MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-257B04
Chromosome	4 (Build37)
Map Location	60,146,850 - 60,147,891
singlet/doublet	singlet
Overlap gene	none
Upstream gene	AI481877, LOC433712, Ugcg, LOC100041535, LOC634731, LOC666719, Rod1, Hsdl2, E130308A19Rik, LOC100041592, 1110054O05Rik, Snx30, Slc46a2, LOC100041656, Mup4, LOC620807, LOC100041658, LOC620846
Downstream gene	Mup2, LOC620882, LOC100041687, LOC667221, LOC100038948, LOC620997, Mup1, LOC620942, LOC100039008, LOC100039028, LOC620982, LOC100039054, LOC100039063, LOC667234, LOC100039089, LOC667239, LOC100039116, LOC667242, LOC100039150, LOC100039019
Link	Open Mouse BAC browser

Click to get alignment info.

name	AI481877 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100155 MGI:2140313
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins

name	LOC433712 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433712
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 mRNAs, 915 ESTs, 6 Proteins

name	Ugcg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22234 MGI:1332243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041535 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC634731 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	LOC666719 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666719
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Rod1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230257 MGI:1923334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Hsdl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72479 MGI:1919729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E130308A19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230259 MGI:2442164
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100041592 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041592
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	1110054O05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66209 MGI:1913459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209131 MGI:2443882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc46a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30936 MGI:1353616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041656 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Mup4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17843 MGI:97236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620807 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620807
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041658 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041658
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 585 ESTs, 1 Protein

name	LOC620846 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620846
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	Mup2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17841 MGI:97234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC620882 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins pseudo : _no_value

name	LOC100041687 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 574 ESTs, 1 Protein

name	LOC667221 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	LOC100038948 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038948
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 586 ESTs, 1 Protein

name	LOC620997 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	Mup1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17840 MGI:97233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620942 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 17 Proteins pseudo : _no_value

name	LOC100039008 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039008
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 592 ESTs, 1 Protein

name	LOC100039028 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039028
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 565 ESTs, 1 Protein

name	LOC620982 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 21 Proteins pseudo : _no_value

name	LOC100039054 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039054
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 578 ESTs, 1 Protein

name	LOC100039063 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 17 Proteins pseudo : _no_value

name	LOC667234 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667234
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	LOC100039089 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 570 ESTs, 1 Protein

name	LOC667239 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667239
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins pseudo : _no_value

name	LOC100039116 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039116
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 588 ESTs, 1 Protein

name	LOC667242 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins pseudo : _no_value

name	LOC100039150 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 586 ESTs, 1 Protein

name	LOC100039019 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 21 Proteins pseudo : _no_value

name	AI481877 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252424 GeneID:100155 MGI:2140313
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins product : expressed sequence AI481877 transcript_id : XM_001476641.1

name	LOC433712 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94371879 GeneID:433712
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 mRNAs, 915 ESTs, 6 Proteins product : similar to 67 kda laminin receptor transcript_id : XM_620036.3

name	Ugcg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892814 GeneID:22234 MGI:1332243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-glucose ceramide glucosyltransferase transcript_id : NM_011673.3

name	LOC100041535 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252420 GeneID:100041535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041535 transcript_id : XM_001476771.1

name	LOC634731 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252426 GeneID:634731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : similar to sushi domain containing 1 transcript_id : XM_988632.2

name	Rod1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142389023 GeneID:230257 MGI:1923334
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ROD1 regulator of differentiation 1 (S. pombe) transcript_id : NM_178164.2

name	Rod1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450284 GeneID:230257 MGI:1923334
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ROD1 regulator of differentiation 1 (S. pombe) transcript_id : NM_144904.1

name	Hsdl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125656149 GeneID:72479 MGI:1919729
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxysteroid dehydrogenase like 2 transcript_id : NM_024255.2

name	E130308A19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62821810 GeneID:230259 MGI:2442164
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E130308A19 gene transcript_id : NM_001015681.1

name	E130308A19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370765 GeneID:230259 MGI:2442164
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E130308A19 gene transcript_id : NM_153158.2

name	1110054O05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62526127 GeneID:66209 MGI:1913459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110054O05 gene transcript_id : NM_001013577.1

name	Snx30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781798 GeneID:209131 MGI:2443882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin family member 30 transcript_id : NM_172468.2

