MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-268A18
Chromosome	4 (Build37)
Map Location	41,483,695 - 41,627,518
singlet/doublet	doublet
Overlap gene	2310028H24Rik, Dnaic1, 2310040A07Rik, LOC100042420, Cntfr
Upstream gene	Aptx, LOC665630, LOC622208, Dnaja1, Smu1, LOC100042305, B4galt1, LOC100039668, Spink4, Bag1, Chmp5, Nfx1, Aqp7, Aqp3, Nol6, Ube2r2, Ubap2, Wdr40a, Ubap1, Kif24, Nudt2, AI464131, 1110017D15Rik, 1700066J24Rik
Downstream gene	2810432D09Rik, Dctn3, OTTMUSG00000006683, Oprs1, Galt, Il11ra1, Ccl27, LOC100039789, LOC623085, LOC100042466, LOC100042472, LOC100042493, Ccl19-ps1, LOC621580, LOC545611, LOC100042524, LOC100042519, LOC100039817, LOC100042536, LOC100039824, LOC100042539, LOC100042544, LOC100039848, LOC100039863, LOC100042555, 1700045I11Rik, LOC100039894, LOC100039909, EG545605, LOC674214, LOC100038965, LOC100039053, LOC100039193, LOC100039374, LOC100039930, LOC100038993, LOC100039939, Ccl19-ps3, Ccl21c, LOC100039323, LOC665845, LOC100039973, LOC100039986, 4933409K07Rik, LOC100039344, LOC100039995, EG623054, Ccl19-ps2, LOC100039331, LOC100039131
Link	Open Mouse BAC browser

Click to get alignment info.

name	Aptx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66408 MGI:1913658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC665630 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665630
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC622208 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs

name	Dnaja1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15502 MGI:1270129
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smu1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74255 MGI:1915546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042305 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 129 ESTs, 5 Proteins

name	B4galt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14595 MGI:95705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039668 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 120 ESTs, 6 Proteins

name	Spink4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20731 MGI:1341848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bag1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12017 MGI:108047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chmp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76959 MGI:1924209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nfx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74164 MGI:1921414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aqp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11832 MGI:1314647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aqp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11828 MGI:1333777
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nol6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230082 MGI:2140151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2r2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67615 MGI:1914865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68926 MGI:1916176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr40a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68970 MGI:1916220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67123 MGI:2149543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109242 MGI:1918345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nudt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66401 MGI:1913651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI464131 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329828 MGI:2140300
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 56 ESTs, 3 Proteins

name	1110017D15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73721 MGI:1920971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	1700066J24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76992 MGI:1924242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	2310028H24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71901 MGI:1919151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnaic1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68922 MGI:1916172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310040A07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69638 MGI:1916888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 29 ESTs

name	LOC100042420 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 27 ESTs, 1 Protein

name	Cntfr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12804 MGI:99605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810432D09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69961 MGI:1917211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dctn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53598 MGI:1859251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000006683 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:550619 MGI:3650624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oprs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18391 MGI:1195268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Galt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14430 MGI:95638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il11ra1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16157 MGI:107426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20301 MGI:1343459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100039789 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039789
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins

name	LOC623085 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042466 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 77 ESTs, 1 Protein

name	LOC100042472 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 54 ESTs, 1 Protein pseudo : _no_value

name	LOC100042493 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 54 ESTs, 5 Proteins

name	Ccl19-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65957 MGI:1891387
definition	gene_synonym : ELC; Scya19-ps1 note : chemokine (C-C motif) ligand 19, pseudogene 1 pseudo : _no_value

name	LOC621580 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 23 ESTs

name	LOC545611 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins

name	LOC100042524 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042524
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 77 ESTs pseudo : _no_value

name	LOC100042519 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 67 ESTs, 1 Protein pseudo : _no_value

name	LOC100039817 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	LOC100042536 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 87 ESTs, 1 Protein

name	LOC100039824 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039824
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	LOC100042539 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 87 ESTs, 1 Protein

name	LOC100042544 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042544
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 54 ESTs, 5 Proteins

name	LOC100039848 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	LOC100039863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 56 ESTs, 1 Protein

name	LOC100042555 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 115 ESTs, 6 Proteins

name	1700045I11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73350 MGI:1920600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100039909 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039909
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 48 ESTs, 1 Protein

name	EG545605 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545605 MGI:3704096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 53 ESTs, 1 Protein

name	LOC674214 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 66 ESTs pseudo : _no_value

name	LOC100038965 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038965
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 54 ESTs, 6 Proteins

name	LOC100039053 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039053
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 12 ESTs, 3 Proteins

name	LOC100039193 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039193
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs

name	LOC100039374 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 57 ESTs, 1 Protein pseudo : _no_value

name	LOC100039930 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038993 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038993
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 115 ESTs, 6 Proteins

name	LOC100039939 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 1 Protein

name	Ccl19-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65959 MGI:1891391
definition	gene_synonym : ELC; Scya19-ps3 note : chemokine (C-C motif) ligand 19, pseudogene 3 pseudo : _no_value

name	Ccl21c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65956 MGI:1891386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039323 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 87 ESTs, 1 Protein

name	LOC665845 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 87 ESTs, 1 Protein

name	LOC100039973 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	LOC100039986 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	4933409K07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108816 MGI:1918429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039344 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 77 ESTs pseudo : _no_value

name	LOC100039995 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins

name	EG623054 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623054 MGI:3643815
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	Ccl19-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65958 MGI:1891390
definition	gene_synonym : ELC; Scya19-ps2 note : chemokine (C-C motif) ligand 19, pseudogene 2 pseudo : _no_value

