MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-242P13
Chromosome	4 (Build37)
Map Location	142,720,867 - 142,852,594
singlet/doublet	doublet
Overlap gene	Prdm2, LOC666018, EG626575, LOC433776
Upstream gene	EG665983, LOC546484, 6330411D24Rik
Downstream gene	Pdpn, Lrrc38, LOC621961, Pramel1, 4732496O08Rik, Oog4, LOC666015, LOC626700, OTTMUSG00000010207, LOC100040854, LOC100040861, BC080695, LOC666049, LOC279185, LOC277668, LOC100040924, OTTMUSG00000010333, LOC277666, OTTMUSG00000010009, OTTMUSG00000010328, OTTMUSG00000010433, LOC195555, LOC194224, LOC626889, LOC329984, LOC626922, LOC626943, LOC100041127, LOC436146, Pramel4, LOC100041077, LOC100041144, Oog3, Oog2, C87977
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG665983 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665983 MGI:3644415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC546484 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	6330411D24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70725 MGI:1917975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Prdm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110593 MGI:107628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666018 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	EG626575 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626575 MGI:3646960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC433776 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 850 ESTs, 2 Proteins

name	Pdpn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14726 MGI:103098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc38 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242735 MGI:2442845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 12 ESTs, 4 Proteins

name	LOC621961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 129 ESTs, 7 Proteins pseudo : _no_value

name	Pramel1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83491 MGI:1890541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4732496O08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242736 MGI:2140473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oog4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242737 MGI:2684051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666015 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666015
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC626700 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins pseudo : _no_value

name	OTTMUSG00000010207 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545693 MGI:3649690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040854 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 12 ESTs, 54 Proteins

name	LOC100040861 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 12 ESTs, 55 Proteins

name	BC080695 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329986 MGI:3525148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666049 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666049
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins pseudo : _no_value

name	LOC279185 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:279185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 37 Proteins

name	LOC277668 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:277668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 ESTs, 28 Proteins

name	LOC100040924 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs

name	OTTMUSG00000010333 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277667 MGI:3649972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 36 Proteins

name	LOC277666 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:277666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 45 Proteins

name	OTTMUSG00000010009 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194227 MGI:3650478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000010328 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381569 MGI:3650237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000010433 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194225 MGI:3650203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC195555 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:195555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 41 Proteins

name	LOC194224 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:194224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC626889 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC329984 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:329984
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 12 ESTs, 50 Proteins

name	LOC626922 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 9 ESTs, 55 Proteins

name	LOC626943 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 Proteins

name	LOC100041127 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	LOC436146 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436146
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Pramel4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:347710 MGI:2156377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041077 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 138 ESTs, 43 Proteins

name	LOC100041144 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Oog3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100012 MGI:2684047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oog2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381570 MGI:2684035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C87977 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97187 MGI:2140708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 199 ESTs, 48 Proteins

name	EG665983 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372615 GeneID:665983 MGI:3644415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG665983 transcript_id : XM_980711.1

name	Prdm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486860 GeneID:110593 MGI:107628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PR domain containing 2, with ZNF domain transcript_id : NM_001081355.1

name	EG626575 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253249 GeneID:626575 MGI:3646960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG626575 transcript_id : XM_899431.3

name	LOC433776 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253257 GeneID:433776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 850 ESTs, 2 Proteins product : similar to Eukaryotic translation elongation factor 2 transcript_id : XM_001475562.1

name	Pdpn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113462004 GeneID:14726 MGI:103098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : podoplanin transcript_id : NM_010329.2

name	Lrrc38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372710 GeneID:242735 MGI:2442845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 12 ESTs, 4 Proteins product : leucine rich repeat containing 38 transcript_id : XM_144076.5

name	Pramel1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878196 GeneID:83491 MGI:1890541
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : preferentially expressed antigen in melanoma-like 1 transcript_id : NM_031377.1

name	4732496O08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375940 GeneID:242736 MGI:2140473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732496O08 gene transcript_id : NM_172877.2

name	Oog4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30424638 GeneID:242737 MGI:2684051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oogenesin 4 transcript_id : NM_173773.1

name	OTTMUSG00000010207 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131175 GeneID:545693 MGI:3649690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000010207 transcript_id : NM_001039595.2

name	LOC100040854 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253251 GeneID:100040854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 12 ESTs, 54 Proteins product : similar to Predicted gene, OTTMUSG00000010207 transcript_id : XM_001476396.1

name	LOC100040861 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253253 GeneID:100040861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 12 ESTs, 55 Proteins product : similar to Predicted gene, OTTMUSG00000010207 transcript_id : XM_001476412.1

name	BC080695 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371044 GeneID:329986 MGI:3525148
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC080695 transcript_id : NM_001007579.2

name	LOC279185 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253261 GeneID:279185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 37 Proteins product : hypothetical LOC279185 transcript_id : XM_205435.7

