MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-260G07
Chromosome	4 (Build37)
Map Location	136,305,163 - 136,364,478
singlet/doublet	doublet
Overlap gene	Ephb2
Upstream gene	Il22ra1, LOC665334, Myom3, Fusip1, Pnrc2, Cnr2, Fuca1, Hmgcl, Gale, Lypla2, 1110049F12Rik, LOC669445, Tceb3, Rpl11, Id3, E2f2, Ddefl1, Tcea3, Zfp46, Hnrpr, Htr1d, LOC100042540, Luzp1, Aof2, LOC667080, LOC433770, 4930549C01Rik, BC029684
Downstream gene	C1qb, C1qc, C1qa, Epha8, Zbtb40, Wnt4, Cdc42, LOC665533, LOC242711, Ela3, 1700013G24Rik, Hspg2, Ldlrad2, Usp48, Rap1gap, Akp2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Il22ra1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230828 MGI:2663588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665334 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins pseudo : _no_value

name	Myom3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242702 MGI:2685280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 5 Proteins

name	Fusip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14105 MGI:1333805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pnrc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52830 MGI:106512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12802 MGI:104650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fuca1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71665 MGI:95593
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hmgcl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15356 MGI:96158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gale (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74246 MGI:1921496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lypla2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26394 MGI:1347000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110049F12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66193 MGI:1913443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669445 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins pseudo : _no_value

name	Tceb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27224 MGI:1351315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67025 MGI:1914275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Id3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15903 MGI:96398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E2f2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242705 MGI:1096341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddefl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230837 MGI:2684986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcea3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21401 MGI:1196908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp46 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22704 MGI:99192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hnrpr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74326 MGI:1891692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Htr1d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15552 MGI:96276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042540 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Luzp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269593 MGI:107629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aof2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99982 MGI:1196256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667080 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	LOC433770 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433770
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 23 ESTs, 23 Proteins pseudo : _no_value

name	4930549C01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67663 MGI:1914913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC029684 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242707 MGI:2448566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein

name	Ephb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13844 MGI:99611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C1qb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12260 MGI:88224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C1qc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12262 MGI:88225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C1qa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12259 MGI:88223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Epha8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13842 MGI:109378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230848 MGI:2682254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wnt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22417 MGI:98957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc42 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12540 MGI:106211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665533 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 514 ESTs, 6 Proteins

name	LOC242711 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:242711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 13 Proteins pseudo : _no_value

name	Ela3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67868 MGI:1915118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700013G24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69380 MGI:1916630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hspg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15530 MGI:96257
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 189 ESTs, 5 Proteins

name	Ldlrad2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435811 MGI:3588210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp48 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170707 MGI:2158502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rap1gap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110351 MGI:109338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11647 MGI:87983
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il22ra1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30142708 GeneID:230828 MGI:2663588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 22 receptor, alpha 1 transcript_id : NM_178257.1

name	Myom3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372579 GeneID:242702 MGI:2685280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 5 Proteins product : myomesin family, member 3 transcript_id : XM_144099.7

name	Fusip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937375 GeneID:14105 MGI:1333805
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FUS interacting protein (serine-arginine rich) 1 transcript_id : NM_010178.2

name	Fusip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937371 GeneID:14105 MGI:1333805
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FUS interacting protein (serine-arginine rich) 1 transcript_id : NM_001080387.1

name	Pnrc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374269 GeneID:52830 MGI:106512
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline-rich nuclear receptor coactivator 2 transcript_id : NM_026383.2

name	Cnr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981836 GeneID:12802 MGI:104650
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cannabinoid receptor 2 (macrophage) transcript_id : NM_009924.2

name	Fuca1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802500 GeneID:71665 MGI:95593
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fucosidase, alpha-L- 1, tissue transcript_id : NM_024243.3

name	Hmgcl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680232 GeneID:15356 MGI:96158
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 3-hydroxy-3-methylglutaryl-Coenzyme A lyase transcript_id : NM_008254.1

name	Gale (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130587 GeneID:74246 MGI:1921496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactose-4-epimerase, UDP transcript_id : NM_178389.3

name	Lypla2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7242155 GeneID:26394 MGI:1347000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysophospholipase 2 transcript_id : NM_011942.1

name	1110049F12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802905 GeneID:66193 MGI:1913443
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110049F12 gene transcript_id : NM_025411.3

name	Tceb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801340 GeneID:27224 MGI:1351315
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription elongation factor B (SIII), polypeptide 3 transcript_id : NM_013736.3

name	Rpl11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359456 GeneID:67025 MGI:1914275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L11 transcript_id : NM_025919.2

name	Id3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680340 GeneID:15903 MGI:96398
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inhibitor of DNA binding 3 transcript_id : NM_008321.1

name	E2f2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803420 GeneID:242705 MGI:1096341
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : E2F transcription factor 2 transcript_id : NM_177733.3

name	Ddefl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56711263 GeneID:230837 MGI:2684986
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : development and differentiation enhancing factor-like 1 transcript_id : NM_001008232.1