name	Slc46a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386973 GeneID:30936 MGI:1353616
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 46, member 2 transcript_id : NM_021053.3

name	Mup4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678967 GeneID:17843 MGI:97236
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : major urinary protein 4 transcript_id : NM_008648.1

name	LOC620807 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:124486864 GeneID:620807
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : novel member of the major urinary protein (Mup) gene family transcript_id : NM_001081285.1

name	LOC100041658 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252428 GeneID:100041658
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 585 ESTs, 1 Protein product : similar to major urinary protein 1 transcript_id : XM_001476969.1

name	Mup2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930711 GeneID:17841 MGI:97234
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : major urinary protein 2 transcript_id : NM_008647.3

name	Mup2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930713 GeneID:17841 MGI:97234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : major urinary protein 2 transcript_id : NM_001045550.1

name	LOC100041687 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252431 GeneID:100041687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 574 ESTs, 1 Protein product : similar to major urinary protein 1 transcript_id : XM_001477004.1

name	LOC100038948 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252529 GeneID:100038948
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 586 ESTs, 1 Protein product : similar to major urinary protein 1 transcript_id : XM_001471958.1

name	Mup1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13654244 GeneID:17840 MGI:97233
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : major urinary protein 1 transcript_id : NM_031188.1

name	LOC100039008 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252532 GeneID:100039008
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 592 ESTs, 1 Protein product : similar to major urinary protein 1 transcript_id : XM_001472055.1

name	LOC100039028 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252535 GeneID:100039028
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 565 ESTs, 1 Protein product : similar to major urinary protein 1 transcript_id : XM_001472078.1

name	LOC100039054 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252539 GeneID:100039054
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 578 ESTs, 1 Protein product : similar to major urinary protein 1 transcript_id : XM_001472149.1

name	LOC100039089 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252542 GeneID:100039089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 570 ESTs, 1 Protein product : similar to major urinary protein 1 transcript_id : XM_001472190.1

name	LOC100039116 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252546 GeneID:100039116
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 588 ESTs, 1 Protein product : similar to major urinary protein 1 transcript_id : XM_001472209.1

name	LOC100039150 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252551 GeneID:100039150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 586 ESTs, 1 Protein product : similar to major urinary protein 1 transcript_id : XM_001472263.1

name	LOC433712 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:63514363 GeneID:433712
definition	codon_start : 1 product : similar to 67 kda laminin receptor protein_id : XP_620036.1

name	Ugcg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106443 CCDS:CCDS18219.1 GeneID:22234 MGI:1332243
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008120 - ceramide glucosyltransferase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 note : ectoplacental cone, invasive trophoblast giant cells, extraembryonic ectoderm and chorion sequence 21; UDP-glucose ceramide glucosyltransferase-like product : UDP-glucose ceramide glucosyltransferase protein_id : NP_035803.1

name	LOC100041535 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252421 GeneID:100041535
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476821.1

name	LOC634731 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252427 GeneID:634731
definition	codon_start : 1 product : hypothetical protein protein_id : XP_993726.2

name	Rod1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450285 CCDS:CCDS18220.1 GeneID:230257 MGI:1923334
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : ROD1 regulator of differentiation 1 isoform 1 protein_id : NP_659153.1

name	Rod1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30039680 CCDS:CCDS18221.1 GeneID:230257 MGI:1923334
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : ROD1 regulator of differentiation 1 isoform 2 protein_id : NP_835458.1

name	Hsdl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125656150 GeneID:72479 MGI:1919729
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : hydroxysteroid dehydrogenase-like 2 protein product : hydroxysteroid dehydrogenase like 2 protein_id : NP_077217.2

name	E130308A19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62821811 CCDS:CCDS18223.1 GeneID:230259 MGI:2442164
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC230259 isoform 2 protein_id : NP_001015681.1

name	E130308A19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24233509 CCDS:CCDS18224.1 GeneID:230259 MGI:2442164
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC230259 isoform 1 protein_id : NP_694798.1

name	1110054O05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62526128 CCDS:CCDS18225.1 GeneID:66209 MGI:1913459
definition	codon_start : 1 product : hypothetical protein LOC66209 protein_id : NP_001013595.1

name	Snx30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859789 CCDS:CCDS18226.1 GeneID:209131 MGI:2443882
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : novel PX domain containing protein product : sorting nexin family member 30 protein_id : NP_766056.1

