MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-256P05
Chromosome	4 (Build37)
Map Location	125,175,693 - 125,330,233
singlet/doublet	doublet
Overlap gene	Grik3, Ftl2
Upstream gene	LOC100039332, Pou3f1, Utp11l, Fhl3, Sf3a3, LOC664991, Inpp5b, LOC100039433, Mtf1, Yrdc, Gm50, Epha10, Cdca8, 9930104L06Rik, Rspo1, Gnl2, Dnali1, Snip1, 2310005N01Rik, Zc3h12a, LOC100039298
Downstream gene	Csf3r, Mrps15, 1810007P19Rik, LOC100039645, Lsm10, Stk40, 2610027C15Rik, 1700029G01Rik, Thrap3, Mtap7d1, Trappc3, Col8a2, EG667193, Adprhl2, Tekt2, Eif2c3, Eif2c1, LOC100039351, Eif2c4, Clspn, LOC665197, 5730409E04Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039332 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Pou3f1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18991 MGI:101896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Utp11l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67205 MGI:1914455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fhl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14201 MGI:1341092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sf3a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75062 MGI:1922312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664991 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Inpp5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16330 MGI:103257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039433 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Mtf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17764 MGI:101786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Yrdc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230734 MGI:2387201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215090 MGI:2684896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Epha10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230735 MGI:3586824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdca8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52276 MGI:1196274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9930104L06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194268 MGI:3041172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rspo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192199 MGI:2183426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230737 MGI:2385207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnali1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75563 MGI:1922813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76793 MGI:2156003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310005N01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70088 MGI:1917338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zc3h12a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230738 MGI:2385891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039298 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039298
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Grik3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14807 MGI:95816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ftl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14337 MGI:95590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csf3r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12986 MGI:1339755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66407 MGI:1913657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810007P19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230751 MGI:1916308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039645 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 1315 ESTs, 6 Proteins

name	Lsm10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116748 MGI:2151045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stk40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74178 MGI:1921428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610027C15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230752 MGI:1922063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700029G01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66938 MGI:1914188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thrap3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230753 MGI:2442637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtap7d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245877 MGI:2384297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trappc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27096 MGI:1351486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col8a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329941 MGI:88464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667193 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667193 MGI:3643537
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Adprhl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100206 MGI:2140364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tekt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24084 MGI:1346335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif2c3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214150 MGI:2446634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif2c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236511 MGI:2446630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039351 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Eif2c4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76850 MGI:1924100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clspn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269582 MGI:2445153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665197 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins pseudo : _no_value

name	5730409E04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230757 MGI:3609248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039332 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253097 GeneID:100039332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039332 transcript_id : XM_001472948.1

name	Pou3f1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106382 GeneID:18991 MGI:101896
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : POU domain, class 3, transcription factor 1 transcript_id : NM_011141.1

name	Utp11l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373827 GeneID:67205 MGI:1914455
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast) transcript_id : NM_026031.2

name	Fhl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130488505 GeneID:14201 MGI:1341092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : four and a half LIM domains 3 transcript_id : NM_010213.2

name	Sf3a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249078 GeneID:75062 MGI:1922312
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor 3a, subunit 3 transcript_id : NM_029157.3

name	Inpp5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30231212 GeneID:16330 MGI:103257
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol polyphosphate-5-phosphatase B transcript_id : NM_008385.3

name	LOC100039433 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253101 GeneID:100039433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical protein LOC100039433 transcript_id : XM_001473153.1

name	Mtf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362528 GeneID:17764 MGI:101786
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : metal response element binding transcription factor 1 transcript_id : NM_008636.3

name	Yrdc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956353 GeneID:230734 MGI:2387201
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : yrdC domain containing (E.coli) transcript_id : NM_153566.1

name	Gm50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56090559 GeneID:215090 MGI:2684896
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 50, (NCBI) transcript_id : NM_001007573.1

name	Epha10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364312 GeneID:230735 MGI:3586824
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Eph receptor A10 transcript_id : NM_177671.4

name	Cdca8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375934 GeneID:52276 MGI:1196274
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle associated 8 transcript_id : NM_026560.3

