11 9 25 10 15 10 11 6 13 7 3 5 17 9 6 5 6 8 7 11 7 13 26 13 19 9 6 14 6 18 28 13 11 13 7 5 3 3 27 5 5 15 10 7 6 5 16 13 18 7 8 6 6 6 6 11 28 30 6 5 6 16 14 6 6 4 3 8 5 6 5 10 9 9 18 5 25 5 6 5 10 9 22 5 11	Open. Hide. 62 47 51 47 62 47 31 62 62 62 42 38 50 21 21 23 25 24 44 45 49 43 59 59 59 59 62 59 62 59 59 49 62 59 59 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 59 59 59 54 62 56 59 59 59 62 59 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 54 58 52 58 52 58 58 54 58 58 58 58 58 40 58 58 58 58 54 58 58 58 54 58 54 58 58 58 58 58 52 58 58 58 46 54 54 41 42 58 58 58 54 58 58 54 46 54 49 46 58 58 51 52 52 51 45 50 41 58 58 40 50 41 58 58 58 58 41 50 54 58 58 58 47 47 50 58 58 58 41 58 47 58 49 58 50 50 58 51 41 54 58 51 58 53 58 52 50 51 58 53 49 58 58 58 53 51 48 51 40 54 52 40 41 49 58 53 58 58 54 58 53 58 53 51 58 50 44 50 52 51 58 58 58 58 58 58 42 36 58 58 52 58 50 58 52 53 51 58 32 51 53 51 49 40 50 49 51 51 52 52 53 50 58 40 50 38 53 58 37 58 50 50 46 17 41 34 51 53 53 32 32 53 54 54 49 32 50 54 39 38 28 53 53 34 47 49 41 38 31 34 49 34 39 24 41 45 39 39 38 52 53 45 39 45 53 37 53 43 34 42 42 54 37 37 37 42 52 37 31 20 20 37 37 37 44 32 54 41 39 52 26 52 40 37 41 27 39 53 36 37 28 40 39 22 51 54 37 29 20 31 22 22 40 42 28 22 36 13 34 35 21 31 51 25 39 53 47 32 32 40 32 24 28 29 40 32 31 52 26 32 30 32 18 19 18 37 31 29 29 12 33 28 33 53 24 24 30 31 33 33 31 31 31 32 35 36 39 45 28 22 31 25 46 32 26 20 30 27 32 19 13 24 41 24 31 29 31 31 29 29 51 31 31 48 28 29 43 29 25 42 31 26 31 46 46 25 26 32 24 31 31 24 26 24 17 27 24 30 31 26 32 31 24 31 9 20 36 21 17 34 46 30 25 14 32 31 38 43 46 36 17 20 23 44 46 46 26 30 11 13 11 10 21 24 23 21 31 41 46 46 44 41 46 41 39 36 32 32 48 47 44 28 17 20 30 20 29 31 28 22 23 26 10 25 41 16 35 21 27 12 15 33 26 26 12 8 8 8 13 21 6 17 13 31 26 12 5 5 4 5 4 7 13 20 5 7 17 7 22 30 23 23 7 10 20 31 15 12 28 6 28 20 25 11 10 8 8 16 7 7 12 8 11 8 6 8 10 16 8 25 5 11 26 6 11 21 12 11 21 6 10 14 28 17 19 8 18 15 30 13 13 10 22 18 6 22 22 8 40 22 31 8 20 14 27 13 28 11 20 10 15 8 27 13 28 16 24 32 27 5 9 9 30 21 34 29 28 17 11 3 16 28 26 21 18 7 4 7 15 4 14 9 10 8 7 3 13 25 13 25 24 30 30 28 17 14 23 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_115123939_115125045
seq2: B6Ng01-224L20.g_69_1156 (reverse)

seq1  TTTTTTTTTTTTCCATAAATTCTTTTTTTAAAAAAAACTCCCTGGGAATA  50
      |||||||||||| ||||| |||||||||||||||||  |||||||  |||
seq2  TTTTTTTTTTTTGCATAAGTTCTTTTTTTAAAAAAACTTCCCTGG--ATA  48

seq1  CAACTTGATGGTAACCCTCCTGCTATTTGGAAGCTACCATTTCTCTCTTT  100
      ||   |||||   ||||| ||||||||||||||||||||    ||||| |
seq2  CA--CTGATG--TACCCT-CTGCTATTTGGAAGCTACCA----TCTCTCT  89

seq1  GTCTCTCTGTCTGTCTATCCTCTATCTCTGTCTCTCTCTGTCTCTCTGTC  150
      ||||||| ||| ||| |||||||||||| ||||||||||||||||| |||
seq2  GTCTCTC-GTC-GTC-ATCCTCTATCTC-GTCTCTCTCTGTCTCTC-GTC  134