name	Slc46a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560331 CCDS:CCDS18227.1 GeneID:30936 MGI:1353616
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0015520 - tetracycline:hydrogen antiporter activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0015904 - tetracycline transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : putative thymic stromal co-transporter TSCOT; thymic stromal cotransporter product : solute carrier family 46, member 2 protein_id : NP_066395.2

name	Mup4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678968 CCDS:CCDS18228.1 GeneID:17843 MGI:97236
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005550 - pheromone binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : major urinary protein 4 protein_id : NP_032674.1

name	LOC620807 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:124486865 GeneID:620807
definition	codon_start : 1 product : similar to Major urinary protein 4 precursor (MUP 4) protein_id : NP_001074754.1

name	LOC100041658 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252429 GeneID:100041658
definition	codon_start : 1 product : similar to major urinary protein 1 protein_id : XP_001477019.1

name	Mup2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930714 GeneID:17841 MGI:97234
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005550 - pheromone binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : 2610016E04Rik; novel member of the major urinary protein (Mup) gene family product : major urinary protein 2 protein_id : NP_001039015.1

name	Mup2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930712 CCDS:CCDS18230.1 GeneID:17841 MGI:97234
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005550 - pheromone binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : 2610016E04Rik; novel member of the major urinary protein (Mup) gene family product : major urinary protein 2 protein_id : NP_032673.3

name	LOC100041687 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252432 GeneID:100041687
definition	codon_start : 1 product : similar to major urinary protein 1 protein_id : XP_001477054.1

name	LOC100038948 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252530 GeneID:100038948
definition	codon_start : 1 product : similar to major urinary protein 1 protein_id : XP_001472008.1

name	Mup1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13654245 CCDS:CCDS18231.1 GeneID:17840 MGI:97233
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005550 - pheromone binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : major urinary protein 1 protein_id : NP_112465.1

name	LOC100039008 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252533 GeneID:100039008
definition	codon_start : 1 product : similar to major urinary protein 1 protein_id : XP_001472105.1

name	LOC100039028 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252536 GeneID:100039028
definition	codon_start : 1 product : similar to major urinary protein 1 protein_id : XP_001472128.1

name	LOC100039054 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252540 GeneID:100039054
definition	codon_start : 1 product : similar to major urinary protein 1 protein_id : XP_001472199.1

name	LOC100039089 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252543 GeneID:100039089
definition	codon_start : 1 product : similar to major urinary protein 1 protein_id : XP_001472240.1

name	LOC100039116 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252547 GeneID:100039116
definition	codon_start : 1 product : similar to major urinary protein 1 protein_id : XP_001472259.1

name	LOC100039150 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252552 GeneID:100039150
definition	codon_start : 1 product : similar to major urinary protein 1 protein_id : XP_001472313.1

name	LOC666719 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666719
definition	number : 1 pseudo : _no_value

name	LOC100041592 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041592
definition	number : 1 pseudo : _no_value

name	LOC100041656 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041656
definition	number : 1 pseudo : _no_value

name	LOC100041656 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041656
definition	number : 2 pseudo : _no_value

name	LOC100041656 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041656
definition	number : 3 pseudo : _no_value

name	LOC620846 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620846
definition	number : 1 pseudo : _no_value

name	LOC620846 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620846
definition	number : 2 pseudo : _no_value

name	LOC620846 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620846
definition	number : 3 pseudo : _no_value

name	LOC620846 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620846
definition	number : 4 pseudo : _no_value

name	LOC620846 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620846
definition	number : 5 pseudo : _no_value

name	LOC620846 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620846
definition	number : 6 pseudo : _no_value

name	LOC620997 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620997
definition	number : 1 pseudo : _no_value

name	LOC620997 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620997
definition	number : 2 pseudo : _no_value

name	LOC620997 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620997
definition	number : 3 pseudo : _no_value

name	LOC620997 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620997
definition	number : 4 pseudo : _no_value

name	LOC620997 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620997
definition	number : 5 pseudo : _no_value

name	LOC620997 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620997
definition	number : 6 pseudo : _no_value

name	LOC667234 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667234
definition	number : 1 pseudo : _no_value

name	LOC667234 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667234
definition	number : 2 pseudo : _no_value