name	9930104L06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145556 GeneID:194268 MGI:3041172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9930104L06 gene transcript_id : NM_177573.3

name	Rspo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149775 GeneID:192199 MGI:2183426
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : R-spondin homolog (Xenopus laevis) transcript_id : NM_138683.1

name	Gnl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704087 GeneID:230737 MGI:2385207
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein-like 2 (nucleolar) transcript_id : NM_145552.1

name	Dnali1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352308 GeneID:75563 MGI:1922813
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein, axonemal, light intermediate polypeptide 1 transcript_id : NM_175223.3

name	Snip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377792 GeneID:76793 MGI:2156003
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Smad nuclear interacting protein 1 transcript_id : NM_175246.3

name	2310005N01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371828 GeneID:70088 MGI:1917338
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310005N01 gene transcript_id : NM_027310.2

name	Zc3h12a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24233518 GeneID:230738 MGI:2385891
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger CCCH type containing 12A transcript_id : NM_153159.1

name	LOC100039298 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253095 GeneID:100039298
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to cyclic nucleotide gated channel beta 1 transcript_id : XM_001472625.1

name	Grik3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487363 GeneID:14807 MGI:95816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, kainate 3 transcript_id : NM_001081097.1

name	Ftl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130485276 GeneID:14337 MGI:95590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ferritin light chain 2 transcript_id : NM_008049.2

name	Csf3r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681050 GeneID:12986 MGI:1339755
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : colony stimulating factor 3 receptor (granulocyte) transcript_id : NM_007782.1

name	Mrps15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48526511 GeneID:66407 MGI:1913657
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S15 transcript_id : NM_025544.2

name	1810007P19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244065 GeneID:230751 MGI:1916308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810007P19 gene transcript_id : NM_172701.2

name	LOC100039645 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253109 GeneID:100039645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 1315 ESTs, 6 Proteins product : similar to ribosomal protein L28 transcript_id : XM_001473710.1

name	Lsm10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20270250 GeneID:116748 MGI:2151045
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : U7 snRNP-specific Sm-like protein LSM10 transcript_id : NM_138721.1

name	Stk40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560066 GeneID:74178 MGI:1921428
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 40 transcript_id : NM_028800.2

name	2610027C15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353701 GeneID:230752 MGI:1922063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610027C15 gene transcript_id : NM_172145.3

name	1700029G01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130252 GeneID:66938 MGI:1914188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700029G01 gene transcript_id : NM_025856.2

name	Thrap3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68533245 GeneID:230753 MGI:2442637
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thyroid hormone receptor associated protein 3 transcript_id : NM_146153.3

name	Mtap7d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542191 GeneID:245877 MGI:2384297
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein 7 domain containing 1 transcript_id : NM_144941.2

name	Trappc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560502 GeneID:27096 MGI:1351486
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trafficking protein particle complex 3 transcript_id : NM_013718.2

name	Col8a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130942 GeneID:329941 MGI:88464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type VIII, alpha 2 transcript_id : NM_199473.2

name	EG667193 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372516 GeneID:667193 MGI:3643537
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG667193 transcript_id : XM_988918.1

name	Adprhl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129802 GeneID:100206 MGI:2140364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylhydrolase like 2 transcript_id : NM_133883.2

name	Tekt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755766 GeneID:24084 MGI:1346335
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tektin 2 transcript_id : NM_011902.1

name	Eif2c3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23510274 GeneID:214150 MGI:2446634
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2C, 3 transcript_id : NM_153402.1

name	Eif2c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23510268 GeneID:236511 MGI:2446630
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2C, 1 transcript_id : NM_153403.1

name	LOC100039351 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253099 GeneID:100039351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Ep400 protein transcript_id : XM_001472738.1

name	Eif2c4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68448546 GeneID:76850 MGI:1924100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2C, 4 transcript_id : NM_153177.2

name	Clspn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34330171 GeneID:269582 MGI:2445153
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claspin homolog (Xenopus laevis) transcript_id : NM_175554.3

name	5730409E04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345197 GeneID:230757 MGI:3609248
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730409E04Rik gene transcript_id : NM_001013755.2

name	LOC100039332 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253098 GeneID:100039332
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472998.1