name	LOC100039331 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 87 ESTs, 1 Protein

name	LOC100039131 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 55 ESTs, 5 Proteins

name	Aptx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115292443 GeneID:66408 MGI:1913658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aprataxin transcript_id : NM_001025444.2

name	Aptx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115292446 GeneID:66408 MGI:1913658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aprataxin transcript_id : NM_025545.4

name	LOC622208 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94371690 GeneID:622208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs product : hypothetical LOC622208 transcript_id : XM_896940.2

name	Dnaja1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802804 GeneID:15502 MGI:1270129
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily A, member 1 transcript_id : NM_008298.3

name	Smu1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803589 GeneID:74255 MGI:1915546
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) transcript_id : NM_021535.3

name	LOC100042305 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252292 GeneID:100042305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 129 ESTs, 5 Proteins product : similar to presenilin enhancer 2 homolog transcript_id : XM_001478012.1

name	B4galt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129977 GeneID:14595 MGI:95705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 transcript_id : NM_022305.3

name	LOC100039668 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252250 GeneID:100039668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 120 ESTs, 6 Proteins product : similar to F-box and leucine-rich repeat protein 10 transcript_id : XM_001473301.1

name	Spink4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842399 GeneID:20731 MGI:1341848
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine peptidase inhibitor, Kazal type 4 transcript_id : NM_011463.2

name	Bag1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753159 GeneID:12017 MGI:108047
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl2-associated athanogene 1 transcript_id : NM_009736.1

name	Chmp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13386441 GeneID:76959 MGI:1924209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromatin modifying protein 5 transcript_id : NM_029814.1

name	Nfx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347528 GeneID:74164 MGI:1921414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear transcription factor, X-box binding 1 transcript_id : NM_023739.3

name	Aqp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982531 GeneID:11832 MGI:1314647
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aquaporin 7 transcript_id : NM_007473.3

name	Aqp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121949812 GeneID:11828 MGI:1333777
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aquaporin 3 transcript_id : NM_016689.2

name	Nol6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031987 GeneID:230082 MGI:2140151
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar protein family 6 (RNA-associated) transcript_id : NM_139236.3

name	Ube2r2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802140 GeneID:67615 MGI:1914865
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2R 2 transcript_id : NM_026275.3

name	Ubap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076914 GeneID:68926 MGI:1916176
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-associated protein 2 transcript_id : NM_026872.1

name	Wdr40a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541821 GeneID:68970 MGI:1916220
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 40A transcript_id : NM_026893.2

name	Ubap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15011881 GeneID:67123 MGI:2149543
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-associated protein 1 transcript_id : NM_023305.2

name	Kif24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68448533 GeneID:109242 MGI:1918345
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 24 transcript_id : NM_024241.1

name	Nudt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86198334 GeneID:66401 MGI:1913651
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 2 transcript_id : NM_025539.2

name	AI464131 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371694 GeneID:329828 MGI:2140300
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 56 ESTs, 3 Proteins product : expressed sequence AI464131, transcript variant 1 transcript_id : XM_283952.6

name	1110017D15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114520612 GeneID:73721 MGI:1920971
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110017D15 gene transcript_id : NM_001048005.1

name	1110017D15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114520610 GeneID:73721 MGI:1920971
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110017D15 gene transcript_id : NM_028624.1

name	1700066J24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252252 GeneID:76992 MGI:1924242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 1700066J24 gene transcript_id : XM_001473370.1

name	2310028H24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388829 GeneID:71901 MGI:1919151
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310028H24 gene transcript_id : NM_027993.2

name	Dnaic1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383967 GeneID:68922 MGI:1916172
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein, axonemal, intermediate chain 1 transcript_id : NM_175138.3

name	2310040A07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252254 GeneID:69638 MGI:1916888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 29 ESTs product : RIKEN cDNA 2310040A07 gene transcript_id : XM_001473388.1

name	LOC100042420 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252294 GeneID:100042420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 27 ESTs, 1 Protein product : similar to 2310040A07Rik protein transcript_id : XM_001478385.1

name	Cntfr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7710005 GeneID:12804 MGI:99605
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ciliary neurotrophic factor receptor transcript_id : NM_016673.1

name	2810432D09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312503 GeneID:69961 MGI:1917211
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810432D09 gene transcript_id : NM_027278.1

name	Dctn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380109 GeneID:53598 MGI:1859251
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynactin 3 transcript_id : NM_016890.3

name	OTTMUSG00000006683 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134244289 GeneID:550619 MGI:3650624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000006683 transcript_id : NM_001017362.2

name	Oprs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892605 GeneID:18391 MGI:1195268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : opioid receptor, sigma 1 transcript_id : NM_011014.2

name	Galt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120952694 GeneID:14430 MGI:95638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactose-1-phosphate uridyl transferase transcript_id : NM_016658.2

name	Il11ra1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802044 GeneID:16157 MGI:107426
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 11 receptor, alpha chain 1 transcript_id : NM_010549.2

name	Ccl27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431221 GeneID:20301 MGI:1343459
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 27 transcript_id : NM_001048179.1

name	Ccl27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755427 GeneID:20301 MGI:1343459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 27 transcript_id : NM_011336.1

name	LOC100039789 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252256 GeneID:100039789
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : similar to EBI-1 ligand chemokine transcript_id : XM_001473508.1

name	LOC623085 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252258 GeneID:623085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical LOC623085 transcript_id : XM_001473534.1