name	LOC277668 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372716 GeneID:277668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 28 Proteins product : similar to Predicted gene, OTTMUSG00000010433 transcript_id : XM_204040.4

name	LOC100040924 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253255 GeneID:100040924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs product : similar to Rab6 protein transcript_id : XM_001476459.1

name	LOC277666 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253264 GeneID:277666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 45 Proteins product : novel protein similar to preferentially expressed antigen in melanoma-like family (Pramel) transcript_id : XM_205433.5

name	OTTMUSG00000010009 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55741546 GeneID:194227 MGI:3650478
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000010009 transcript_id : NM_001007077.1

name	OTTMUSG00000010328 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802069 GeneID:381569 MGI:3650237
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000010328 transcript_id : NM_001005371.2

name	OTTMUSG00000010433 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248521 GeneID:194225 MGI:3650203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000010433 transcript_id : NM_177571.3

name	LOC195555 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253267 GeneID:195555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 41 Proteins product : novel protein similar to preferentially expressed antigen in melanoma-like family (Pramel) transcript_id : XM_112266.7

name	LOC329984 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253259 GeneID:329984
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 50 Proteins product : hypothetical LOC329984 transcript_id : XM_285846.7

name	LOC626922 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253269 GeneID:626922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 9 ESTs, 55 Proteins product : novel protein similar to the preferentially expressed antigen in melanoma like (Pramel) family transcript_id : XM_891538.3

name	LOC626943 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82895671 GeneID:626943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 Proteins product : novel protein similar to the preferentially expressed antigen in melanoma like (Pramel) family transcript_id : XM_891565.1

name	LOC100041127 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253275 GeneID:100041127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : similar to pol protein transcript_id : XM_001475845.1

name	Pramel4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373617 GeneID:347710 MGI:2156377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : preferentially expressed antigen in melanoma like 4 transcript_id : NM_001001319.3

name	LOC100041077 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253265 GeneID:100041077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 138 ESTs, 43 Proteins product : similar to preferentially expressed antigen in melanoma like 4 transcript_id : XM_001476560.1

name	LOC100041144 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253277 GeneID:100041144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : similar to pol protein transcript_id : XM_001475876.1

name	Oog3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41054937 GeneID:100012 MGI:2684047
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oogenesin 3 transcript_id : NM_201258.1

name	Oog2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802198 GeneID:381570 MGI:2684035
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oogenesin 2 transcript_id : NM_198661.2

name	C87977 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253273 GeneID:97187 MGI:2140708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 95 ESTs product : expressed sequence C87977, transcript variant 2 transcript_id : XM_001476630.1

name	C87977 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253271 GeneID:97187 MGI:2140708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 192 ESTs, 48 Proteins product : expressed sequence C87977, transcript variant 1 transcript_id : XM_001476610.1

name	EG665983 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94372616 GeneID:665983 MGI:3644415
definition	codon_start : 1 product : hypothetical protein protein_id : XP_985805.1

name	Prdm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486861 GeneID:110593 MGI:107628
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : PR domain containing 2, with ZNF domain protein_id : NP_001074824.1

name	EG626575 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82895635 GeneID:626575 MGI:3646960
definition	codon_start : 1 product : hypothetical protein protein_id : XP_904524.1

name	LOC433776 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253258 GeneID:433776
definition	codon_start : 1 product : similar to Eukaryotic translation elongation factor 2 protein_id : XP_001475612.1

name	Pdpn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113462005 GeneID:14726 MGI:103098
definition	GO_component : GO:0030175 - filopodium [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IDA]; GO:0008517 - folic acid transporter activity [Evidence IDA]; GO:0015250 - water channel activity [Evidence IDA]; GO:0005372 - water transporter activity [Evidence IDA] GO_process : GO:0006865 - amino acid transport [Evidence IDA]; GO:0007155 - cell adhesion [Evidence ISS]; GO:0007275 - development [Evidence IEA]; GO:0015884 - folic acid transport [Evidence IDA]; GO:0030324 - lung development [Evidence IMP]; GO:0001946 - lymphangiogenesis [Evidence IMP]; GO:0030335 - positive regulation of cell migration [Evidence ISS]; GO:0051272 - positive regulation of cell motility [Evidence IDA]; GO:0008360 - regulation of cell shape [Evidence IEA]; GO:0035239 - tube morphogenesis [Evidence ISS]; GO:0006833 - water transport [Evidence IDA] codon_start : 1 note : Aggrus; glycoprotein 38 product : podoplanin protein_id : NP_034459.2

name	Lrrc38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38078948 GeneID:242735 MGI:2442845
definition	codon_start : 1 product : similar to Lrrc38 protein protein_id : XP_144076.2

name	Pramel1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878197 CCDS:CCDS18888.1 GeneID:83491 MGI:1890541
definition	codon_start : 1 product : preferentially expressed antigen in melanoma-like 1 protein_id : NP_113554.1