name	Tcea3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189437 GeneID:21401 MGI:1196908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription elongation factor A (SII), 3 transcript_id : NM_011542.1

name	Zfp46 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253915 GeneID:22704 MGI:99192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 46 transcript_id : NM_009557.3

name	Hnrpr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859723 GeneID:74326 MGI:1891692
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein R transcript_id : NM_028871.1

name	Htr1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142389109 GeneID:15552 MGI:96276
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5-hydroxytryptamine (serotonin) receptor 1D transcript_id : NM_008309.3

name	LOC100042540 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253174 GeneID:100042540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100042540 transcript_id : XM_001479038.1

name	Luzp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119433662 GeneID:269593 MGI:107629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine zipper protein 1 transcript_id : NM_024452.2

name	Aof2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930514 GeneID:99982 MGI:1196256
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amine oxidase (flavin containing) domain 2 transcript_id : NM_133872.1

name	4930549C01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802988 GeneID:67663 MGI:1914913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930549C01 gene transcript_id : NM_026300.2

name	BC029684 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253147 GeneID:242707 MGI:2448566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : cDNA sequence BC029684 transcript_id : XM_205950.7

name	Ephb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129939 GeneID:13844 MGI:99611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Eph receptor B2 transcript_id : NM_010142.2

name	C1qb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893071 GeneID:12260 MGI:88224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement component 1, q subcomponent, beta polypeptide transcript_id : NM_009777.2

name	C1qc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680119 GeneID:12262 MGI:88225
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement component 1, q subcomponent, C chain transcript_id : NM_007574.2

name	C1qa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286804 GeneID:12259 MGI:88223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement component 1, q subcomponent, alpha polypeptide transcript_id : NM_007572.2

name	Epha8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679662 GeneID:13842 MGI:109378
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Eph receptor A8 transcript_id : NM_007939.1

name	Zbtb40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38016186 GeneID:230848 MGI:2682254
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 40 transcript_id : NM_198248.1

name	Wnt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678594 GeneID:22417 MGI:98957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless-related MMTV integration site 4 transcript_id : NM_009523.1

name	Cdc42 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753363 GeneID:12540 MGI:106211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 42 homolog (S. cerevisiae) transcript_id : NM_009861.1

name	LOC665533 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372584 GeneID:665533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 514 ESTs, 6 Proteins product : similar to ribosomal protein L31 transcript_id : XM_977600.1

name	Ela3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129812 GeneID:67868 MGI:1915118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elastase 3, pancreatic transcript_id : NM_026419.2

name	1700013G24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378009 GeneID:69380 MGI:1916630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700013G24 gene transcript_id : NM_027063.2

name	Hspg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253149 GeneID:15530 MGI:96257
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 189 ESTs, 5 Proteins product : perlecan (heparan sulfate proteoglycan 2) transcript_id : XM_978879.2

name	Ldlrad2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702178 GeneID:435811 MGI:3588210
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : low density lipoprotein receptor A domain containing 2 transcript_id : NM_001033979.1

name	Usp48 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114053324 GeneID:170707 MGI:2158502
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 48 transcript_id : NM_130879.2

name	Rap1gap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487210 GeneID:110351 MGI:109338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rap1 GTPase-activating protein transcript_id : NM_001081155.1

name	Akp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6671532 GeneID:11647 MGI:87983
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alkaline phosphatase 2, liver transcript_id : NM_007431.1

name	Il22ra1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30142709 CCDS:CCDS18789.1 GeneID:230828 MGI:2663588
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : interleukin-22 receptor alpha chain product : interleukin 22 receptor, alpha 1 protein_id : NP_839988.1

name	Myom3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82895260 GeneID:242702 MGI:2685280
definition	codon_start : 1 product : myomesin family, member 3 protein_id : XP_144099.6

name	Fusip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753820 CCDS:CCDS18791.1 GeneID:14105 MGI:1333805
definition	GO_component : GO:0005737 - cytoplasm [Evidence IC] [Evidence ISS]; GO:0005654 - nucleoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] [Evidence IC] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0031202 - RNA splicing factor activity, transesterification mechanism [Evidence IDA]; GO:0051082 - unfolded protein binding [Evidence NAS] GO_process : GO:0016482 - cytoplasmic transport [Evidence IDA]; GO:0006406 - mRNA export from nucleus [Evidence NAS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0048025 - negative regulation of nuclear mRNA splicing, via spliceosome [Evidence IDA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence NAS] [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Fus-associated protein with serine-arginine repeats; neural-salient serine/arginine-rich product : FUS interacting protein (serine-arginine rich) 1 isoform 1 protein_id : NP_034308.1