name	LOC100042466 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252296 GeneID:100042466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 77 ESTs, 1 Protein product : similar to 4933409K07Rik protein transcript_id : XM_001478493.1

name	LOC100042493 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252299 GeneID:100042493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 54 ESTs, 5 Proteins product : similar to beta chemokine Exodus-2 transcript_id : XM_001478541.1

name	LOC621580 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252301 GeneID:621580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs product : hypothetical LOC621580, transcript variant 1 transcript_id : XM_001487802.1

name	LOC621580 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252303 GeneID:621580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs product : hypothetical LOC621580, transcript variant 2 transcript_id : XM_001487803.1

name	LOC545611 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252260 GeneID:545611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : hypothetical LOC545611 transcript_id : XM_620023.4

name	LOC100039817 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252262 GeneID:100039817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical protein LOC100039817 transcript_id : XM_001473592.1

name	LOC100042536 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252307 GeneID:100042536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 87 ESTs, 1 Protein product : similar to 4933409K07Rik protein transcript_id : XM_001478587.1

name	LOC100039824 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252264 GeneID:100039824
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to EBI-1 ligand chemokine transcript_id : XM_001473611.1

name	LOC100042539 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252309 GeneID:100042539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 87 ESTs, 1 Protein product : similar to 4933409K07Rik protein transcript_id : XM_001478593.1

name	LOC100042544 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252311 GeneID:100042544
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 54 ESTs, 5 Proteins product : similar to beta chemokine Exodus-2 transcript_id : XM_001478610.1

name	LOC100039848 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252266 GeneID:100039848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to EBI-1 ligand chemokine transcript_id : XM_001473659.1

name	LOC100039863 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252268 GeneID:100039863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 56 ESTs, 1 Protein product : similar to chemokine (C-C motif) ligand 27 transcript_id : XM_001473680.1

name	LOC100042555 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252313 GeneID:100042555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 115 ESTs, 6 Proteins product : similar to interleukin 11 receptor, alpha chain 2 transcript_id : XM_001478617.1

name	1700045I11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252270 GeneID:73350 MGI:1920600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700045I11 gene transcript_id : XM_001487791.1

name	LOC100039894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252272 GeneID:100039894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : hypothetical protein LOC100039894 transcript_id : XM_001473735.1

name	LOC100039909 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252274 GeneID:100039909
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 48 ESTs, 1 Protein product : similar to 4933409K07Rik protein transcript_id : XM_001473759.1

name	LOC100038965 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252318 GeneID:100038965
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 54 ESTs, 6 Proteins product : similar to TCA4 transcript_id : XM_001471996.1

name	LOC100039053 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252322 GeneID:100039053
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 12 ESTs, 3 Proteins product : similar to EBI-1 ligand chemokine transcript_id : XM_001472168.1

name	LOC100039193 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252326 GeneID:100039193
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs product : similar to chemokine (C-C motif) ligand 27 transcript_id : XM_001472298.1

name	LOC100039930 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252343 GeneID:100039930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : similar to CG31439-PA transcript_id : XM_001473797.1

name	LOC100038993 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252320 GeneID:100038993
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 115 ESTs, 6 Proteins product : similar to interleukin 11 receptor, alpha chain 2 transcript_id : XM_001472054.1

name	LOC100039939 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252346 GeneID:100039939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 1 Protein product : similar to chemokine (C-C motif) ligand 27 transcript_id : XM_001473820.1

name	Ccl21c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922618 GeneID:65956 MGI:1891386
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 21c (leucine) transcript_id : NM_023052.2

name	LOC100039323 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252332 GeneID:100039323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 87 ESTs, 1 Protein product : similar to 4933409K07Rik protein transcript_id : XM_001472444.1

name	LOC665845 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252329 GeneID:665845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 87 ESTs, 1 Protein product : similar to 4933409K07Rik protein transcript_id : XM_979819.2

name	LOC100039973 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252348 GeneID:100039973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to EBI-1 ligand chemokine transcript_id : XM_001473878.1

name	LOC100039986 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252352 GeneID:100039986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical protein LOC100039986 transcript_id : XM_001473895.1

name	4933409K07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61657927 GeneID:108816 MGI:1918429
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933409K07 gene transcript_id : NM_178649.4

name	LOC100039995 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252354 GeneID:100039995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : similar to 4933409K07Rik protein transcript_id : XM_001473914.1

name	EG623054 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252356 GeneID:623054 MGI:3643815
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : predicted gene, EG623054 transcript_id : XM_897499.3

name	LOC100039331 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252334 GeneID:100039331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 87 ESTs, 1 Protein product : similar to 4933409K07Rik protein transcript_id : XM_001472494.1

name	LOC100039131 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252324 GeneID:100039131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 55 ESTs, 5 Proteins product : similar to beta chemokine Exodus-2 transcript_id : XM_001472262.1

name	Aptx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32526865 GeneID:66408 MGI:1913658
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005654 - nucleoplasm [Evidence TAS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence TAS]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; forkhead-associated domain histidine-triad like product : aprataxin isoform a protein_id : NP_079821.3

name	Aptx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70887792 GeneID:66408 MGI:1913658
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005654 - nucleoplasm [Evidence TAS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence TAS]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; forkhead-associated domain histidine-triad like product : aprataxin isoform b protein_id : NP_001020615.1

name	LOC622208 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94371691 GeneID:622208
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902033.2