name	Oog4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424639 CCDS:CCDS18890.1 GeneID:242737 MGI:2684051
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : oogenesin 4 protein_id : NP_776134.1

name	OTTMUSG00000010207 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88853565 CCDS:CCDS18891.1 GeneID:545693 MGI:3649690
definition	codon_start : 1 note : novel protein similar to the preferentially expressed antigen in melanoma like (Pramel) family product : hypothetical protein LOC545693 protein_id : NP_001034684.1

name	LOC100040854 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253252 GeneID:100040854
definition	codon_start : 1 product : similar to Predicted gene, OTTMUSG00000010207 protein_id : XP_001476446.1

name	LOC100040861 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253254 GeneID:100040861
definition	codon_start : 1 product : similar to Predicted gene, OTTMUSG00000010207 protein_id : XP_001476462.1

name	BC080695 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56090469 GeneID:329986 MGI:3525148
definition	codon_start : 1 note : novel protein similar to the preferentially expressed antigen in melanoma like (Pramel) family product : hypothetical protein LOC329986 protein_id : NP_001007580.1

name	LOC279185 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253262 GeneID:279185
definition	codon_start : 1 product : hypothetical protein protein_id : XP_205435.5

name	LOC277668 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:28498570 GeneID:277668
definition	codon_start : 1 product : similar to Predicted gene, OTTMUSG00000010433 protein_id : XP_204040.2

name	LOC100040924 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253256 GeneID:100040924
definition	codon_start : 1 product : similar to Rab6 protein protein_id : XP_001476509.1

name	LOC277666 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895655 GeneID:277666
definition	codon_start : 1 product : hypothetical protein LOC277666 protein_id : XP_205433.4

name	OTTMUSG00000010009 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55741547 CCDS:CCDS18894.1 GeneID:194227 MGI:3650478
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC194227 protein_id : NP_001007078.1

name	OTTMUSG00000010328 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52851398 GeneID:381569 MGI:3650237
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC381569 protein_id : NP_001005371.1

name	OTTMUSG00000010433 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248522 GeneID:194225 MGI:3650203
definition	codon_start : 1 note : novel protein similar to oogenesin 3 (Oog3) product : hypothetical protein LOC194225 protein_id : NP_808239.2

name	LOC195555 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253268 GeneID:195555
definition	codon_start : 1 product : hypothetical protein LOC195555 protein_id : XP_112266.5

name	LOC329984 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895664 GeneID:329984
definition	codon_start : 1 product : hypothetical protein protein_id : XP_285846.5

name	LOC626922 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253270 GeneID:626922
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896631.3

name	LOC626943 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895672 GeneID:626943
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896658.1

name	LOC100041127 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253276 GeneID:100041127
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001475895.1

name	Pramel4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75812918 CCDS:CCDS18900.1 GeneID:347710 MGI:2156377
definition	codon_start : 1 product : preferentially expressed antigen in melanoma like 4 protein_id : NP_001001319.2

name	LOC100041077 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253266 GeneID:100041077
definition	codon_start : 1 product : similar to preferentially expressed antigen in melanoma like 4 protein_id : XP_001476610.1

name	LOC100041144 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253278 GeneID:100041144
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001475926.1

name	Oog3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41054938 GeneID:100012 MGI:2684047
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : oogenesin 3 protein_id : NP_957710.1

name	Oog2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348556 CCDS:CCDS18901.1 GeneID:381570 MGI:2684035
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : oogenesin 2 protein_id : NP_941063.1

name	C87977 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253272 GeneID:97187 MGI:2140708
definition	codon_start : 1 product : hypothetical protein LOC97187 isoform 1 protein_id : XP_001476660.1

name	C87977 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253274 GeneID:97187 MGI:2140708
definition	codon_start : 1 product : hypothetical protein LOC97187 isoform 2 protein_id : XP_001476680.1

name	LOC546484 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546484
definition	number : 2 pseudo : _no_value

name	LOC546484 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546484
definition	number : 1 pseudo : _no_value

name	LOC666018 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666018
definition	number : 1 pseudo : _no_value

name	LOC666015 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666015
definition	number : 4 pseudo : _no_value

name	LOC666015 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666015
definition	number : 3 pseudo : _no_value

name	LOC666015 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666015
definition	number : 2 pseudo : _no_value

name	LOC666015 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666015
definition	number : 1 pseudo : _no_value

name	LOC626700 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626700
definition	number : 1 pseudo : _no_value

name	LOC626700 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626700
definition	number : 2 pseudo : _no_value

name	LOC626700 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626700
definition	number : 3 pseudo : _no_value

name	LOC194224 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194224
definition	number : 1 pseudo : _no_value

name	LOC194224 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194224
definition	number : 2 pseudo : _no_value

name	LOC194224 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194224
definition	number : 3 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 7 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 6 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 5 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 4 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 3 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 2 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 1 pseudo : _no_value

name	LOC436146 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436146
definition	number : 1 pseudo : _no_value