name	Pou3f1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106383 GeneID:18991 MGI:101896
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0042552 - myelination [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : octamer binding factor oct6 product : POU domain, class 3, transcription factor 1 protein_id : NP_035271.1

name	Utp11l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385534 CCDS:CCDS18623.1 GeneID:67205 MGI:1914455
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] [Evidence ISS]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0048011 - nerve growth factor receptor signaling pathway [Evidence ISS]; GO:0007399 - nervous system development [Evidence ISS]; GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 note : novel protein similar to Cgi-94 product : UTP11-like, U3 small nucleolar ribonucleoprotein protein_id : NP_080307.1

name	Fhl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130488506 GeneID:14201 MGI:1341092
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0001725 - stress fiber [Evidence IDA]; GO:0030018 - Z disc [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IDA] codon_start : 1 product : four and a half LIM domains 3 protein_id : NP_034343.2

name	Sf3a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22095003 GeneID:75062 MGI:1922312
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : splicing factor 3a, subunit 3 protein_id : NP_083433.1

name	Inpp5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30231213 GeneID:16330 MGI:103257
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004445 - inositol-polyphosphate 5-phosphatase activity [Evidence ISS] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : inositol polyphosphate-5-phosphatase, 75 kDa product : inositol polyphosphate-5-phosphatase B protein_id : NP_032411.3

name	LOC100039433 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253102 GeneID:100039433
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473203.1

name	Mtf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543269 CCDS:CCDS18627.1 GeneID:17764 MGI:101786
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA]; GO:0042156 - zinc-mediated transcriptional activator activity [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : metalloregulatory transcription factor; thymic lymphoma susceptibility product : metal response element binding transcription factor 1 protein_id : NP_032662.2

name	Yrdc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956354 CCDS:CCDS18628.1 GeneID:230734 MGI:2387201
definition	GO_component : GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0051051 - negative regulation of transport [Evidence ISS] codon_start : 1 exception : mismatches in translation product : yrdC domain containing protein_id : NP_705794.1

name	Gm50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56090560 CCDS:CCDS18629.1 GeneID:215090 MGI:2684896
definition	codon_start : 1 note : novel protein similar to mannosidase, endo-alpha Manea product : hypothetical protein LOC215090 protein_id : NP_001007574.1

name	Epha10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626015 CCDS:CCDS18630.1 GeneID:230735 MGI:3586824
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005003 - ephrin receptor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 product : Eph receptor A10 protein_id : NP_808339.2

name	Cdca8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50878279 CCDS:CCDS18631.1 GeneID:52276 MGI:1196274
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0043234 - protein complex [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : embryonic stem cell-related protein_id : NP_080836.2

name	9930104L06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145557 GeneID:194268 MGI:3041172
definition	codon_start : 1 product : hypothetical protein LOC194268 protein_id : NP_808241.2

name	Rspo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149776 CCDS:CCDS18633.1 GeneID:192199 MGI:2183426
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : thrombospondin type 1 domain containing gene Rspondin product : thrombospondin type 1 domain containing protein_id : NP_619624.1

name	Gnl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704088 CCDS:CCDS18634.1 GeneID:230737 MGI:2385207
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : testicular antigen product : guanine nucleotide binding protein-like 2 (nucleolar) protein_id : NP_663527.1

name	Dnali1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30172570 CCDS:CCDS18635.1 GeneID:75563 MGI:1922813
definition	codon_start : 1 product : axonemal dynein light chain (hp28) homolog protein_id : NP_780432.1

name	Snip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424886 CCDS:CCDS18636.1 GeneID:76793 MGI:2156003
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007249 - I-kappaB kinase/NF-kappaB cascade [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] codon_start : 1 exception : mismatches in translation product : Smad nuclear interacting protein 1 protein_id : NP_780455.1

name	2310005N01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312536 CCDS:CCDS18637.1 GeneID:70088 MGI:1917338
definition	codon_start : 1 product : hypothetical protein LOC70088 protein_id : NP_081586.1

name	Zc3h12a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24233519 CCDS:CCDS18638.1 GeneID:230738 MGI:2385891
definition	codon_start : 1 note : MCP-1 treatment-induced protein product : zinc finger CCCH type containing 12A protein_id : NP_694799.1