name	Dnaja1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680297 CCDS:CCDS18049.1 GeneID:15502 MGI:1270129
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0050750 - low-density lipoprotein receptor binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030521 - androgen receptor signaling pathway [Evidence IMP]; GO:0006457 - protein folding [Evidence IEA]; GO:0009408 - response to heat [Evidence IEA]; GO:0030317 - sperm motility [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : heat shock protein, DNAJ-like 2; neural precursor cell expressed, developmentally down-regulated gene 7 product : DnaJ (Hsp40) homolog, subfamily A, member 1 protein_id : NP_032324.1

name	Smu1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981191 CCDS:CCDS18050.1 GeneID:74255 MGI:1915546
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : smu-1 suppressor of mec-8 and unc-52 homolog protein_id : NP_067510.2

name	LOC100042305 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252293 GeneID:100042305
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478062.1

name	B4galt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11602910 CCDS:CCDS18051.1 GeneID:14595 MGI:95705
definition	EC_number : 2.4.1.38 GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0003831 - beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity [Evidence IDA] [Evidence IMP]; GO:0004461 - lactose synthase activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003945 - N-acetyllactosamine synthase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0045136 - development of secondary sexual characteristics [Evidence IMP]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IMP]; GO:0006012 - galactose metabolism [Evidence IDA]; GO:0009312 - oligosaccharide biosynthesis [Evidence IDA] codon_start : 1 note : galactosyltransferase 2 beta 1, 4; glycoprotein galactosyltransferase beta 1, 4; beta-1,4-GalT; B-1,4-GalT1; beta-1,4-GalT1; b1,4-Galactosyltransferase I; beta 1,4-Galactosyltransferase I; beta-1,4-galactosyltransferase (short form); UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 1 product : UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 protein_id : NP_071641.1

name	LOC100039668 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252251 GeneID:100039668
definition	codon_start : 1 product : similar to F-box and leucine-rich repeat protein 10 protein_id : XP_001473351.1

name	Spink4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842400 CCDS:CCDS18052.1 GeneID:20731 MGI:1341848
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 product : serine protease inhibitor, Kazal type 4 protein_id : NP_035593.2

name	Bag1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34398362 GeneID:12017 MGI:108047
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0030182 - neuron differentiation [Evidence IDA]; GO:0006457 - protein folding [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA] codon_start : 1 exception : mismatches in translation note : non-AUG (CUG) translation initiation codon product : Bcl2-associated athanogene 1 isoform 1L protein_id : NP_033866.3 transl_except : (pos:complement(40895233..40895235),aa:Met)

name	Chmp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386442 CCDS:CCDS18053.1 GeneID:76959 MGI:1924209
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008333 - endosome to lysosome transport [Evidence IMP]; GO:0007040 - lysosome organization and biogenesis [Evidence IMP]; GO:0015031 - protein transport [Evidence IEA]; GO:0001919 - regulation of receptor recycling [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : likely ortholog of H. sapiens SNF7 domain containing 2 product : chromatin modifying protein 5 protein_id : NP_084090.1

name	Nfx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347529 CCDS:CCDS18054.1 GeneID:74164 MGI:1921414
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045347 - negative regulation of MHC class II biosynthesis [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : nuclear X box binding factor 1; testis expressed gene 42 product : nuclear transcription factor, X-box binding 1 protein_id : NP_076228.2

name	Aqp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680712 CCDS:CCDS18055.1 GeneID:11832 MGI:1314647
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA]; GO:0015250 - water channel activity [Evidence TAS] GO_process : GO:0006810 - transport [Evidence IEA]; GO:0006833 - water transport [Evidence TAS] codon_start : 1 product : aquaporin 7 protein_id : NP_031499.1

name	Aqp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121949813 GeneID:11828 MGI:1333777
definition	GO_component : GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA]; GO:0015250 - water channel activity [Evidence TAS] GO_process : GO:0006810 - transport [Evidence IEA]; GO:0006833 - water transport [Evidence TAS] codon_start : 1 product : aquaporin 3 protein_id : NP_057898.2

name	Nol6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118026904 GeneID:230082 MGI:2140151
definition	GO_component : GO:0000794 - condensed nuclear chromosome [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005732 - small nucleolar ribonucleoprotein complex [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA]; GO:0030515 - snoRNA binding [Evidence ISS] GO_process : GO:0006365 - 35S primary transcript processing [Evidence ISS]; GO:0008150 - biological_process [Evidence ND]; GO:0007046 - ribosome biogenesis [Evidence NAS] codon_start : 1 product : nucleolar protein family 6 protein_id : NP_631982.2

name	Ube2r2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385778 CCDS:CCDS18057.1 GeneID:67615 MGI:1914865
definition	codon_start : 1 product : ubiquitin-conjugating enzyme E2R 2 protein_id : NP_080551.1

name	Ubap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076915 CCDS:CCDS18058.1 GeneID:68926 MGI:1916176
definition	codon_start : 1 product : ubiquitin-associated protein 2 protein_id : NP_081148.1

name	Wdr40a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541822 CCDS:CCDS18059.1 GeneID:68970 MGI:1916220
definition	codon_start : 1 product : WD repeat domain 40A protein_id : NP_081169.2

name	Ubap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15011882 GeneID:67123 MGI:2149543
definition	codon_start : 1 exception : unclassified translation discrepancy product : ubiquitin-associated protein 1 protein_id : NP_075794.2

name	Kif24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68448534 CCDS:CCDS18060.1 GeneID:109242 MGI:1918345
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA] codon_start : 1 product : kinesin family member 24 protein_id : NP_077203.1