name	Fusip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122937372 GeneID:14105 MGI:1333805
definition	GO_component : GO:0005737 - cytoplasm [Evidence IC] [Evidence ISS]; GO:0005654 - nucleoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] [Evidence IC] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0031202 - RNA splicing factor activity, transesterification mechanism [Evidence IDA]; GO:0051082 - unfolded protein binding [Evidence NAS] GO_process : GO:0016482 - cytoplasmic transport [Evidence IDA]; GO:0006406 - mRNA export from nucleus [Evidence NAS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0048025 - negative regulation of nuclear mRNA splicing, via spliceosome [Evidence IDA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence NAS] [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Fus-associated protein with serine-arginine repeats; neural-salient serine/arginine-rich product : FUS interacting protein (serine-arginine rich) 1 isoform 2 protein_id : NP_001073856.1

name	Pnrc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385876 CCDS:CCDS18792.1 GeneID:52830 MGI:106512
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : proline-rich nuclear receptor coactivator 2 protein_id : NP_080659.1

name	Cnr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981837 CCDS:CCDS18793.1 GeneID:12802 MGI:104650
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cannabinoid receptor 2 (spleen) product : cannabinoid receptor 2 (macrophage) protein_id : NP_034054.2

name	Fuca1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541781 CCDS:CCDS18794.1 GeneID:71665 MGI:95593
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004560 - alpha-L-fucosidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : alpha-L-fucosidase product : fucosidase, alpha-L-1, tissue protein_id : NP_077205.2

name	Hmgcl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680233 CCDS:CCDS18795.1 GeneID:15356 MGI:96158
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004419 - hydroxymethylglutaryl-CoA lyase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : 3-hydroxy-3-methylglutaryl-Coenzyme A lyase protein_id : NP_032280.1

name	Gale (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30409988 CCDS:CCDS18796.1 GeneID:74246 MGI:1921496
definition	GO_function : GO:0050662 - coenzyme binding [Evidence IEA]; GO:0016857 - racemase and epimerase activity, acting on carbohydrates and derivatives [Evidence IEA]; GO:0003978 - UDP-glucose 4-epimerase activity [Evidence IDA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0044237 - cellular metabolism [Evidence IEA] codon_start : 1 product : galactose-4-epimerase, UDP protein_id : NP_848476.1

name	Lypla2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7242156 CCDS:CCDS18797.1 GeneID:26394 MGI:1347000
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : lysophospholipase II product : lysophospholipase 2 protein_id : NP_036072.1

name	1110049F12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076883 GeneID:66193 MGI:1913443
definition	codon_start : 1 exception : unclassified translation discrepancy note : novel protein containing a DUF1000 domain product : thioredoxin family Trp26 protein_id : NP_079687.2

name	Tceb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543847 CCDS:CCDS18798.1 GeneID:27224 MGI:1351315
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : transcription elongation factor B (SIII), polypeptide 3 (110kD); Elongin A product : transcription elongation factor B (SIII), polypeptide 3 protein_id : NP_038764.2

name	Rpl11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385408 CCDS:CCDS18799.1 GeneID:67025 MGI:1914275
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : ribosomal protein L11 protein_id : NP_080195.1

name	Id3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680341 CCDS:CCDS18800.1 GeneID:15903 MGI:96398
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0019904 - protein domain specific binding [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0030855 - epithelial cell differentiation [Evidence IDA]; GO:0007507 - heart development [Evidence IGI]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : inhibitor of DNA binding 3 protein_id : NP_032347.1

name	E2f2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244208 CCDS:CCDS18801.1 GeneID:242705 MGI:1096341
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : E2F transcription factor 2 protein_id : NP_808401.1

name	Ddefl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56711264 CCDS:CCDS18802.1 GeneID:230837 MGI:2684986
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 product : development and differentiation enhancing factor-like 1 protein_id : NP_001008233.1

name	Tcea3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189438 CCDS:CCDS18803.1 GeneID:21401 MGI:1196908
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0003746 - translation elongation factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006354 - RNA elongation [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : transcription elongation factor A (SII), 3 protein_id : NP_035672.1

name	Zfp46 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49087060 CCDS:CCDS18804.1 GeneID:22704 MGI:99192
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 46 protein_id : NP_033583.2

name	Hnrpr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859724 CCDS:CCDS18805.1 GeneID:74326 MGI:1891692
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : heterogeneous nuclear ribonucleoprotein R protein_id : NP_083147.1

name	Htr1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542974 CCDS:CCDS18806.1 GeneID:15552 MGI:96276
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G-protein coupled receptor 14 product : 5-hydroxytryptamine (serotonin) receptor 1D protein_id : NP_032335.2

name	LOC100042540 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253175 GeneID:100042540
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479088.1

name	Luzp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119433663 GeneID:269593 MGI:107629
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : leucine zipper motif-containing protein product : leucine zipper protein 1 protein_id : NP_077772.2

name	Aof2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930515 GeneID:99982 MGI:1196256
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006118 - electron transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : amine oxidase (flavin containing) domain 2 protein_id : NP_598633.1

name	4930549C01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385796 CCDS:CCDS18808.1 GeneID:67663 MGI:1914913
definition	codon_start : 1 product : hypothetical protein LOC67663 protein_id : NP_080576.1

name	BC029684 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253148 GeneID:242707 MGI:2448566
definition	codon_start : 1 product : hypothetical protein protein_id : XP_205950.7