name	6330411D24Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94372712 GeneID:70725 MGI:1917975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 6330411D24 gene, transcript variant 2 transcript_id : XR_002341.1

name	LOC621961 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253250 GeneID:621961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 129 ESTs, 7 Proteins product : similar to Anp32b protein pseudo : _no_value transcript_id : XR_032654.1

name	LOC666049 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253260 GeneID:666049
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : hypothetical LOC666049 pseudo : _no_value transcript_id : XR_032359.1

name	OTTMUSG00000010333 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149253263 GeneID:277667 MGI:3649972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 36 Proteins product : predicted gene, OTTMUSG00000010333 transcript_id : XR_032378.1

clone name	MSMg01-469O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367O20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-347J12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-482E15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-078J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379J04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-356E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-372M17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-326G21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-532E23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-413I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-419E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060I21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-068M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-104M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-178P21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-102M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-104M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-111D21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-142I23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-384D18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-436L12
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-103I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315N16
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-242P13.b	B6Ng01-242P13.g
ACC	GA052479	GA052480
length	1,141	1,184
definition	B6Ng01-242P13.b	B6Ng01-242P13.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(142,720,867 - 142,722,019)	(142,851,423 - 142,852,594)
sequence	gaattccaaatgtatatcaactcagcttgagaagtcaatataacaggcta tcctagggccacatcactgtccctgagaaccatgtgtatatggggagaat atggaataaggcagtaaggtcagctcagatctaaactgagaaacctaaca ttataggagaagcactgagccccagggcctggcctgctcttcttccccat tagaacctcaattgctagtctctctattgctgtaggcagagggctagagg ggaatataaggcattttaaagatatatggtgattttattttaagcaacgt ggaaaaaattttaaattcaaacactagcaaatggaagtattaacattaga tatttagacatcattaactatgcttaagtcacaaactactaaacaagaga gcactgaggttgctactggacttgtcgtcacccacttaaccctaaggagc aatgcaggaccaggaaccaacacaggtggccttggaacactgcccaagat gtaaattaagagaacttcatcttttcacacagggaactgggttcaagctc cattcagaaattaaagaaatggtaccactttgtgagcactaagtctgaaa tcattgtatttattcatcagtacagcatcaaagtagcaagggtatgccac aagattatgccagtgccactctgctaaaaggacagacgtcctccaggcca gctacagctctccagcagtcctcacctccccgagctctgggcttacctca agtccttcagctcatgcctggcactgctgtcctctctcctgctttcactc agtccgcagcagctgccagctgaaggcttcgggtgattgggcccccgctc cgctctctagattttactatgaaccggtctgttcttttcttgctggccag ggcagtcttgctttgtagaacagctttgctcttctgcacctttcacgtgc aggcttcgggatgcttttgcttgagagctgagtagaatgactcttgggca acagctttgggattttttgccctcaacatgagtatcttagccattcttac ggactagatctcaagatgagagctgcttttttgactgactgagctgcaac ttgacttcttgtctgaatctgaaggaaggagagcagcaggc	gaattcaagggcagagcaaactgtgccaactcctaaacttgtcctggtta caaaccttaaaacaccctccctgctcaaagtttaatttgaatatacaatt caaactatgaaacatgttgacgcttagagcagtggttcttaaccttctta attctgcaaccctttaatacatttcctcatgttgtggtgaactccccctt ccccccagaccacaaaattattttcatgggctacttcgtaattgtaattt ttctactattatgaatcgtaatgtaaatatctgatatgcaggacatgtga tatgagatccctgtgggggtcgcgacccacaggttgagaactgctgctcc agagcgtcttggctttggattctgaatcatttgtccacatgtgggaagtc tgtccatctgtgtgggtgtgcaggagcgcgtcctcacttttaatagtttg ttgccttctgtgcttaaggtttttcctgacttttaatcccttaagaggca gggaaaacaaagcagaccaggatcatagacagtaacatggcagtcacctg cagcggtggctctggaggagccaagaagagcttccttgctgcctcccctc ctctctgtcccctcctgtcctcagactcctgttgtctgttgcctggagcc tgccctcactaggctgccaatggatcctgctaagggaagagtaagaagag agaacatggtgtgtgtatagcacacttcctgtctgccgaatagaaatgcg gtcacagttgaccttaggagaccacacctggcacaagtagacagtacgca tggctgtatccctgcagtgtccatctctaggcttgtggccattgacactc ctagctgcttgaacttgctgagatctgatttgcaggcgcctcagctctta agcctctcgctctgctgccactcagtatccactccctcaaagttcctctc caccgccactttcagataggcattcaaacacccttgcttgttcacagcca cctgtcactactggtgcacttgtgcttttctggtgcactttacctggtgt catattccttttccccagatggggcgttacactcccatattaatttttct acgcccactacaaccaaatgcctacaattcagatagttaggcctggaaca cagttccggaccacacatgtgtaatcagcagcgc