name	Nudt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86198335 CCDS:CCDS18061.1 GeneID:66401 MGI:1913651
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004081 - bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity [Evidence IEA] [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006917 - induction of apoptosis [Evidence ISS] codon_start : 1 product : nudix (nucleoside diphosphate linked moiety X)-type motif 2 protein_id : NP_079815.2

name	AI464131 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28495681 GeneID:329828 MGI:2140300
definition	codon_start : 1 product : hypothetical protein LOC329828 isoform 1 protein_id : XP_283952.1

name	1110017D15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114520613 GeneID:73721 MGI:1920971
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1; spermatid specific manchette related protein 1; testes development-related NYD-SP22; ciliated bronchial epithelium 1; likely ortholog of H. sapiens chromosome 9 open reading frame 24 (C9orf24) product : testes development-related NYD-SP22 isoform 1 protein_id : NP_001041470.1

name	1110017D15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114520611 GeneID:73721 MGI:1920971
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2; spermatid specific manchette related protein 1; testes development-related NYD-SP22; ciliated bronchial epithelium 1; likely ortholog of H. sapiens chromosome 9 open reading frame 24 (C9orf24) product : testes development-related NYD-SP22 isoform 2 protein_id : NP_082900.1

name	1700066J24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252253 GeneID:76992 MGI:1924242
definition	codon_start : 1 product : hypothetical protein LOC76992 protein_id : XP_001473420.1

name	2310028H24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91206448 GeneID:71901 MGI:1919151
definition	codon_start : 1 exception : mismatches in translation note : likely ortholog of H. sapiens chromosome 9 open reading frame 25 (C9orf25) product : hypothetical protein LOC71901 protein_id : NP_082269.1

name	Dnaic1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29611661 CCDS:CCDS18066.1 GeneID:68922 MGI:1916172
definition	codon_start : 1 exception : mismatches in translation product : dynein, axonemal, intermediate chain 1 protein_id : NP_780347.1

name	LOC100042420 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252295 GeneID:100042420
definition	codon_start : 1 product : similar to 2310040A07Rik protein protein_id : XP_001478435.1

name	2310040A07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252255 GeneID:69638 MGI:1916888
definition	codon_start : 1 product : hypothetical protein LOC69638 protein_id : XP_001473438.1

name	Cntfr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710006 CCDS:CCDS18067.1 GeneID:12804 MGI:99605
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008284 - positive regulation of cell proliferation [Evidence IGI] codon_start : 1 exception : mismatches in translation product : ciliary neurotrophic factor receptor protein_id : NP_057882.1

name	2810432D09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312504 CCDS:CCDS18068.1 GeneID:69961 MGI:1917211
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC69961 protein_id : NP_081554.1

name	Dctn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980821 CCDS:CCDS18069.1 GeneID:53598 MGI:1859251
definition	GO_component : GO:0005869 - dynactin complex [Evidence ISS] [Evidence IDA]; GO:0005875 - microtubule associated complex [Evidence IDA]; GO:0048471 - perinuclear region [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000910 - cytokinesis [Evidence ISS]; GO:0007017 - microtubule-based process [Evidence IDA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : dynactin light chain (P24); p24 dynactin light chain product : dynactin 3 protein_id : NP_058586.2

name	OTTMUSG00000006683 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62865645 GeneID:550619 MGI:3650624
definition	codon_start : 1 note : AT rich interactive domain 3C (Bright like) product : AT rich interactive domain 3C protein_id : NP_001017362.1

name	Oprs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754942 CCDS:CCDS18070.1 GeneID:18391 MGI:1195268
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0000247 - C-8 sterol isomerase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IDA] GO_process : GO:0006696 - ergosterol biosynthesis [Evidence IEA] codon_start : 1 product : opioid receptor, sigma 1 protein_id : NP_035144.1

name	Galt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120952695 GeneID:14430 MGI:95638
definition	GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008108 - UDP-glucose:hexose-1-phosphate uridylyltransferase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006012 - galactose metabolism [Evidence IMP] codon_start : 1 product : galactose-1-phosphate uridyl transferase protein_id : NP_057867.2

name	Il11ra1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7110651 CCDS:CCDS18071.1 GeneID:16157 MGI:107426
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004921 - interleukin-11 receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0001779 - natural killer cell differentiation [Evidence IMP] codon_start : 1 note : locus 2; interleukin 11 receptor, alpha chain 2 product : interleukin 11 receptor, alpha chain 1 protein_id : NP_034679.1

name	Ccl27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114431222 GeneID:20301 MGI:1343459
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; small inducible cytokine A27; chemokine (C-C motif) ligand 27a; small inducible cytokine A27a; skinkine; skinskine; chemokine (C-C motif) ligand 27b; small inducible cytokine A27b product : chemokine (C-C motif) ligand 27 isoform b protein_id : NP_001041644.1

name	Ccl27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755428 CCDS:CCDS18072.1 GeneID:20301 MGI:1343459
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; small inducible cytokine A27; chemokine (C-C motif) ligand 27a; small inducible cytokine A27a; skinkine; skinskine; chemokine (C-C motif) ligand 27b; small inducible cytokine A27b product : chemokine (C-C motif) ligand 27 isoform a protein_id : NP_035466.1

name	LOC100039789 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252257 GeneID:100039789
definition	codon_start : 1 product : similar to EBI-1 ligand chemokine protein_id : XP_001473558.1

name	LOC623085 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252259 GeneID:623085
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473584.1