name	Ephb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47777351 CCDS:CCDS18809.1 GeneID:13844 MGI:99611
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence NAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008046 - axon guidance receptor activity [Evidence IDA]; GO:0005003 - ephrin receptor activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA] [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005102 - receptor binding [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0005005 - transmembrane-ephrin receptor activity [Evidence TAS] GO_process : GO:0007411 - axon guidance [Evidence IDA]; GO:0007612 - learning [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0048170 - positive regulation of long-term neuronal synaptic plasticity [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0050770 - regulation of axonogenesis [Evidence IDA]; GO:0048168 - regulation of neuronal synaptic plasticity [Evidence IMP]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IDA] codon_start : 1 product : Eph receptor B2 protein_id : NP_034272.1

name	C1qb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753220 CCDS:CCDS18810.1 GeneID:12260 MGI:88224
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_process : GO:0006956 - complement activation [Evidence IEA]; GO:0006958 - complement activation, classical pathway [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : complement component 1, q subcomponent, B chain protein_id : NP_033907.1

name	C1qc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680120 CCDS:CCDS18811.1 GeneID:12262 MGI:88225
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_process : GO:0006956 - complement activation [Evidence IEA]; GO:0006958 - complement activation, classical pathway [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 note : complement component 1, q subcomponent, c polypeptide product : complement component 1, q subcomponent, gamma polypeptide protein_id : NP_031600.2

name	C1qa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286805 CCDS:CCDS18812.1 GeneID:12259 MGI:88223
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_process : GO:0006956 - complement activation [Evidence IEA]; GO:0006958 - complement activation, classical pathway [Evidence IMP]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : complement component 1, q subcomponent, A chain protein_id : NP_031598.2

name	Epha8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679663 CCDS:CCDS18813.1 GeneID:13842 MGI:109378
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005003 - ephrin receptor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Eph receptor A8 protein_id : NP_031965.1

name	Zbtb40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38016187 CCDS:CCDS18814.1 GeneID:230848 MGI:2682254
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger and BTB domain containing 40 protein_id : NP_937891.1

name	Wnt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678595 CCDS:CCDS18815.1 GeneID:22417 MGI:98957
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005102 - receptor binding [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IMP]; GO:0007267 - cell-cell signaling [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0001838 - embryonic epithelial tube formation [Evidence IDA]; GO:0008585 - female gonad development [Evidence IMP]; GO:0007223 - frizzled-2 signaling pathway [Evidence IEA]; GO:0007276 - gametogenesis [Evidence IGI]; GO:0042445 - hormone metabolism [Evidence IMP]; GO:0008584 - male gonad development [Evidence IMP]; GO:0045596 - negative regulation of cell differentiation [Evidence IMP]; GO:0048599 - oocyte development [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP] [Evidence TAS]; GO:0007548 - sex differentiation [Evidence IMP]; GO:0007165 - signal transduction [Evidence TAS]; GO:0051145 - smooth muscle cell differentiation [Evidence IMP] [Evidence IDA]; GO:0035239 - tube morphogenesis [Evidence IMP]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : signal molecule product : wingless-related MMTV integration site 4 protein_id : NP_033549.1

name	Cdc42 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753364 CCDS:CCDS18816.1 GeneID:12540 MGI:106211
definition	GO_component : GO:0042995 - cell projection [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0030742 - GTP-dependent protein binding [Evidence IPI]; GO:0003924 - GTPase activity [Evidence ISS] [Evidence TAS] [Evidence NAS] [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0051301 - cell division [Evidence IEA]; GO:0046847 - filopodium formation [Evidence IDA]; GO:0007097 - nuclear migration [Evidence IMP]; GO:0043552 - positive regulation of phosphoinositide 3-kinase activity [Evidence IMP]; GO:0007266 - Rho protein signal transduction [Evidence TAS] citation : [PUBMED 8817303] codon_start : 1 function : GTP-binding protein product : cell division cycle 42 homolog protein_id : NP_033991.1

name	LOC665533 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94372585 GeneID:665533
definition	codon_start : 1 product : hypothetical protein protein_id : XP_982694.1

name	Ela3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385916 CCDS:CCDS18817.1 GeneID:67868 MGI:1915118
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : elastase 3B, pancreatic protein_id : NP_080695.1

name	1700013G24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312286 CCDS:CCDS18818.1 GeneID:69380 MGI:1916630
definition	codon_start : 1 product : hypothetical protein LOC69380 protein_id : NP_081339.1

name	Hspg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253150 GeneID:15530 MGI:96257
definition	codon_start : 1 product : perlecan (heparan sulfate proteoglycan 2) protein_id : XP_983973.2

name	Ldlrad2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702179 CCDS:CCDS18819.1 GeneID:435811 MGI:3588210
definition	codon_start : 1 product : low density lipoprotein receptor A domain containing 2 protein_id : NP_001029151.1

name	Usp48 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114053325 GeneID:170707 MGI:2158502
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : ubiquitin specific protease 31 product : ubiquitin specific protease 48 protein_id : NP_570949.2