quality values	Open. Hide. 58 31 25 33 62 62 39 19 62 62 62 54 62 56 62 56 47 38 39 62 62 62 47 44 62 62 62 62 62 59 47 59 59 34 38 29 32 38 46 59 62 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 59 62 62 49 42 62 59 59 59 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 59 62 62 62 62 62 62 62 49 42 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 49 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 54 54 58 58 58 54 58 58 54 46 54 54 58 58 58 58 58 54 54 58 54 54 54 58 54 54 58 58 58 58 58 58 58 58 54 58 49 54 58 54 58 52 58 58 58 58 58 58 58 54 54 53 58 58 58 52 48 46 58 49 52 51 58 54 41 58 58 53 54 53 53 52 40 53 58 54 58 58 51 58 58 52 53 53 51 51 58 43 50 58 58 51 53 52 58 50 49 52 53 41 50 51 46 29 38 41 50 58 49 49 46 51 50 58 51 51 50 46 58 58 51 49 51 50 51 58 58 47 25 58 41 37 49 50 44 23 50 49 52 53 53 50 39 40 41 58 52 39 42 50 51 51 40 40 40 52 51 51 41 50 51 52 33 39 53 47 39 40 49 46 41 42 38 31 54 39 29 54 54 54 42 51 27 53 53 52 41 41 54 41 39 53 41 40 45 54 47 37 42 32 38 52 37 32 35 53 33 32 38 46 46 40 39 40 35 30 34 32 45 54 32 39 33 39 38 40 41 38 40 28 32 52 42 42 53 34 31 53 32 47 32 52 53 49 29 32 39 53 40 6 7 8 16 52 31 53 40 27 53 53 20 33 34 30 32 33 35 33 45 31 30 38 38 20 38 30 31 31 31 16 46 29 24 31 35 19 31 30 51 48 27 46 51 46 31 26 31 31 36 42 25 31 34 38 31 31 28 31 21 37 18 48 48 31 34 32 32 31 29 31 34 22 31 31 20 33 20 28 27 32 35 34 31 31 46 46 31 23 18 19 28 22 32 31 44 18 31 33 26 41 48 31 30 27 33 30 18 36 36 27 31 48 29 31 13 15 7 31 17 33 21 22 30 33 47 31 28 34 32 29 36 22 31 31 31 30 19 21 29 13 44 11 32 27 34 22 31 31 32 20 25 18 22 30 30 32 27 36 32 20 19 32 27 25 48 43 16 15 23 27 13 17 24 7 10 7 32 30 16 23 6 15 14 6 30 31 24 31 31 28 25 32 16 22 8 26 11 28 20 11 28 16 27 28 21 40 24 11 33 10 26 27 40 34 34 40 17 6 10 31 23 19 22 16 16 6 6 10 11 21 7 13 22 5 16 11 22 25 8 18 18 14 16 20 11 8 7 18 4 3 12 4 9 26 13 8 27 5 3 2 7 7 9 12 5 12 15 27 7 16 7 16 18 8 12 20 28 28 23 29 13 18 9 8 21 17 15 10 5 7 17 7 22 7 6 16 18 12 9 9 11 4 2 1 2 4 6 4 4 8 4 6 6 17 4 5 17 10 16 8 17 17 8 9 10 6 4 5 7 11 3 3 2 4 7 4 2 4 6 4	Open. Hide. 62 47 42 47 62 47 42 62 62 62 24 22 14 18 23 17 22 25 22 27 44 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 59 59 48 35 43 48 43 56 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 47 47 62 62 62 62 62 62 62 56 56 56 62 56 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 62 62 62 62 62 43 62 62 62 62 62 62 62 54 62 56 62 62 62 56 62 62 62 62 62 62 56 56 46 48 52 52 62 62 52 52 62 62 62 50 54 54 62 62 52 62 62 62 41 22 62 62 21 62 42 62 62 52 62 62 47 62 49 62 62 62 54 62 54 62 54 54 54 54 48 54 58 54 54 58 58 58 54 58 54 54 58 58 54 58 54 52 58 58 58 54 58 58 52 58 47 54 54 51 54 35 39 58 46 54 37 52 58 54 58 58 52 52 52 54 52 49 45 45 48 52 54 58 58 58 23 52 54 52 54 52 52 54 54 54 42 42 52 52 49 58 52 58 58 54 39 30 53 46 58 58 41 33 40 50 41 49 50 45 39 51 16 58 58 58 41 34 58 30 50 27 33 35 54 58 23 58 27 51 30 58 50 33 39 42 50 58 46 58 50 58 48 48 40 35 46 52 40 37 38 46 49 42 38 43 41 46 31 52 46 41 46 50 39 51 26 39 50 46 52 33 36 49 25 31 50 28 24 43 32 37 37 39 31 32 24 23 30 28 12 44 47 34 50 27 46 29 8 32 32 33 21 26 27 35 41 35 27 54 32 29 37 34 53 33 39 43 26 51 32 31 45 25 41 35 27 52 32 33 54 51 26 40 49 32 32 30 8 49 19 31 53 30 22 8 16 41 31 32 31 33 39 28 37 40 28 25 13 54 28 49 12 32 24 31 29 20 26 18 38 9 9 26 23 26 32 28 32 27 25 24 28 32 40 33 33 31 35 15 22 10 47 9 20 20 21 31 31 42 10 18 30 25 32 31 30 22 51 9 28 20 33 25 28 21 26 34 30 32 36 20 6 9 29 29 23 32 26 25 16 31 31 30 28 31 28 26 31 31 15 15 31 36 32 33 34 29 17 25 31 18 24 9 23 31 21 8 8 13 21 31 25 46 33 25 31 23 41 30 18 19 5 15 19 27 25 29 21 22 23 16 25 28 21 19 9 8 6 21 10 28 23 9 38 14 6 5 11 11 11 9 9 10 13 6 4 5 7 14 29 38 18 10 12 21 34 32 25 11 38 21 19 27 27 13 30 12 15 7 14 18 22 15 21 23 21 20 21 32 13 9 21 8 9 7 22 9 19 6 9 11 29 9 26 48 37 17 13 21 16 5 5 12 6 5 11 7 28 23 26 13 18 14 11 12 16 16 24 25 11 9 20 13 16 16 14 15 19 16 9 15 38 29 21 4 6 21 13 31 29 34 14 18 24 10 12 15 20 8 10 26 20 28 15 3 4 14 12 24 8 13 10 19 28 20 11 6 4 5 5 3 5 28 20 9 7 8 7 14 11 10 7 4 10 3 3 3 15 5 5 11 4 6 3 4 4 11 6 9 5 10 7 4 13 3 6 5 8 4 4 6 5 9 7 17 10 6 4 5 4 3 1 3 9 5 3 5 2 2 2 2 3 7 10 6 6 7 5 6 6 15 12 3 5 8 16 11 7 3 3 6 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_142720867_142722019
seq2: B6Ng01-242P13.b_46_1186