name	LOC100039298 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253096 GeneID:100039298
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472675.1

name	Grik3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487364 GeneID:14807 MGI:95816
definition	GO_component : GO:0008328 - ionotropic glutamate receptor complex [Evidence IC]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005234 - glutamate-gated ion channel activity [Evidence IEA]; GO:0042802 - identical protein binding [Evidence TAS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004970 - ionotropic glutamate receptor activity [Evidence TAS] [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA] codon_start : 1 product : glutamate receptor 7 protein_id : NP_001074566.1

name	Ftl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130485277 GeneID:14337 MGI:95590
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008199 - ferric iron binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006879 - iron ion homeostasis [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA] codon_start : 1 product : ferritin light chain 2 protein_id : NP_032075.2

name	Csf3r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681051 CCDS:CCDS18640.1 GeneID:12986 MGI:1339755
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0030593 - neutrophil chemotaxis [Evidence IMP] codon_start : 1 exception : mismatches in translation product : colony stimulating factor 3 receptor protein_id : NP_031808.1

name	Mrps15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:48526512 CCDS:CCDS18641.1 GeneID:66407 MGI:1913657
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein S15 protein_id : NP_079820.2

name	1810007P19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244066 GeneID:230751 MGI:1916308
definition	codon_start : 1 note : organic solute carrier protein 1; novel protein similar to oxidored-nitro domain-containing protein NOR1; organic solute carrier 1 product : oxidored-nitro domain-containing protein protein_id : NP_766289.2

name	LOC100039645 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253110 GeneID:100039645
definition	codon_start : 1 product : similar to ribosomal protein L28 protein_id : XP_001473760.1

name	Lsm10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270251 CCDS:CCDS18642.1 GeneID:116748 MGI:2151045
definition	GO_component : GO:0015030 - Cajal body [Evidence ISS]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005683 - snRNP U7 [Evidence ISS] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0017069 - snRNA binding [Evidence ISS] GO_process : GO:0006398 - histone mRNA 3'-end processing [Evidence TAS]; GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : U7 snRNP-specific Sm-like protein LSM10 protein_id : NP_620046.1

name	Stk40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560067 GeneID:74178 MGI:1921428
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : serine/threonine kinase 40 protein_id : NP_083076.2

name	2610027C15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26024305 CCDS:CCDS18643.1 GeneID:230752 MGI:1922063
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : hypothetical protein LOC230752 protein_id : NP_742157.1

name	1700029G01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859688 CCDS:CCDS18644.1 GeneID:66938 MGI:1914188
definition	codon_start : 1 note : novel protein containing SH3 domains product : hypothetical protein LOC66938 protein_id : NP_080132.1

name	Thrap3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68533246 CCDS:CCDS18645.1 GeneID:230753 MGI:2442637
definition	GO_component : GO:0000119 - mediator complex [Evidence IDA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IC] codon_start : 1 product : thyroid hormone receptor associated protein 3 protein_id : NP_666265.3

name	Mtap7d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542192 CCDS:CCDS18646.1 GeneID:245877 MGI:2384297
definition	codon_start : 1 exception : mismatches in translation note : arginine/proline rich coiled-coil 1 product : proline arginine rich coiled coil 1 protein_id : NP_659190.2

name	Trappc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304929 CCDS:CCDS18647.1 GeneID:27096 MGI:1351486
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0000139 - Golgi membrane [Evidence IDA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : Bet3 homolog product : trafficking protein particle complex 3 protein_id : NP_038746.1

name	EG667193 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94372517 GeneID:667193 MGI:3643537
definition	codon_start : 1 product : hypothetical protein protein_id : XP_994012.1

name	Col8a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41054950 CCDS:CCDS18649.1 GeneID:329941 MGI:88464
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0050673 - epithelial cell proliferation [Evidence IGI]; GO:0048595 - eye morphogenesis (sensu Mammalia) [Evidence IGI]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 note : endothelial collagen; procollagen type VIII alpha 2 product : procollagen, type VIII, alpha 2 protein_id : NP_955767.1