name	LOC100042466 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252297 GeneID:100042466
definition	codon_start : 1 product : similar to 4933409K07Rik protein protein_id : XP_001478543.1

name	LOC100042493 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252300 GeneID:100042493
definition	codon_start : 1 product : similar to beta chemokine Exodus-2 protein_id : XP_001478591.1

name	LOC621580 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252302 GeneID:621580
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001487852.1

name	LOC621580 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252304 GeneID:621580
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001487853.1

name	LOC545611 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252261 GeneID:545611
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620023.2

name	LOC100039817 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252263 GeneID:100039817
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473642.1

name	LOC100039824 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252265 GeneID:100039824
definition	codon_start : 1 product : similar to EBI-1 ligand chemokine protein_id : XP_001473661.1

name	LOC100042536 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252308 GeneID:100042536
definition	codon_start : 1 product : similar to 4933409K07Rik protein protein_id : XP_001478637.1

name	LOC100042539 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252310 GeneID:100042539
definition	codon_start : 1 product : similar to 4933409K07Rik protein protein_id : XP_001478643.1

name	LOC100042544 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252312 GeneID:100042544
definition	codon_start : 1 product : similar to beta chemokine Exodus-2 protein_id : XP_001478660.1

name	LOC100039848 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252267 GeneID:100039848
definition	codon_start : 1 product : similar to EBI-1 ligand chemokine protein_id : XP_001473709.1

name	LOC100039863 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252269 GeneID:100039863
definition	codon_start : 1 product : similar to chemokine (C-C motif) ligand 27 protein_id : XP_001473730.1

name	LOC100042555 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252314 GeneID:100042555
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478667.1

name	1700045I11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252271 GeneID:73350 MGI:1920600
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001487841.1

name	LOC100039894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252273 GeneID:100039894
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473785.1

name	LOC100039909 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252275 GeneID:100039909
definition	codon_start : 1 product : similar to 4933409K07Rik protein protein_id : XP_001473809.1

name	LOC100038965 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252319 GeneID:100038965
definition	codon_start : 1 product : similar to TCA4 protein_id : XP_001472046.1

name	LOC100039053 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252323 GeneID:100039053
definition	codon_start : 1 product : similar to EBI-1 ligand chemokine protein_id : XP_001472218.1

name	LOC100039193 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252327 GeneID:100039193
definition	codon_start : 1 product : similar to chemokine (C-C motif) ligand 27 protein_id : XP_001472348.1

name	LOC100039930 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252344 GeneID:100039930
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473847.1

name	LOC100038993 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252321 GeneID:100038993
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472104.1

name	LOC100039939 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252347 GeneID:100039939
definition	codon_start : 1 product : similar to chemokine (C-C motif) ligand 27 protein_id : XP_001473870.1

name	Ccl21c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14547895 GeneID:65956 MGI:1891386
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : small inducible cytokine A21c; Ccl21-leu; novel protein similar to chemokine (C-C motif) ligand 21b (serine) Ccl21b product : chemokine (C-C motif) ligand 21c (serine) protein_id : NP_075539.1

name	LOC100039323 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252333 GeneID:100039323
definition	codon_start : 1 product : similar to 4933409K07Rik protein protein_id : XP_001472494.1

name	LOC665845 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94371716 GeneID:665845
definition	codon_start : 1 product : similar to 4933409K07Rik protein protein_id : XP_984913.1

name	LOC100039973 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252349 GeneID:100039973
definition	codon_start : 1 product : similar to EBI-1 ligand chemokine protein_id : XP_001473928.1

name	LOC100039986 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252353 GeneID:100039986
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473945.1

name	4933409K07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61657928 GeneID:108816 MGI:1918429
definition	codon_start : 1 product : hypothetical protein LOC108816 protein_id : NP_848764.3

name	LOC100039995 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252355 GeneID:100039995
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473964.1

name	EG623054 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252357 GeneID:623054 MGI:3643815
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902592.3

name	LOC100039331 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252335 GeneID:100039331
definition	codon_start : 1 product : similar to 4933409K07Rik protein protein_id : XP_001472544.1

name	LOC100039131 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252325 GeneID:100039131
definition	codon_start : 1 product : similar to beta chemokine Exodus-2 protein_id : XP_001472312.1

name	LOC665630 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665630
definition	number : 2 pseudo : _no_value

name	LOC665630 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665630
definition	number : 1 pseudo : _no_value

name	LOC100042472 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252298 GeneID:100042472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 54 ESTs, 1 Protein product : similar to 4933409K07Rik protein pseudo : _no_value transcript_id : XR_033727.1

name	LOC100042524 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252306 GeneID:100042524
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 77 ESTs product : similar to RIKEN cDNA 4933409K07 gene pseudo : _no_value transcript_id : XR_033762.1

name	LOC100042519 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252305 GeneID:100042519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 67 ESTs, 1 Protein product : similar to 4933409K07Rik protein pseudo : _no_value transcript_id : XR_033754.1

name	EG545605 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149252315 GeneID:545605 MGI:3704096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 53 ESTs, 1 Protein product : predicted gene, EG545605 transcript_id : XR_033794.1

name	LOC674214 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252317 GeneID:674214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 66 ESTs product : similar to 4933409K07Rik protein pseudo : _no_value transcript_id : XR_030504.1

name	LOC100039374 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252337 GeneID:100039374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 57 ESTs, 1 Protein product : similar to 4933409K07Rik protein pseudo : _no_value transcript_id : XR_030760.1