name	Rap1gap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487211 GeneID:110351 MGI:109338
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Rap1, GTPase-activating protein 1 protein_id : NP_001074624.1

name	Akp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671533 CCDS:CCDS18821.1 GeneID:11647 MGI:87983
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004035 - alkaline phosphatase activity [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Tissue Non-Specific Alkaline Phosphatase; tissue-nonspecific alkaline phosphatase product : alkaline phosphatase 2, liver protein_id : NP_031457.1

name	LOC669445 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669445
definition	number : 1 pseudo : _no_value

name	LOC665334 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253173 GeneID:665334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins product : similar to RNA polymerase II elongation factor pseudo : _no_value transcript_id : XR_001716.2

name	LOC667080 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253176 GeneID:667080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to ribosomal protein pseudo : _no_value transcript_id : XR_035693.1

name	LOC433770 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253146 GeneID:433770
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 23 ESTs, 23 Proteins product : similar to heterogeneous nuclear ribonucleoprotein A3 pseudo : _no_value transcript_id : XR_031848.1

name	LOC242711 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253177 GeneID:242711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 13 Proteins product : similar to elastase 3B, pancreatic pseudo : _no_value transcript_id : XR_034091.1

clone name	MSMg01-272G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471D19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-237O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338D04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-434K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200H24
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-260G07.b	B6Ng01-260G07.g
ACC	GA065328	GA065329
length	901	1,038
definition	B6Ng01-260G07.b	B6Ng01-260G07.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(136,305,163 - 136,306,063)	(136,363,446 - 136,364,478)
sequence	gaattcccaactcaatgcctaacacttccttctcccgctacagaaggagg ggttggggtgtggctcagttgctatagtgcttgcccagcaagtaggaagg aggccctgggtccacacccaagcaccacataaaaccaggagtggggtctc atatctgggatcagaactggggatgcaaaggcaggagaatgaggagtttg aggaccttgaacttgaggccagcctgggacacatagaaccctgtctcaaa ttgaggccagcctgggctataatgagaccctgtttcagaagaaaaaaaaa tccatgtcttccatttcatcccttcctaaagcagtatttgggtcacttgt gtttcttcattgcccagctaggacacagggtcctggaggatgaaacaggg gtgtcccaatgtcatcaagcagggtgcagagagagaaaggtggtgtccct tgaaggtaacccgctggagccgacattacaggctgttcttcaaagaagtg tgtgtgggggtcaccatcatgcagcaccctccccccaatagagggaaccc gttcccacccctgttttctcagaggcgcctctgaggaccacgatggcaat aaaggcacccctgtgtgtctctggggaagccgagctgggggtggcgaggg gggccccacaaaggacccgcagctgtgtgtttgcaaacaggggagctgag ctgtgcagaggggctgaaagcagtaattgtctttaattaaaggaggttgg aggcagcgcgggctttgacaaaagagatttccagcccgtgagcagcttca gccagcactgggtctgggcgccttcggctttgtccctgtggggcctggcc ccgtggagggctcggccaacacctgcctgctggaaggggtggggggtgtg t	gaattccctcatcggctcagggtaggatgctgtactcgttgagagagaca tttttacaaaataaatccttagagaagccaggcgctgaggctgggaggcc tggcaagggattatttaaataaaccctgtttttgaagcttcgggggccca aatgatttgcctgagcctttagttactccttgtgttcagtttatggtccc cagtgaccctgagacagtgttccttggaatgacggcagcaggccctctcc ctgggtgagagctttggtctttggagtctctatcattcctttctttattg gggggtgggtaggagtcaatttcactttctttaagcaagcatagttcgta gcatagttctctcttcgtgaggatgtacttcctgcccattgcaagttaag ggccccaggttctagcctgtgggatgttcatgtaccaccccccatggcca cattgtccccatgttccttaagaaggcaaggagatttcatccagtcctct taggctgggacaacactggaatggctaatgtcctgagccttccagacctt actgcacacttgcctctttgcatgagactgaggctcgtgtattcaggcat ctgtgtagcttgctgggtggctgaggacagccttgaactccctctttctc ctgcctctccctgggattacaccaggatccgttttatgacgtgttgggga tcaaaccaaggaagggccttggttgtgttaggcaaccactctaccaagcg agccaaatcgcaccactcagcacatttctaagtgtcccctgggggagcgc agtgctcaagtgagacccacgaagtgactgcagttcaggcctcggcccct gggtcccttgtctgcatgagcttgaactcagctgtcttcctttgtctcct ccctaggcgccctgtatctctctgtctttgcggctttcccatgattcctt ttgcccagagctggagtgacagcatcagcctcagacttgtgcccagctct cacttttctcctcagttaaaggggaagggggcagagca