name	Adprhl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28916671 CCDS:CCDS18650.1 GeneID:100206 MGI:2140364
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : ADP-ribosylhydrolase 2 product : ecto ADP-ribosylhydrolase protein_id : NP_598644.1

name	Tekt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755767 CCDS:CCDS18651.1 GeneID:24084 MGI:1346335
definition	GO_component : GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0001539 - ciliary or flagellar motility [Evidence IMP]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IEA]; GO:0030317 - sperm motility [Evidence IMP] codon_start : 1 exception : mismatches in translation product : tektin 2 protein_id : NP_036032.1

name	Eif2c3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510275 CCDS:CCDS18652.1 GeneID:214150 MGI:2446634
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation function : siRNA-mediated RNAi note : argonaute 3; Piwi/Argonaute family protein meIF2C3 product : eukaryotic translation initiation factor 2C, 3 protein_id : NP_700451.1

name	Eif2c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510269 CCDS:CCDS18653.1 GeneID:236511 MGI:2446630
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation function : siRNA mediated RNAi note : Piwi/Argonaute family protein meIF2C1; argonaute 1 product : eukaryotic translation initiation factor 2C, 1 protein_id : NP_700452.1

name	LOC100039351 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253100 GeneID:100039351
definition	codon_start : 1 product : similar to Ep400 protein protein_id : XP_001472788.1

name	Eif2c4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68448547 CCDS:CCDS18654.1 GeneID:76850 MGI:1924100
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : argonaute 4 product : Piwi/Argonaute family protein meIF2C4 protein_id : NP_694817.2

name	Clspn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34330172 CCDS:CCDS18655.1 GeneID:269582 MGI:2445153
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0000217 - DNA secondary structure binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0000076 - DNA replication checkpoint [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : claspin protein_id : NP_780763.2

name	5730409E04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701450 CCDS:CCDS18656.1 GeneID:230757 MGI:3609248
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC230757 protein_id : NP_001013777.1

name	LOC664991 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664991
definition	number : 1 pseudo : _no_value

name	LOC665197 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253115 GeneID:665197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins product : similar to hCG1787519 pseudo : _no_value transcript_id : XR_031684.1