name	LOC100039344 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252336 GeneID:100039344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 77 ESTs product : similar to RIKEN cDNA 4933409K07 gene pseudo : _no_value transcript_id : XR_030749.1

clone name	MSMg01-409F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-424O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499G20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-263L06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-177E23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338P06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-499G20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-296B01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-337C09
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-249N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196I11
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-268A18.b	B6Ng01-268A18.g
ACC	GA071013	GA071014
length	1,022	1,155
definition	B6Ng01-268A18.b	B6Ng01-268A18.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(41,626,509 - 41,627,518)	(41,483,695 - 41,484,865)
sequence	gaattcctctgctctttcctgctccccgtgcaagaggcaggggctgctgg agcaaatgccttctgaagagacaagcccagacctcctgcatctagaggtc tgctccgagtacagttccagggctctgagtggacctctccatgtgggctc aggctggcgggatggattctcatcttcccaggacatgtccccagctgctc agtcagacccatcgtaggagggccccaggctcttctaacacgcctgtaca cacgtgcaacaagcagggcacgcacatgctgaactcagggtccccacggt acaagaggctgggggtgggggtgtgtgagcacttagagtccaggctgctg ccaaaatccatcggaatctctgtgtccccccccccacgggcccccatctc cggctctggaggtcacaacagcaggtgcggatacccacccccccaactca ctcacatcggggcggcctccttttccacaacctcagccagaggctggagc tgggaaattgctattgctgcctctgtcttgccctccctcccactggtgct cagccgtatcctaccccttctaagcaggagggggcacacatactggtgtg gggtcctttcccctgggcactcaggcttgccgtgggagggactgtagcag cccagaaggagaagaaggcttgaatcccaacctcagtcacagcttctggg tcctatgtcgcttggtggcaccaagaggtgagaggaagaggagggctaga ttcaaaggagggaaagggatagaaccagagacaagagagtcagaaagaca ggagggaggcatgcaactattaagtgggagcctatagcccaggagtggcc ctgacctgtgcccccttcttcttttctctccccttccccccccccccccc cggggtgaggggaccttgcttggcccaacttgccaggagccaggcctccc tccgtgggcctgggtcctcctccaatccagcctagtgaaaccatttcagg cctcttgcacaggccccctccg	gaattcaggccatcaaacccgtccatcatcttcagagacagctccagccc tcattttctgcttccctctggggaatcttctctaaagaatagaatttccc ctggggaatcacccgctagacaaaatattcctgacttgaggttatcaatg aggaacaaaaggaaggacaggtttgccacagtgaggtttggggaggctct agtgatcaccagtactgcctggtagctggctatacatttggcatgctcat taggtccttgctcctgccagcacaccagctgtggtccttgctcctaccag cacaccattggtagtaaccatgacttggtagagccaggaggcaaacctca acaaagcaactcctttgctttcggacttgggccaggagaaccaagcaaaa tgtcctggaagttactgaagcttgtatggcagtttttatgctaagatttt aaaaatgtgtgtgtgtgtgtgtgtgtgcatgtgtgtgtgctgcatgtgta tatggtgtgtgagtgcacacatgtggaggtcagcagacgactctgtggaa ctggttctcttcacctttctgtggattctgaggatcacactgggtcacgg ggctcatcccacaagcacctttacccactgagcaatcctacctaccacac tcttccttttctttcctttctttaaaaaaaatatttttatgtgtagctcg gagtggtggtgcatgactttaatcctagcactggggaggcagaggtaggt gatctctgtgagtttgaggctagcctggtctacataaatgagtctaggac gaccagggctctgttatacagagaaaccctgacttagggagagaagaaaa aggaaaaagaattttttatgtgtatgggtattttgcctgcgtgtgtctgc actccatgagtgtctggagccaagggagccagagagggcacatatctcct ggaacagagtacagatggtgtgagccatcatatgggtgctggaaatcaac cctgaactcgaggagcagccagtgctctactaccgagccacctctctagg tccgttcttcttttcttcgtttttggaaacaaggttccatgtagtccatg atgcctccacactcctgcaagcttagacggtcttaaacttgaagtctctt gccgt
quality values	Open. Hide. 58 31 32 30 58 58 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 59 59 59 59 43 44 59 46 49 59 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 49 49 54 62 62 62 62 62 62 62 59 59 62 62 62 62 62 54 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 54 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 54 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 52 58 54 58 58 54 58 58 58 58 54 52 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 54 41 47 58 54 58 54 44 49 54 33 58 58 58 58 51 42 54 54 58 54 58 54 58 58 58 58 54 58 52 54 58 58 58 