name	LOC667234 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667234
definition	number : 3 pseudo : _no_value

name	LOC667234 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667234
definition	number : 4 pseudo : _no_value

name	LOC667234 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667234
definition	number : 5 pseudo : _no_value

name	LOC667234 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667234
definition	number : 6 pseudo : _no_value

name	LOC620882 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252430 GeneID:620882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins product : similar to novel member of the major urinary protein (Mup) gene family pseudo : _no_value transcript_id : XR_032925.1

name	LOC667221 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252433 GeneID:667221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to novel member of the major urinary protein (Mup) gene family pseudo : _no_value transcript_id : XR_035681.1

name	LOC620942 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252531 GeneID:620942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 17 Proteins product : similar to novel member of the major urinary protein (Mup) gene family pseudo : _no_value transcript_id : XR_030536.1

name	LOC620982 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252537 GeneID:620982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 21 Proteins product : similar to novel member of the major urinary protein (Mup) gene family pseudo : _no_value transcript_id : XR_030572.1

name	LOC100039063 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252541 GeneID:100039063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 17 Proteins product : similar to novel member of the major urinary protein (Mup) gene family pseudo : _no_value transcript_id : XR_030591.1

name	LOC667239 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:94371886 GeneID:667239
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins product : similar to novel member of the major urinary protein (Mup) gene family pseudo : _no_value transcript_id : XR_001996.1

name	LOC667242 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252548 GeneID:667242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins product : similar to novel member of the major urinary protein (Mup) gene family pseudo : _no_value transcript_id : XR_030627.1

name	LOC100039019 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252534 GeneID:100039019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 21 Proteins product : similar to Predicted gene, OTTMUSG00000007485 pseudo : _no_value transcript_id : XR_030567.1