quality values	Open. Hide. 62 47 19 24 62 62 62 39 20 62 62 62 41 24 62 62 62 62 62 62 62 62 59 46 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 62 62 62 62 62 62 62 54 54 62 62 54 54 62 62 62 62 62 62 62 59 59 62 62 59 56 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 49 35 59 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 49 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 58 47 49 58 58 58 58 58 58 49 58 58 58 54 58 58 58 58 58 58 47 58 58 58 58 58 58 58 54 46 58 58 58 58 46 58 58 58 58 58 58 58 58 49 52 58 42 58 54 53 58 58 58 58 58 58 54 39 58 42 41 54 52 54 54 58 51 58 58 51 58 58 58 54 58 58 49 58 50 50 51 58 58 58 58 58 51 58 58 58 49 51 58 53 58 58 58 58 51 58 58 40 58 58 52 58 26 58 58 48 58 58 58 54 52 58 58 49 54 51 39 58 58 58 58 58 39 58 54 54 42 53 50 58 47 39 58 39 27 58 58 52 53 53 39 53 58 54 52 53 53 54 50 58 44 47 41 39 58 51 52 38 37 58 54 49 35 25 53 54 53 54 18 52 53 53 52 51 53 38 30 53 29 54 51 42 40 51 42 54 54 52 42 53 53 25 33 33 35 39 54 51 37 53 54 54 42 40 33 37 52 37 54 40 34 51 41 24 52 34 33 47 51 51 37 52 29 40 40 53 53 53 31 53 53 32 32 49 46 45 41 30 16 26 49 53 40 53 31 34 30 49 25 32 46 32 32 27 37 29 30 30 36 31 23 45 31 33 45 31 42 32 28 32 31 45 32 32 38 31 31 31 30 47 51 31 33 36 42 51 45 38 24 27 43 31 32 22 8 26 29 42 46 41 31 31 31 46 30 31 35 31 31 46 46 42 24 36 32 31 42 33 46 46 33 21 15 28 31 41 20 48 31 27 30 31 31 31 30 30 24 31 31 27 27 27 31 42 36 30 18 31 31 30 21 28 31 28 27 46 48 9 10 5 43 44 43 43 32 20 29 16 17 6	Open. Hide. 62 44 62 59 62 62 62 62 62 59 59 62 62 62 59 62 62 59 59 59 62 62 59 62 59 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 59 51 62 59 62 62 62 59 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 56 62 59 62 62 59 62 62 59 62 62 62 62 62 59 54 54 46 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 54 49 54 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 54 54 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 59 59 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 49 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 59 43 62 62 46 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 43 62 56 62 62 62 62 62 56 43 45 62 62 62 56 62 62 49 62 56 62 62 62 62 62 62 54 62 56 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 54 62 62 62 62 62 62 54 52 62 41 62 62 62 62 62 62 62 62 62 52 49 62 62 62 62 62 62 62 62 62 62 58 58 54 54 58 58 58 39 58 32 58 58 58 39 49 44 58 54 58 48 58 54 52 50 54 52 35 54 58 52 54 58 53 58 58 52 58 58 54 43 48 58 54 54 53 58 58 58 58 39 58 58 35 58 58 54 10 45 58 32 52 49 53 58 54 58 52 54 58 42 42 47 52 47 54 52 58 58 58 40 46 52 47 37 49 50 58 51 49 51 48 41 43 50 49 45 49 25 25 41 34 58 50 38 34 49 53 51 37 46 48 48 50 50 51 49 46 53 49 48 52 31 52 39 36 30 40 51 48 58 48 48 27 32 50 51 50 49 18 25 53 42 51 31 39 21 41 42 30 42 44 27 49 58 37 36 39 32 49 41 17 39 35 58 32 27 41 49 42 39 35 35 39 39 38 37 32 19 50 49 51 41 50 26 16 16 18 49 39 42 29 37 52 21 17 38 32 49 40 52 41 23 45 37 40 23 41 53 29 37 42 24 49 29 39 51 26 39 51 51 54 33 32 39 49 49 49 44 16 51 32 34 39 8 30 45 30 33 37 29 29 42 40 37 52 26 28 29 49 39 28 27 12 46 9 9 9 22 16 18 33 31 19 14 32 25 32 24 42 31 51 14 20 32 32 29 12 21 53 51 38 28 27 53 46 32 25 46 31 31 30 30 31 34 17 27 21 28 36 34 45 18 30 12 16 28 11 31 23 32 31 18 12 21 31 31 30 31 51 19 30 19 26 42 31 33 32 31 14 7 11 9 11 33 28 17 28 7 40 24 30 30 42 29 15 27 8 15 31 18 10 22 33 21 31 37 31 30 27 35 21 9 17 22 33 21 39 46 43 27 48 31 31 31 21 28 22 9 15 25 21 41 43 17 11 13 47 12 11 18 27 12 10 29 15 13 31 16 33 33 17 10 6 9 11 13 27 30 23 17 26 21 32 16 13 9 38 11 12 6 7 11 23 28 31 27 8 5 17 32 18 32 18 7 8 24 48 39 24 25 17 11 25 32 28 24 17 17 6 26 13 6 14 31 36 30 6 10 33 36 31 31 30 10 4 4 4 6 12 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_136305163_136306063
seq2: B6Ng01-260G07.b_43_943