clone name	MSMg01-290G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059N13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-384P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488H24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-376E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328C01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-303B18
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-143M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227E14
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-256P05.b	B6Ng01-256P05.g
ACC	GA062778	GA062779
length	1,061	436
definition	B6Ng01-256P05.b	B6Ng01-256P05.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(125,175,693 - 125,176,767)	(125,329,792 - 125,330,233)
sequence	gaattctggtcagccagcccttcttaaatagggtgttcaatgcttgtttc ttggactggtcggtagggacgggagatggtctgtggctgggtcagaggac agacgttgctggctcttttgagagacgccaggtaacacgaaggcaaaagc tggggaggaagtcctcatgatggtctgaggataggagataatgaacccag cagaactgggggtggtgtcaagcctctactccgatcctttggtgctgtac tgaatggtggttaaggacggcagagagaaaaggagtgaagtgctgagatc cctgtttgtgtcaagagggttccagtccataggagacaattaagtctcct gctattcaagacaggcttctggtagaaggggttttatagagttctcagaa aaactgcaggaacgagctctttaaatatggctacgctggggacctctgca aagcccccctgcctccgctttgcagaactgaatgcgctattcctaagagc tgcccaattgggcagaaaagcgggagcggaaagccaaggacttcccaggg ctccaagcatcccatttcctgtctccggtgaagaagcaggctgcagagaa ctccaggggtcactctgggcttctggttctcctgtattagcattcatcag aatcacagagaacactttcaaacacagacagccaggaccccaacccccaa aaggttgccactcagctggtctggggtgaagtctatggagttgccaaagt gagtgctactggcctggggatttgctgtagcccatctctacctgaagacc ataggcagtctcaggagctcactgcttctagggccctcctgttctttagt gcagcattggctgcagatggccctccctcaagccgtaacacacatctgcc tgcagttctggggagttgatgggaccctatctctggaaacatgaactcta gcatccactatctgggcttaaatccctcctctctgcctgctgctgtgtga gtgatgactcatagtgagattccctcacctgtgaaggcaaaaagtccgct ttccaatcata	caggccagcctggctacttcctgagactgccccaagccatcctcaccccc acctaaaaagtaggtaggtgaaaggtatcctaactcagaggcagcaccct ggaggcccagacagctgcaaaacaaaaggtacttgatccagctaccaacc ccactggtctgcaggccctaaaagaggtgggtgaagtgcccagtaccatg cctgtgtgcacggccatgactgagtattatgggctatatataactttgtg ggttctggaacccaataggctcctgcaaatggaactggtcctcaactggg aaggagtagcagacctttgggcaaggccaggctcccagaggaagtttata ggagagagttacaattactacccttagggagtcccttgaacttccattgc caccctacgaagtgtgtgtgtgtgtgtgtggggggg
quality values	Open. Hide. 58 26 27 35 58 54 39 58 38 54 39 24 62 62 41 31 62 62 62 62 62 62 62 62 54 62 62 62 62 47 62 51 42 26 30 27 50 28 21 21 44 62 62 62 62 62 62 62 62 62 62 62 62 62 59 47 62 62 62 62 62 62 62 62 62 59 62 62 59 44 62 62 62 59 59 59 46 49 38 56 56 54 62 62 59 59 62 62 62 62 62 62 62 62 51 59 59 62 59 59 62 59 59 62 59 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 54 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 45 39 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 54 58 54 54 58 58 58 54 58 58 58 58 58 58 54 54 58 58 58 54 58 58 53 58 52 58 58 58 58 58 58 52 58 58 58 58 58 58 54 58 49 58 58 58 58 50 58 58 58 58 58 50 58 58 58 58 58 49 51 51 58 40 51 51 58 34 43 58 58 58 58 51 49 53 58 58 58 58 52 53 28 58 54 58 50 58 58 58 50 49 58 58 58 51 51 51 58 53 53 54 53 53 39 51 50 49 58 51 34 58 58 40 58 50 32 58 49 58 58 51 53 40 58 31 58 50 31 58 58 53 40 50 58 58 58 50 52 52 51 58 58 49 58 58 58 53 58 54 54 50 58 54 50 53 53 53 52 54 52 58 42 31 53 42 42 42 51 42 41 53 53 40 54 53 49 11 54 50 45 53 40 53 53 52 54 31 49 49 40 39 38 51 54 54 39 24 53 50 39 40 53 45 38 35 52 42 49 44 49 37 54 41 51 45 54 44 51 39 42 54 54 54 54 38 23 54 54 45 45 49 23 53 53 42 44 37 35 54 53 38 37 53 34 30 54 32 53 42 47 54 54 54 43 53 46 42 30 32 53 39 45 34 46 47 53 28 31 35 40 31 45 32 53 40 33 32 35 37 28 34 41 32 42 39 40 32 53 53 41 41 39 32 41 46 41 12 15 51 30 32 42 36 42 31 31 25 51 51 31 30 31 38 34 41 37 33 31 35 30 31 42 42 28 29 17 36 35 43 36 6 46 27 30 33 36 37 31 36 9 10 10 6 13 36 32 32 30 31 28 37 34 33 32 31 31 30 33 47 32 21 47 33 32 31 39 24 38 33 27 37 26 48 31 35 17 27 43 32 32 24 32 32 41 35 34 37 28 29 31 35 31 13 31 20 28 31 23 48 33 31 33 44 28 20 29 20 24 31 31 30 18 33 30 22 32 25 34 32 32 32 37 21 21 28 21 25 31 31 32 23 14 30 29 32 18 23 43 39 26 10 4 5 11 17 32 21 32 43 25 20 18 48 32 21 32 34 31 30 31 24 17 28 9 39 9 24 20 26 21 15 17 31 33 25 22 27 16 27 18 23 8 18 20 3 14 28 28 16 19 15 47 11 11 3 10 16 40 25 11 14 40 13 5 10 22 12 5 5 8 3 13 21 13 21 11 21 7 18 21 3 7 8 11 16 8 38 15 24 19 16 17 23 22 9 23 25 20 10 23 9 8 19 15 5 18 4 5 21 26 13 15 16 6 9 20 7 16 6 11 15 7 5 5 1 3 25 30 30 20 12 7 6 10 5 20 17 28 17 11 10 7 7 21 20 13 10 2	Open. Hide. 44 41 62 62 39 44 21 28 45 45 34 33 31 45 59 56 59 62 62 62 62 62 62 59 46 59 59 62 62 62 62 62 62 59 62 62 62 59 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 54 59 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 56 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 54 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 49 49 58 58 58 58 47 25