clone name	MSMg01-361I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324J05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-402J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211H05
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-257B04.b	B6Ng01-257B04.g
ACC	GA062865	GA062866
length	1,156	1,037
definition	B6Ng01-257B04.b	B6Ng01-257B04.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcttttccagcttctactctgaggtaatgtctgtgtttgtccccga ggtgaatttcctgtttgcagcaaaatgctggttcctttttaagtatccag tctgttagtctatgtctctttattggggaatttagtccactgatattaag aattattaagtaatgattgttgcttcctttttttgttgttagagatggaa ttatgttaagatggctatcttttttctggtttgttaagagattactttct tgacttttctagggtgtagttttgctccttttgttggagttttccattta ttatcctttgaagagctggatttgttgaaagatattgtgtaaatttgttt ttatcatggaatatcatgatagtatcatggaatatctctatctaaggtaa ttgagagttttctgggcatagtatccagggctgatatttgtgttctctta gggtttgtatgatgtcttcccaggatcttttggcttttatagtctctgat gagaagtgtggtgtaattctgataggtctgcctttatatgttacttgact tttttattccttgttgcttttaatattctttctttgttttgtgcatttgg tgttttgagtattatgttacaggaaaaatttcttttctggtctaatctat ttggtgttctgtctgcttcctgtgtgttcatgggcatctcttttctttag gttagggaagttttcttttataatttttgttgaaaatatttactggccct ttatgttgggatttttttgctctctttctatacctatttatccttaggtt ttggtctttctcatttgtgttcctggatttcctggatgtttttgagctta ggattctttttgcattttgcatttttctttgactgttgtgtcaatgtttt tctatgggcatccttctgcttcttgacattctctcttccatctcatgtat tttggttgggtggatgcctggcatcctattgactccctgatctcttttcc ttaggttttttctatcctcctcgagttgttttccctttggtgattggcct tttgaattgtttcctatttcaattttgagatcccgggaatgggtttggtt ccaatttttccacttgttcggcttgtgtttttgccggtaattcctttaag ggaaat	gaattcaaaatctcagaccaagcaatccctttgtaaagtaagaagacagg gaagatgtgacggttgacactgtagaactgtacaattctttgtgatctgg gaatacattacagctaagggaacatagagggttggggaaaactgtcacaa aagcccaaggatgccacatgagcatgtaccctcagataacaagggctgaa gcagggtgaatttgaagacagatgcccaaccttacatgacatacagaaag aacacaaatacctgtagctgctgtgacaggaccaaccattctaaatatca aagcagctgttgatacctaaggactggtctgactgctagatctaggagtt tcaacttgcaaaagctggcttgatgctcatggttggcccaaatgtcttat caggaataaataacctcacaaaatatcaacattaggcaccatcctcctga gattggaaacacaagataattgtgccatctaaaatggtgtctgtcctctg gctaaaatcagtgacagctacttctttaccaatagcagagttagctttat gtttgtgtccacttattagaaataggatataatgggctatttaatcactg aagtgtaatttcccaattacacccaacctagagcttattgagacattcct taaccctataggagttccttatttcattccttttataaagattatcagct gtgcaaaggccaggacaggaaagaactgttctcccaggagtgctttcact cgagggctgggaggtgaagtagacactttctctccattaacactccaggg aatgaccagcaagggtgtgcagggcacagaaacagtggagcagctgggac aggatcccttcagtcaccatctactcccggagcttgggctgttcacagcc ctctgtacacaagttcatccaggatagagcgttctccaaggagtataggc acagcttaacagatgcacagaaggacaagctcgagccagagactaacagg ccattacaccagagttaacagatggcaaaaggcaggg
quality values	Open. Hide. 31 15 27 35 58 58 54 58 58 62 62 22 10 62 62 62 62 62 62 56 62 62 62 62 62 54 47 47 51 62 35 39 47 37 32 28 24 36 45 32 34 38 59 62 62 62 62 62 59 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 48 43 49 56 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 59 56 38 33 51 56 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 59 59 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 43 43 27 43 28 33 56 51 43 49 56 56 51 43 46 34 32 28 34 50 56 51 56 46 48 28 27 48 50 56 62 62 59 62 62 62 56 56 56 56 48 59 56 62 62 62 56 62 59 62 62 62 62 62 62 62 62 59 59 59 49 59 59 56 56 62 59 59 62 62 62 62 62 62 62 62 62 50 62 59 62 62 62 62 62 59 59 54 54 56 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 54 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 53 62 62 62 62 62 62 47 47 62 62 62 62 49 47 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 54 47 62 47 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 