seq1  TCTCTCTCCCTTCTTCTCCTTTACACTCATTACAAAAATGAAAAAAAATA  200
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTCT-CCTTCTTCTCCTTTACACTCATTACAAAAATGAAAAAAAATA  183

seq1  TATACAAATATTTTACAAAAGCTCTAAAGCTCATCCTCTATGGCCTATAC  250
      ||||| |||| |||||||||||||||||||||||||||||||||||||||
seq2  TATAC-AATA-TTTACAAAAGCTCTAAAGCTCATCCTCTATGGCCTATAC  231

seq1  ATTTTATTCCTCAAATTTGAGAGACAAGAACCTAAACATCACTGGCTTGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTATTCCTCAAATTTGAGAGACAAGAACCTAAACATCACTGGCTTGA  281

seq1  GTTGGTTTGGTGACCTTCACATTTCTGGAGCCCAAACTCCTAAGGAAGGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGGTTTGGTGACCTTCACATTTCTGGAGCCCAAACTCCTAAGGAAGGT  331

seq1  CCCATCATCTTCAGAGACACCCTAGTAATCTAGTATTATACACATGAGTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCATCATCTTCAGAGACACCCTAGTAATCTAGTATTATACACATGAGTA  381

seq1  TTCCTAATATCAGCTGCTAAAGTTTTACGAGGTCTCAGACATGACAGAGA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTAATATCAGCTGCTAAAGTTTTACGAGGTCTCAGACATGACAGAGA  431

seq1  GCAGCAAGACAGACACAAGATTTTTTTTCACACAGAGAGTTGTGGTGAGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCAAGACAGACACAAGATTTTTTTTCACACAGAGAGTTGTGGTGAGT  481

seq1  CCAAAAAGAATGAGAGGATTTTGAAAACACCCAGAAAAGTAAAAAATAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAAAAGAATGAGAGGATTTTGAAAACACCCAGAAAAGTAAAAAATAAA  531

seq1  ATAATGTCCATCTGGGGAGATGGTAAGATGGCTTTGTAGTTAAGAGTCTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAATGTCCATCTGGGGAGATGGTAAGATGGCTTTGTAGTTAAGAGTCTT  581

seq1  ACTGCTCTTAAAGAGGACCCATAACGCTAGCTCCAGAGCTAGCTCAGCAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGCTCTTAAAGAGGACCCATAACGCTAGCTCCAGAGCTAGCTCAGCAA  631

seq1  TATTGTTGACCTCCCTGGGTACCAACACTCACATGAGCATGCCTATCCAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTGTTGACCTCCCTGGGTACCAACACTCACATGAGCATGCCTATCCAT  681

seq1  ACACACACCCATGGTTATACATATAACCAATAAATAAATAAGTAAATAAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACACACCCATGGTTATACATATAACCAATAAATAAATAAGTAAATAAT  731

seq1  AAAAGCTGTTGAGAGGAAGAAGAAAAGCAAATATTGAACTATGGGGTGGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGCTGTTGAGAGGAAGAAGAAAAGCAAATATTGAACTATGGGGTGGT  781

seq1  AAGGAATGAACCTGGTTACTGTGCAACTTAGAAGATACAGGGAGATATGG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAATGAACCTGGTTACTGTGCAACTTAGAAGATACAGGGAGATATGG  831

seq1  ACACAGACACTTTAAAGTGTACTGATTGGGCAGCATACACACCTTAGCAG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACAGACACTTTAAAGTGTACTGATTGGGCAGCATACACACCTTAGCAG  881

seq1  AAATCCCCATATCAGCTATGAGGACCAAGCTATCATGAATAAAGAGAAAT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATCCCCATATCAGCTATGAGGACCAAGCTATCATGAATAAAGAGAAAT  931

seq1  GTCTCATCACTAGAAGCTGACCATTTCATTTCTGAAGCCTAGAAACACAC  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTCATCACTAGAAGCTGACCATTTCATTTCTGAAGCCTAGAAACACAC  981

seq1  AGAGAGAGCTCACACATACACAGACATTTGCTGCAAGGTACCTGCTCATA  1050
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAGAGCTCACACATACACAGACATTTGCTGCAAGGTACCTGCTCATA  1031

seq1  ACTATAGGAAAATATGATCTGATGAGCCCTGTGATCAAATCTAACAGCTT  1100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTATAGGAAAATATGATCTGATGAGCCCTGTGATCAAATCTAACAGCTT  1081

seq1  TGAATTC  1107
      |||||||
seq2  TGAATTC  1088

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information