seq1  GAATTCCCAACTCAATGCCTAACACTTCCTTCTCCCGCTACAGAAGGAGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCAACTCAATGCCTAACACTTCCTTCTCCCGCTACAGAAGGAGG  50

seq1  GGTTGGGGTGTGGCTCAGTTGCTATAGTGCTTGCCCAGCAAGTAGGAAGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTGGGGTGTGGCTCAGTTGCTATAGTGCTTGCCCAGCAAGTAGGAAGG  100

seq1  AGGCCCTGGGTCCACACCCAAGCACCACATAAAACCAGGAGTGGGGTCTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCCCTGGGTCCACACCCAAGCACCACATAAAACCAGGAGTGGGGTCTC  150

seq1  ATATCTGGGATCAGAACTGGGGATGCAAAGGCAGGAGAATGAGGAGTTTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATCTGGGATCAGAACTGGGGATGCAAAGGCAGGAGAATGAGGAGTTTG  200

seq1  AGGACCTTGAACTTGAGGCCAGCCTGGGACACATAGAACCCTGTCTCAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGACCTTGAACTTGAGGCCAGCCTGGGACACATAGAACCCTGTCTCAAA  250

seq1  TTGAGGCCAGCCTGGGCTATAATGAGACCCTGTTTCAGAAGAAAAAAAAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAGGCCAGCCTGGGCTATAATGAGACCCTGTTTCAGAAGAAAAAAAAA  300

seq1  TCCATGTCTTCCATTTCATCCCTTCCTAAAGCAGTATTTGGGTCACTTGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCATGTCTTCCATTTCATCCCTTCCTAAAGCAGTATTTGGGTCACTTGT  350

seq1  GTTTCTTCATTGCCCAGCTAGGACACAGGGTCCTGGAGGATGAAACAGGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTCTTCATTGCCCAGCTAGGACACAGGGTCCTGGAGGATGAAACAGGG  400

seq1  GTGTCCCAATGTCATCAAGCAGGGTGCAGAGAGAGAAAGGTGGTGTCCCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTCCCAATGTCATCAAGCAGGGTGCAGAGAGAGAAAGGTGGTGTCCCT  450

seq1  TGAAGGTAACCCGCTGGAGCCGACATTACAGGCTGTTCTTCAAAGAAGTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAGGTAACCCGCTGGAGCCGACATTACAGGCTGTTCTTCAAAGAAGTG  500

seq1  TGTGTGGGGGTCACCATCATGCAGCACCCTCCCCCCAATAGAGGGAACCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTGGGGGTCACCATCATGCAGCACCCTCCCCCCAATAGAGGGAACCC  550

seq1  GTTCCCACCCCTGTTTTCTCAGAGGCGCCTCTGAGGACCACGATGGCAAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCCCACCCCTGTTTTCTCAGAGGCGCCTCTGAGGACCACGATGGCAAT  600

seq1  AAAGGCACCCCTGTGTGTCTCTGGGGAAGCCGAGCTGGGGGTGGCGAGGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGCACCCCTGTGTGTCTCTGGGGAAGCCGAGCTGGGGGTGGCGAGGG  650

seq1  GGGCCCCACAAAGGACCCGCAGCTGTGTGTTTGCAAACAGGGGAGCTGAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCCCCACAAAGGACCCGCAGCTGTGTGTTTGCAAACAGGGGAGCTGAG  700

seq1  CTGTGCAGAGGGGCTGAAAGCAGTAATTGTCTTTAATTAAAGGAGGTTGG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGCAGAGGGGCTGAAAGCAGTAATTGTCTTTAATTAAAGGAGGTTGG  750

seq1  AGGCAGCGCGGGCTTTGACAAAAGAGATTTCCAGCCCGTGAGCAGCTTCA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAGCGCGGGCTTTGACAAAAGAGATTTCCAGCCCGTGAGCAGCTTCA  800

seq1  GCCAGCACTGGGTCTGGGCGCCTTCGGCTTTGTCCCTGTGGGGCCTGGCC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGCACTGGGTCTGGGCGCCTTCGGCTTTGTCCCTGTGGGGCCTGGCC  850

seq1  CCGTGGAGGGCTCGGCCAACACCTGCCTGCTGGAAGGGTGGGGGTGTGTG  900
      ||||||||||||||||||||||||||||||||||||||  |||| |||||
seq2  CCGTGGAGGGCTCGGCCAACACCTGCCTGCTGGAAGGGGTGGGGGGTGTG  900

seq1  T  901
      |
seq2  T  901

seq1: chr4_136363446_136364478
seq2: B6Ng01-260G07.g_61_1098 (reverse)

seq1  TGCTCTGCCCCCCTCCCCCTTTACTGAGGAG-AAAGTGAGAGCTGGGCAC  49
      |||||||||||| ||||| || ||||||||| ||||||||||||||||||
seq2  TGCTCTGCCCCCTTCCCCTTTAACTGAGGAGAAAAGTGAGAGCTGGGCAC  50