seq1  GAATTCCAAATGTATATCAACTCAGCTTGAGAAGTCAATATAACAGGCTA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAAATGTATATCAACTCAGCTTGAGAAGTCAATATAACAGGCTA  50

seq1  TCCTAGGGCCACATCACTGTCCCTGAGAACCATGTGTATATGGGGAGAAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTAGGGCCACATCACTGTCCCTGAGAACCATGTGTATATGGGGAGAAT  100

seq1  ATGGAATAAGGCAGTAAGGTCAGCTCAGATCTAAACTGAGAAACCTAACA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGAATAAGGCAGTAAGGTCAGCTCAGATCTAAACTGAGAAACCTAACA  150

seq1  TTATAGGAGAAGCACTGAGCCCCAGGGCCTGGCCTGCTCTTCTTCCCCAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATAGGAGAAGCACTGAGCCCCAGGGCCTGGCCTGCTCTTCTTCCCCAT  200

seq1  TAGAACCTCAATTGCTAGTCTCTCTATTGCTGTAGGCAGAGGGCTAGAGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAACCTCAATTGCTAGTCTCTCTATTGCTGTAGGCAGAGGGCTAGAGG  250

seq1  GGAATATAAGGCATTTTAAAGATATATGGTGATTTTATTTTAAGCAACGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAATATAAGGCATTTTAAAGATATATGGTGATTTTATTTTAAGCAACGT  300

seq1  GGAAAAAATTTTAAATTCAAACACTAGCAAATGGAAGTATTAACATTAGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAAAAATTTTAAATTCAAACACTAGCAAATGGAAGTATTAACATTAGA  350

seq1  TATTTAGACATCATTAACTATGCTTAAGTCACAAACTACTAAACAAGAGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTAGACATCATTAACTATGCTTAAGTCACAAACTACTAAACAAGAGA  400

seq1  GCACTGAGGTTGCTACTGGACTTGTCGTCACCCACTTAACCCTAAGGAGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTGAGGTTGCTACTGGACTTGTCGTCACCCACTTAACCCTAAGGAGC  450

seq1  AATGCAGGACCAGGAACCAACACAGGTGGCCTTGGAACACTGCCCAAGAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGCAGGACCAGGAACCAACACAGGTGGCCTTGGAACACTGCCCAAGAT  500

seq1  GTAAATTAAGAGAACTTCATCTTTTCACACAGGGAACTGGGTTCAAGCTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAATTAAGAGAACTTCATCTTTTCACACAGGGAACTGGGTTCAAGCTC  550

seq1  CATTCAGAAATTAAAGAAATGGTACCACTTTGTGAGCACTAAGTCTGAAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTCAGAAATTAAAGAAATGGTACCACTTTGTGAGCACTAAGTCTGAAA  600