56 62 56 56 62 62 62 54 62 56 62 43 56 56 56 62 62 62 62 42 47 54 62 62 62 62 41 62 62 56 54 62 62 62 62 62 40 34 32 24 20 18 32 62 62 62 62 62 62 52 54 42 52 62 54 62 54 62 42 62 62 62 54 35 62 42 51 62 62 62 54 62 52 54 54 58 46 53 58 58 58 52 54 35 52 41 39 52 50 52 58 52 52 52 37 49 50 42 52 41 42 37 35 37 40 40 41 37 20 54 52 39 52 34 52 38 25 18 15 49 54 52 39 42 58 46 45 28 35 41 39 25 22 52 54 54 21 54 18 45 30 49 58 54 52 50 41 38 54 54 39 52 54 36 16 37 58 46 50 45 15 37 40 52 46 51 50 58 34 51 34 58 52 58 52 58 36 42 46 42 45 33 53 24 58 13 28 22 33 42 36 24 50 50 25 8 58 27 40 18 15 12 6 12 13 12 32 15 58 51 15 27 32 31 32 7 50 13 32 28 50 34 46 58 9 37 17 25 7 9 18 15 32 54 41 51 30 30 33 17 15 23 31 30 26 19 47 18 32 52 49 10 27 28 18 31 18 9 15 19 17 14 7 18 26 34 58 58 34 32 23 15 28 39 49 49 39 40 30 33 34 50 32 23 19 6 7 14 30 32 28 25 29 46 18 26 42 6 30 30 31 34 9 15 16 7 40 54 41 20 10 9 9 26 15 27 23 16 16 25 11 9 17 26 37 16 22 18 29 18 14 18 34 41 26 17 14 12 46 22 37 39 32 37 26 52 47 37 20 24 37 26 33 19 28 41 22 19 31 42 28 24 16 14 6 22 23 40 10 15 14 9 40 30 31 13 23 41 21 28 32 6 12 23 7 12 5 9 8 12 32 23 16 20 52 27 19 31 29 28 32 40 15 8 24 45 29 32 20 8 14 12 13 11 10 6 25 24 13 10 16 14 8 7 9 17 25 17 18 7 5 13 15 30 33 21 19 25 33 35 19 31 33 30 31 36 18 22 16 6 12 11 19 21 7 14 14 9 10 16 25 27 6 11 13 13 12 31 20 38 16 16 31 14 24 22 46 15 32 7 14 30 41 5 7 4 13 5 7 15 9 11 9 9 6 14 13 16 19 28 31 25 36 31 27 6 5 12 14 18 16 37 23 24 13 8 24 6 18 14 6 25 22 15 9 14 8 5 11 22 29 9 7 12 6 7 6 22 24 37 31 15 8 5 8 5 6 16 19 12 15 6 5 13 18 8 5 11 6 21 18 7 17 6 6	Open. Hide. 62 49 51 47 62 47 35 56 62 62 62 62 45 38 24 18 28 34 24 24 40 50 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 51 62 62 62 59 54 62 59 59 59 62 62 62 59 59 59 62 62 62 62 59 62 62 59 59 59 59 62 62 59 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 48 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 54 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 54 62 62 62 62 62 62 62 47 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 58 58 42 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 54 54 46 58 58 58 58 58 54 58 52 58 58 44 54 58 58 58 54 37 54 52 54 58 58 58 58 49 54 58 54 47 58 36 54 58 54 58 58 58 58 58 43 39 34 54 58 54 52 39 41 58 47 58 58 47 49 58 58 54 42 58 37 58 58 30 22 42 51 58 49 51 52 58 53 58 53 51 51 49 58 50 53 46 51 50 40 58 50 47 34 47 41 40 51 53 58 58 49 46 53 53 33 58 46 28 51 41 41 47 37 58 49 51 58 58 47 46 47 47 51 39 39 58 58 26 36 35 39 58 49 50 29 12 39 36 39 49 47 36 41 39 52 50 50 47 42 54 37 33 44 19 43 32 22 21 28 23 38 41 58 50 51 58 42 36 33 37 49 58 52 50 52 43 43 28 43 37 41 39 58 35 42 45 45 53 51 37 42 39 49 53 35 19 27 13 54 30 25 45 28 54 49 32 7 54 34 41 38 36 26 32 25 11 38 37 34 53 52 54 54 45 40 37 32 26 54 32 35 33 37 42 39 31 37 53 33 43 40 40 54 39 37 33 26 42 36 31 41 39 25 42 32 36 30 49 40 25 37 32 43 26 31 26 40 36 31 21 26 31 19 36 40 32 37 28 31 34 31 32 25 11 32 28 14 31 42 37 51 18 35 23 31 33 26 26 25 24 51 31 17 41 18 23 26 31 24 25 33 29 29 31 21 16 26 31 34 41 42 32 18 33 42 21 32 33 15 46 36 27 17 32 37 21 13 30 16 26 26 30 21 40 27 42 22 25 31 27 21 20 16 24 27 13 7 14 14 14 24 36 22 17 19 17 33 28 19 39 12 35 23 32 17 21 27 20 13 9 22 24 11 28 16 26 17 36 24 24 31 33 32 15 22 18 7 11 5 19 37 13 10 17 9 6 30 25 14 21 17 29 33 19 35 25 12 12 5 9 10 25 17 29 34 22 9 16 18 32 23 13 9 34 9 21 19 21 11 11 7 29 6 14 8 9 8 34 13 4 6 10 15 20 10 9 31 28 8 16 21 10 17 4 6 19 18 22 27 16 16 34 30 17 8 11 5 8 13 40 18