seq1  -AGTCTGAGGCTGATGCTGTCACTCCAGCTCTGGGCAAA--GGATCATGG  96
       ||||||||||||||||||||||||||||||||||||||  | |||||||
seq2  AAGTCTGAGGCTGATGCTGTCACTCCAGCTCTGGGCAAAAGGAATCATGG  100

seq1  GAAAGCCGCAAAGACAGAGAGATACAGGGCGCCTAGGGA-GAGACAAAGG  145
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  GAAAGCCGCAAAGACAGAGAGATACAGGGCGCCTAGGGAGGAGACAAAGG  150

seq1  AAGACAGCTGAGTTCAAGCTCATGCAGACAAGGGACCCAGGGGCCGAGGC  195
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGACAGCTGAGTTCAAGCTCATGCAGACAAGGGACCCAGGGGCCGAGGC  200

seq1  CTGAACTGCAGTCACTTCGTGGGTCTCACTTGAGCACTGCGCTCCCCCAG  245
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAACTGCAGTCACTTCGTGGGTCTCACTTGAGCACTGCGCTCCCCCAG  250

seq1  GGGACACTTAGAAATGTGCTGAGTGGTGCGATTTGGCTCGCTTGGTAGAG  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGACACTTAGAAATGTGCTGAGTGGTGCGATTTGGCTCGCTTGGTAGAG  300

seq1  TGGTTGCCTAACACAACCAAGGCCCTTCCTTGGTTTGATCCCCAACACGT  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTGCCTAACACAACCAAGGCCCTTCCTTGGTTTGATCCCCAACACGT  350

seq1  CATAAAACGGATCCTGGTGTAATCCCAGGGAGAGGCAGGAGAAAGAGGGA  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATAAAACGGATCCTGGTGTAATCCCAGGGAGAGGCAGGAGAAAGAGGGA  400

seq1  GTTCAAGGCTGTCCTCAGCCACCCAGCAAGCTACACAGATGCCTGAATAC  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCAAGGCTGTCCTCAGCCACCCAGCAAGCTACACAGATGCCTGAATAC  450

seq1  ACGAGCCTCAGTCTCATGCAAAGAGGCAAGTGTGCAGTAAGGTCTGGAAG  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGAGCCTCAGTCTCATGCAAAGAGGCAAGTGTGCAGTAAGGTCTGGAAG  500

seq1  GCTCAGGACATTAGCCATTCCAGTGTTGTCCCAGCCTAAGAGGACTGGAT  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCAGGACATTAGCCATTCCAGTGTTGTCCCAGCCTAAGAGGACTGGAT  550

seq1  GAAATCTCCTTGCCTTCTTAAGGAACATGGGGACAATGTGGCCATGGGGG  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATCTCCTTGCCTTCTTAAGGAACATGGGGACAATGTGGCCATGGGGG  600

seq1  GTGGTACATGAACATCCCACAGGCTAGAACCTGGGGCCCTTAACTTGCAA  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTACATGAACATCCCACAGGCTAGAACCTGGGGCCCTTAACTTGCAA  650

seq1  TGGGCAGGAAGTACATCCTCACGAAGAGAGAACTATGCTACGAACTATGC  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCAGGAAGTACATCCTCACGAAGAGAGAACTATGCTACGAACTATGC  700

seq1  TTGCTTAAAGAAAGTGAAATTGACTCCTACCCACCCCCCAATAAAGAAAG  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTTAAAGAAAGTGAAATTGACTCCTACCCACCCCCCAATAAAGAAAG  750

seq1  GAATGATAGAGACTCCAAAGACCAAAGCTCTCACCCAGGGAGAGGGCCTG  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATGATAGAGACTCCAAAGACCAAAGCTCTCACCCAGGGAGAGGGCCTG  800

seq1  CTGCCGTCATTCCAAGGAACACTGTCTCAGGGTCACTGGGGACCATAAAC  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCGTCATTCCAAGGAACACTGTCTCAGGGTCACTGGGGACCATAAAC  850

seq1  TGAACACAAGGAGTAACTAAAGGCTCAGGCAAATCATTTGGGCCCCCGAA  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAACACAAGGAGTAACTAAAGGCTCAGGCAAATCATTTGGGCCCCCGAA  900

seq1  GCTTCAAAAACAGGGTTTATTTAAATAATCCCTTGCCAGGCCTCCCAGCC  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTCAAAAACAGGGTTTATTTAAATAATCCCTTGCCAGGCCTCCCAGCC  950

seq1  TCAGCGCCTGGCTTCTCTAAGGATTTATTTTGTAAAAATGTCTCTCTCAA  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCGCCTGGCTTCTCTAAGGATTTATTTTGTAAAAATGTCTCTCTCAA  1000

seq1  CGAGTACAGCATCCTACCCTGAGCCGATGAGGGAATTC  1033
      ||||||||||||||||||||||||||||||||||||||
seq2  CGAGTACAGCATCCTACCCTGAGCCGATGAGGGAATTC  1038

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information