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_125175693_125176767
seq2: B6Ng01-256P05.b_45_1105

seq1  GAATTCTGGTCAGCCAGCCCTTCTTAAATAGGGTGTTCAATGCTTGTTTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGGTCAGCCAGCCCTTCTTAAATAGGGTGTTCAATGCTTGTTTC  50

seq1  TTGGACTGGTCGGTAGGGACGGGAGATGGTCTGTGGCTGGGTCAGAGGAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGACTGGTCGGTAGGGACGGGAGATGGTCTGTGGCTGGGTCAGAGGAC  100

seq1  AGACGTTGCTGGCTCTTTTGAGAGACGCCAGGTAACACGAAGGCAAAAGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACGTTGCTGGCTCTTTTGAGAGACGCCAGGTAACACGAAGGCAAAAGC  150

seq1  TGGGGAGGAAGTCCTCATGATGGTCTGAGGATAGGAGATAATGAACCCAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGAGGAAGTCCTCATGATGGTCTGAGGATAGGAGATAATGAACCCAG  200

seq1  CAGAACTGGGGGTGGTGTCAAGCCTCTACTCCGATCCTTTGGTGCTGTAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAACTGGGGGTGGTGTCAAGCCTCTACTCCGATCCTTTGGTGCTGTAC  250

seq1  TGAATGGTGGTTAAGGACGGCAGAGAGAAAAGGAGTGAAGTGCTGAGATC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATGGTGGTTAAGGACGGCAGAGAGAAAAGGAGTGAAGTGCTGAGATC  300

seq1  CCTGTTTGTGTCAAGAGGGTTCCAGTCCATAGGAGACAATTAAGTCTCCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTTTGTGTCAAGAGGGTTCCAGTCCATAGGAGACAATTAAGTCTCCT  350

seq1  GCTATTCAAGACAGGCTTCTGGTAGAAGGGGTTTTATAGAGTTCTCAGAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTATTCAAGACAGGCTTCTGGTAGAAGGGGTTTTATAGAGTTCTCAGAA  400

seq1  AAACTGCAGGAACGAGCTCTTTAAATATGGCTACGCTGGGGACCTCTGCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTGCAGGAACGAGCTCTTTAAATATGGCTACGCTGGGGACCTCTGCA  450

seq1  AAGCCCCCCTGCCTCCGCTTTGCAGAACTGAATGCGCTATTCCTAAGAGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCCCCCCTGCCTCCGCTTTGCAGAACTGAATGCGCTATTCCTAAGAGC  500

seq1  TGCCCAATTGGGCAGAAAAGCGGGAGCGGAAAGCCAAGGACTTCCCAGGG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCCAATTGGGCAGAAAAGCGGGAGCGGAAAGCCAAGGACTTCCCAGGG  550

seq1  CTCCAAGCATCCCATTTCCTGTCTCCGGTGAAGAAGCAGGCTGCAGAGAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCAAGCATCCCATTTCCTGTCTCCGGTGAAGAAGCAGGCTGCAGAGAA  600

seq1  CTCCAGGGGTCACTCTGGGCTTCTGGTTCTCCTGTATTAGCATTCATCAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCAGGGGTCACTCTGGGCTTCTGGTTCTCCTGTATTAGCATTCATCAG  650

seq1  AATCACAGAGAACACTTTCAAACACAGACAGCCAGGACCCCAACCCCCAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCACAGAGAACACTTTCAAACACAGACAGCCAGGACCCCAACCCCCAA  700

seq1  AAGGTTGCCACTCAGCTGGTCTGGGGTGAAGTCTATGGAGTTGCCAAAGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGTTGCCACTCAGCTGGTCTGGGGTGAAGTCTATGGAGTTGCCAAAGT  750