seq1  TCATTGTATTTATTCATCAGTACAGCATCAAAGTAGCAAGGGTATGCCAC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTGTATTTATTCATCAGTACAGCATCAAAGTAGCAAGGGTATGCCAC  650

seq1  AAGATTATGCCAGTGCCACTCTGCTAAAAGGACAGACGTCCTCCAGGCCA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGATTATGCCAGTGCCACTCTGCTAAAAGGACAGACGTCCTCCAGGCCA  700

seq1  GCTACAGCTCTCCAGCAGTCCTCACCTCCCCGAGCTCTGGGCTTACCTCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTACAGCTCTCCAGCAGTCCTCACCTCCCCGAGCTCTGGGCTTACCTCA  750

seq1  AGTCCTTCAGCTCATGCCTGGCACTGCTGTCCTCTCTCCTGCTTTCACTC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCCTTCAGCTCATGCCTGGCACTGCTGTCCTCTCTCCTGCTTTCACTC  800

seq1  AGGTCCGCAGCAGCTGCCAGCTGAAGGCTTCGGGTGATTGGGCCCCCGCT  850
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  A-GTCCGCAGCAGCTGCCAGCTGAAGGCTTCGGGTGATTGGGCCCCCGCT  849

seq1  CCGCTCTCTAGATTTTACTATGAACCGGTCTGTTCTTTTCTTGCTGGCCA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGCTCTCTAGATTTTACTATGAACCGGTCTGTTCTTTTCTTGCTGGCCA  899

seq1  GGGCAGTCTTGCTTTGTAGAACAGCTTTGCTCTTCTGCACC-TTCACGTG  949
      ||||||||||||||||||||||||||||||||||||||||| ||||||||
seq2  GGGCAGTCTTGCTTTGTAGAACAGCTTTGCTCTTCTGCACCTTTCACGTG  949

seq1  CAGGCTTCGGGATGC-TTTGCTTGAGAGCTGAGTAGAATGACTCTT-GGC  997
      ||||||||||||||| |||||||||||||||||||||||||||||| |||
seq2  CAGGCTTCGGGATGCTTTTGCTTGAGAGCTGAGTAGAATGACTCTTGGGC  999

seq1  AACAGCTTT-GGATTTTTTGCCCTCAACATGAGTAATCTTAGCCATTCTT  1046
      ||||||||| |||||||||||||||||||||||| |||||||||||||||
seq2  AACAGCTTTGGGATTTTTTGCCCTCAACATGAGT-ATCTTAGCCATTCTT  1048

seq1  ACGGGACTAGAATTCCTCAAGGATGAAGAGCTTGCTTTTTTGGACTTGAC  1096
      || ||||||||    ||||| |||| ||||| ||||||||| ||| ||||
seq2  AC-GGACTAGA---TCTCAA-GATG-AGAGC-TGCTTTTTT-GAC-TGAC  1089

seq1  TGAAGCTGCAAACTTGACATTCTGTCTGGATCTGAAGGATGAGGAGGGCA  1146
      || |||||| |||||||| |  |||||| ||||||||||  ||||| |||
seq2  TG-AGCTGC-AACTTGACTTCTTGTCTGAATCTGAAGGA--AGGAGAGCA  1135

seq1  GCGAGGC  1153
      || ||||
seq2  GC-AGGC  1141

seq1: chr4_142851423_142852594
seq2: B6Ng01-242P13.g_68_1251 (reverse)

seq1  GCGCTGCTGAATTCACATGTGTGGGCTCCGGAGCTGTTGTTTCAGG-CTA  49
      |||||||||| | |||||||||||  |||||| ||| |||| |||| |||
seq2  GCGCTGCTGATTACACATGTGTGG--TCCGGAACTG-TGTTCCAGGCCTA  47

seq1  CCTATCTGATGTGTAGCCTTTTTGTTGTAGTGGCTGTAG-AAAATTAATA  98
       ||||||||  ||||| | ||| ||||||||||  |||| ||||||||||
seq2  ACTATCTGAATTGTAGGCATTTGGTTGTAGTGGGCGTAGAAAAATTAATA  97

seq1  TGGGAGTGT-ACGCCCCATCTGGGGAAA--GGATATGACA-CAGGT-AAG  143
      ||||||||| ||||||||||||||||||  | |||||||| ||||| |||
seq2  TGGGAGTGTAACGCCCCATCTGGGGAAAAGGAATATGACACCAGGTAAAG  147

seq1  TGCA-CAGAAAGCCACAAGTGCA-CAGTAGTGACA-GTGGCTGTGAACAA  190
      |||| ||||||  |||||||||| ||||||||||| ||||||||||||||
seq2  TGCACCAGAAAAGCACAAGTGCACCAGTAGTGACAGGTGGCTGTGAACAA  197

seq1  GC-AGGGTGTGTTGATGCCTTATCTGGAGGTGGCGGTGGAGAGG-ACTTT  238
      || ||||||| |  ||||| |||||| | ||||||||||||||| |||||
seq2  GCAAGGGTGTTTGAATGCC-TATCTGAAAGTGGCGGTGGAGAGGAACTTT  246