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_60146850_60147891
seq2: B6Ng01-257B04.g_70_1106 (reverse)

seq1  CCCTGCCTTTTGCCATCTGGTTACCTCTGGTGTTAAATGGCCTTGTAGTC  50
      |||||||||||||||||| |||| |||||||||  ||||||||  |||||
seq2  CCCTGCCTTTTGCCATCT-GTTAACTCTGGTGT--AATGGCCTGTTAGTC  47

seq1  TCTGGCTCGAGCTTGTCCCTTCTGTGCATCTGTAAGCCTGTGCCTATACT  100
      |||||||||||||||| |||||||||||||||| |  |||||||||||||
seq2  TCTGGCTCGAGCTTGT-CCTTCTGTGCATCTGTTAAGCTGTGCCTATACT  96

seq1  CCTTGGAGAACGCTCTATCCTGGATGAACTTGTGTACAGAGGGCTGTGGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  CCTTGGAGAACGCTCTATCCTGGATGAACTTGTGTACAGAGGGCTGT-GA  145

seq1  ACAGCCCAAGCTCCGGGAGTAGATGGTGACTGAAGGGATCCTGTCCCAGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGCCCAAGCTCCGGGAGTAGATGGTGACTGAAGGGATCCTGTCCCAGC  195

seq1  TGCTCCACTGTTTCTGTGCCCTGCACACCCTTGCTGGTCATTCCCTGGAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCCACTGTTTCTGTGCCCTGCACACCCTTGCTGGTCATTCCCTGGAG  245

seq1  TGTTAATGGAGAGAAAGTGTCTACTTCACCTCCCAGCCCTCGAGTGAAAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTAATGGAGAGAAAGTGTCTACTTCACCTCCCAGCCCTCGAGTGAAAG  295

seq1  CACTCCTGGGAGAACAGTTCTTTCCTGTCCTGGCCTTTGCACAGCTGATA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCCTGGGAGAACAGTTCTTTCCTGTCCTGGCCTTTGCACAGCTGATA  345

seq1  ATCTTTATAAAAGGAATGAAATAAGGAACTCCTATAGGGTTAAGGAATGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTTATAAAAGGAATGAAATAAGGAACTCCTATAGGGTTAAGGAATGT  395

seq1  CTCAATAAGCTCTAGGTTGGGTGTAATTGGGAAATTACACTTCAGTGATT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAATAAGCTCTAGGTTGGGTGTAATTGGGAAATTACACTTCAGTGATT  445

seq1  AAATAGCCCATTATATCCTATTTCTAATAAGTGGACACAAACATAAAGCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAGCCCATTATATCCTATTTCTAATAAGTGGACACAAACATAAAGCT  495

seq1  AACTCTGCTATTGGTAAAGAAGTAGCTGTCACTGATTTTAGCCAGAGGAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTCTGCTATTGGTAAAGAAGTAGCTGTCACTGATTTTAGCCAGAGGAC  545

seq1  AGACACCATTTTAGATGGCACAATTATCTTGTGTTTCCAATCTCAGGAGG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACACCATTTTAGATGGCACAATTATCTTGTGTTTCCAATCTCAGGAGG  595

seq1  ATGGTGCCTAATGTTGATATTTTGTGAGGTTATTTATTCCTGATAAGACA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGTGCCTAATGTTGATATTTTGTGAGGTTATTTATTCCTGATAAGACA  645

seq1  TTTGGGCCAACCATGAGCATCAAGCCAGCTTTTGCAAGTTGAAACTCCTA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGGCCAACCATGAGCATCAAGCCAGCTTTTGCAAGTTGAAACTCCTA  695

seq1  GATCTAGCAGTCAGACCAGTCCTTAGGTATCAACAGCTGCTTTGATATTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTAGCAGTCAGACCAGTCCTTAGGTATCAACAGCTGCTTTGATATTT  745

seq1  AGAATGGTTGGTCCTGTCACAGCAGCTACAGGTATTTGTGTTCTTTCTGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAATGGTTGGTCCTGTCACAGCAGCTACAGGTATTTGTGTTCTTTCTGT  795

seq1  ATGTCATGTAAGGTTGGGCATCTGTCTTCAAATTCACCCTGCTTCAGCCC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTCATGTAAGGTTGGGCATCTGTCTTCAAATTCACCCTGCTTCAGCCC  845

seq1  TTGTTATCTGAGGGTACATGCTCATGTGGCATCCTTGGGCTTTTGTGACA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTATCTGAGGGTACATGCTCATGTGGCATCCTTGGGCTTTTGTGACA  895

seq1  GTTTTCCCCAACCCTCTATGTTCCCTTAGCTGTAATGTATTCCCAGATCA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTCCCCAACCCTCTATGTTCCCTTAGCTGTAATGTATTCCCAGATCA  945

seq1  CAAAGAATTGTACAGTTCTACAGTGTCAACCGTCACATCTTCCCTGTCTT  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGAATTGTACAGTTCTACAGTGTCAACCGTCACATCTTCCCTGTCTT  995

seq1  CTTACTTTACAAAGGGATTGCTTGGTCTGAGATTTTGAATTC  1042
      ||||||||||||||||||||||||||||||||||||||||||
seq2  CTTACTTTACAAAGGGATTGCTTGGTCTGAGATTTTGAATTC  1037

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information