seq1  GAGTGCTACTGGCCTGGGGATTTGCTGTAGCCCATCTCTACCTGAAGACC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGCTACTGGCCTGGGGATTTGCTGTAGCCCATCTCTACCTGAAGACC  800

seq1  ATAGGCAGTCTCAGGGAGCTCACTGCTTCTAGGGCCCTCCTGTTCTTTAG  850
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  ATAGGCAGTCTCA-GGAGCTCACTGCTTCTAGGGCCCTCCTGTTCTTTAG  849

seq1  TGCAGCATTGGCTGCAGATGGCCCTCCCTCAAGCCGTAACACACATCTGC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAGCATTGGCTGCAGATGGCCCTCCCTCAAGCCGTAACACACATCTGC  899

seq1  CTGCAGTTCTGGGGAGGTGATGGGACCCTATCTCTGG-AACATGAACTCT  949
      |||||||||||||||| |||||||||||||||||||| ||||||||||||
seq2  CTGCAGTTCTGGGGAGTTGATGGGACCCTATCTCTGGAAACATGAACTCT  949

seq1  AGCATCCAACTATCTGGCCTTAAAATCCCTTCCTTCCTTCCTGCCTGCCT  999
      ||||||| ||||||||| ||||||      ||| ||||  ||||||| ||
seq2  AGCATCC-ACTATCTGGGCTTAAA------TCCCTCCTCTCTGCCTG-CT  991

seq1  GCCTGTGTGAAGTTGGATGACTCATAGTGGAGAATCCCTCACCTGTGAAA  1049
      | ||||||| |||  ||||||||||||| |||| ||||||||||||||| 
seq2  G-CTGTGTG-AGT--GATGACTCATAGT-GAGATTCCCTCACCTGTGAA-  1035

seq1  GGGGAAAAAGT-CGCTTTCACATCATA  1075
       || ||||||| |||||||  ||||||
seq2  -GGCAAAAAGTCCGCTTTCCAATCATA  1061

seq1: chr4_125329792_125330233
seq2: B6Ng01-256P05.g_64_505 (reverse)

seq1  CCCCCCCACACACACACACACACACTTCGTAGGGTGGCAATGGAAGTTCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCCCCACACACACACACACACACTTCGTAGGGTGGCAATGGAAGTTCA  50

seq1  AGGGACTCCCTAAGGGTAGTAATTGTAACTCTCTCCTATAAACTTCCTCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGACTCCCTAAGGGTAGTAATTGTAACTCTCTCCTATAAACTTCCTCT  100

seq1  GGGAGCCTGGCCTTGCCCAAAGGTCTGCTACTCCTTCCCAGTTGAGGACC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGCCTGGCCTTGCCCAAAGGTCTGCTACTCCTTCCCAGTTGAGGACC  150

seq1  AGTTCCATTTGCAGGAGCCTATTGGGTTCCAGAACCCACAAAGTTATATA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCCATTTGCAGGAGCCTATTGGGTTCCAGAACCCACAAAGTTATATA  200

seq1  TAGCCCATAATACTCAGTCATGGCCGTGCACACAGGCATGGTACTGGGCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCCCATAATACTCAGTCATGGCCGTGCACACAGGCATGGTACTGGGCA  250

seq1  CTTCACCCACCTCTTTTAGGGCCTGCAGACCAGTGGGGTTGGTAGCTGGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCACCCACCTCTTTTAGGGCCTGCAGACCAGTGGGGTTGGTAGCTGGA  300

seq1  TCAAGTACCTTTTGTTTTGCAGCTGTCTGGGCCTCCAGGGTGCTGCCTCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGTACCTTTTGTTTTGCAGCTGTCTGGGCCTCCAGGGTGCTGCCTCT  350

seq1  GAGTTAGGATACCTTTCACCTACCTACTTTTTAGGTGGGGGTGAGGATGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTTAGGATACCTTTCACCTACCTACTTTTTAGGTGGGGGTGAGGATGG  400

seq1  CTTGGGGCAGTCTCAGGAAGTAGCCAGGCTGGCCTGGAATTC  442
      ||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGGGGCAGTCTCAGGAAGTAGCCAGGCTGGCCTGGAATTC  442

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information