seq1  GAGGGAGT-GATACTGAGTGGCAGCAGAGCGAGAGGCTTAAGAGCTGAGG  287
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  GAGGGAGTGGATACTGAGTGGCAGCAGAGCGAGAGGCTTAAGAGCTGAGG  296

seq1  CGCCTGC-AATCAGATCTCAGC-AGGTCAAGCAGCTAGGAGTGTCAATGG  335
      ||||||| |||||||||||||| || ||||||||||||||||||||||||
seq2  CGCCTGCAAATCAGATCTCAGCAAGTTCAAGCAGCTAGGAGTGTCAATGG  346

seq1  CCACAAGCCTAGAGATGGACACTGCA-GGATACAGCCATGCGTACTGTCT  384
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  CCACAAGCCTAGAGATGGACACTGCAGGGATACAGCCATGCGTACTGTCT  396

seq1  ACTTGTGCCAGGTGTGGTCTCCTAAGGTCAACTGTGACCGCATTTCTATT  434
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGTGCCAGGTGTGGTCTCCTAAGGTCAACTGTGACCGCATTTCTATT  446

seq1  CGGCAGACAGGAAGTGTGCTATACACACACCATGTTCTCTCTTCTTACTC  484
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGCAGACAGGAAGTGTGCTATACACACACCATGTTCTCTCTTCTTACTC  496

seq1  TTCCCTTAGCAGGATCCATTGGCAGCCTAGTGAGGGCAGGCTCCAGGCAA  534
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCTTAGCAGGATCCATTGGCAGCCTAGTGAGGGCAGGCTCCAGGCAA  546

seq1  CAGACAACAGGAGTCTGAGGACAGGAGGGGACAGAGAGGAGGGGAGGCAG  584
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACAACAGGAGTCTGAGGACAGGAGGGGACAGAGAGGAGGGGAGGCAG  596

seq1  CAAGGAAGCTCTTCTTGGCTCCTCCAGAGCCACCGCTGCAGGTGACTGCC  634
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGGAAGCTCTTCTTGGCTCCTCCAGAGCCACCGCTGCAGGTGACTGCC  646

seq1  ATGTTACTGTCTATGATCCTGGTCTGCTTTGTTTTCCCTGCCTCTTAAGG  684
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTTACTGTCTATGATCCTGGTCTGCTTTGTTTTCCCTGCCTCTTAAGG  696

seq1  GATTAAAAGTCAGGAAAAACCTTAAGCACAGAAGGCAACAAACTATTAAA  734
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTAAAAGTCAGGAAAAACCTTAAGCACAGAAGGCAACAAACTATTAAA  746

seq1  AGTGAGGACGCGCTCCTGCACACCCACACAGATGGACAGACTTCCCACAT  784
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGAGGACGCGCTCCTGCACACCCACACAGATGGACAGACTTCCCACAT  796

seq1  GTGGACAAATGATTCAGAATCCAAAGCCAAGACGCTCTGGAGCAGCAGTT  834
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGACAAATGATTCAGAATCCAAAGCCAAGACGCTCTGGAGCAGCAGTT  846

seq1  CTCAACCTGTGGGTCGCGACCCCCACAGGGATCTCATATCACATGTCCTG  884
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAACCTGTGGGTCGCGACCCCCACAGGGATCTCATATCACATGTCCTG  896

seq1  CATATCAGATATTTACATTACGATTCATAATAGTAGAAAAATTACAATTA  934
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATATCAGATATTTACATTACGATTCATAATAGTAGAAAAATTACAATTA  946

seq1  CGAAGTAGCCCATGAAAATAATTTTGTGGTCTGGGGGGAAGGGGGAGTTC  984
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAAGTAGCCCATGAAAATAATTTTGTGGTCTGGGGGGAAGGGGGAGTTC  996

seq1  ACCACAACATGAGGAAATGTATTAAAGGGTTGCAGAATTAAGAAGGTTAA  1034
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCACAACATGAGGAAATGTATTAAAGGGTTGCAGAATTAAGAAGGTTAA  1046

seq1  GAACCACTGCTCTAAGCGTCAACATGTTTCATAGTTTGAATTGTATATTC  1084
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACCACTGCTCTAAGCGTCAACATGTTTCATAGTTTGAATTGTATATTC  1096

seq1  AAATTAAACTTTGAGCAGGGAGGGTGTTTTAAGGTTTGTAACCAGGACAA  1134
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTAAACTTTGAGCAGGGAGGGTGTTTTAAGGTTTGTAACCAGGACAA  1146

seq1  GTTTAGGAGTTGGCACAGTTTGCTCTGCCCTTGAATTC  1172
      ||||||||||||||||||||||||||||||||||||||
seq2  GTTTAGGAGTTGGCACAGTTTGCTCTGCCCTTGAATTC  1184

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information