52 47 58 58 58 46 49 52 54 54 54 54 52 58 52 50 48 58 49 50 18 58 51 54 49 49 46 51 49 50 58 58 58 45 35 58 48 48 30 51 58 51 58 32 54 46 18 53 58 49 39 31 58 40 25 45 39 33 58 58 39 58 47 22 32 25 58 41 47 51 50 49 50 48 48 27 42 41 39 50 50 52 53 58 41 46 50 50 52 51 58 42 52 53 53 58 58 52 47 50 37 42 52 58 42 42 50 35 31 28 51 52 39 53 54 32 41 53 28 14 39 26 44 17 28 27 49 58 31 46 39 34 49 51 26 54 21 33 32 6 49 44 39 51 40 27 21 16 32 33 20 53 49 49 46 38 19 47 40 46 40 44 30 51 44 24 25 37 26 51 25 22 28 32 25 49 25 30 32 29 30 40 31 17 34 21 45 40 41 14 54 37 41 52 47 29 30 38 33 17 7 49 42 38 20 53 30 32 41 45 32 18 28 29 40 29 33 34 32 21 28 21 28 52 38 20 13 32 41 29 31 37 30 14 19 32 30 31 32 13 45 23 22 26 45 32 51 33 31 31 32 18 42 33 38 21 31 31 51 45 51 31 19 7 11 46 16 40 7 41 41 21 21 31 31 31 32 40 46 31 25 18 46 46 42 46 30 42 28 19 26 15 27 23 46 43 31 39 12 31 36 16 31 27 14 7 31 25 23 22 10 14 8 8 29 8 9 5 9 30 7 31 13 23 32 8 5 10 20 20 27 9 7 21 16 7 32 26 29 31 17 31 21 27 9 14 5 5 9 38 6 26 12 36 14 32 24 30 23 37 18 15 32 18 26 27 21 27 11 8 23 11 29 15 16 22 7 16 17 16 7 8 9 13 26 36 13 23 21 10 12 32 12 5 5 15 12 10 21 21 15 13 5 11 23 11 21 7 11 7 14 25 32 33 27 12 19 32 22	Open. Hide. 62 47 51 47 62 44 44 62 62 62 59 59 59 59 38 32 56 56 38 46 59 62 62 47 59 62 59 62 62 62 62 62 59 59 62 62 62 59 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 54 49 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 54 54 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 37 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 54 58 58 54 58 58 58 58 58 49 54 54 54 58 51 58 58 58 58 58 58 43 58 54 41 58 58 54 54 58 54 54 54 58 54 54 46 54 58 58 58 58 54 53 58 53 58 49 47 28 47 58 58 58 58 35 58 49 49 51 53 51 51 58 49 58 58 58 51 54 52 51 58 58 58 58 50 58 53 52 51 52 58 48 49 51 40 41 58 51 52 51 48 49 49 58 50 48 41 39 50 58 50 58 44 45 53 40 49 50 48 48 50 40 49 51 50 50 51 41 47 51 54 51 58 49 58 48 46 48 51 58 58 58 50 50 58 43 31 44 58 58 51 49 54 49 32 39 58 58 49 58 58 58 33 34 39 47 58 58 58 50 50 43 49 51 49 50 47 50 50 54 38 51 49 51 24 53 54 53 37 53 54 53 51 38 39 39 50 35 23 49 51 38 21 54 50 54 32 32 49 39 36 35 37 38 53 54 54 49 22 13 46 30 40 33 32 12 49 33 37 29 54 52 52 51 45 54 53 54 52 54 47 37 53 32 46 54 49 32 41 11 32 23 52 42 32 40 46 34 35 34 32 52 35 40 31 26 42 26 52 42 35 32 47 23 31 31 32 32 28 32 34 20 18 34 12 32 34 32 47 49 30 42 31 31 33 32 30 25 31 32 30 31 31 42 28 46 51 31 24 40 27 31 31 32 29 45 31 31 23 47 28 45 33 51 24 38 46 32 46 46 46 47 25 27 24 31 47 47 47 31 28 46 31 26 47 48 46 46 30 23 31 42 31 27 28 31 31 31 48 44 31 33 31 46 46 31 27 35 32 27 35 32 30 25 31 23 37 35 38 31 30 27 25 30 36 22 21 31 35 30 33 12 31 37 22 32 31 25 25 28 24 28 28 15 15 18 44 14 10 11 5 14 27 10 19 5 16 11 44 27 9 12 10 20 34 27 31 32 34 23 27 21 21 26 25 18 18 34 14 31 18 21 43 14 17 15 18 13 18 24 17 11 19 16 32 17 12 30 32 16 24 15 16 22 21 18 34 19 16 28 27 27 27 20 8 29 13 22 27 13 25 6 28 14 19 28 14 11 27 15 7 4 5 5 9 28 6 22 8 4 9 6 7 6 5 21 20 19 5 4 5 8 3 8 10 20 20 18 6 17 7 8 18 7 23 13 9 4 6 12 9 5 22 14 14 17 10 8 11 12 6 4 10 19 28 14 17 13 6 7 4 17 16 29 25 19 5 7 12 28 23 10 7 7 16 16 7 7 14 17 5 7 13 13 6 4 3 13 11 10 6 5 16 6 2 3 2 11 6 6 5 6 10 13 8 4 3 4 6 4 9 16 12 10 6 4 8 4 7 5 6 2 2 3 4 7 5 18 12 4 9 3 5 5 4 16 5 6 4 6 7 6 6 5 16 3 2

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_41626509_41627518
seq2: B6Ng01-268A18.b_42_1063 (reverse)

seq1  CGGAGGGGGCTGGTGC-AGAGGCCTG-AATGG-TTCAC-AGGCTGGATTG  46
      ||||||||||  |||| ||||||||| ||||| ||||| |||||||||||
seq2  CGGAGGGGGCCTGTGCAAGAGGCCTGAAATGGTTTCACTAGGCTGGATTG  50

seq1  GAGGAGGA-CCAGG-CCAAGGAGGGAGGCCTGGCTCCTGGC-AGTTGG--  91
      |||||||| ||||| ||| |||||||||||||||||||||| ||||||  
seq2  GAGGAGGACCCAGGCCCACGGAGGGAGGCCTGGCTCCTGGCAAGTTGGGC  100

seq1  CCAGC-AGGTCCCCTCA-CCCGGGGGGGGGGGGGGGGAAGGGGAGAGAAA  139
      | ||| ||||||||||| ||||||||||||||||||||||||||||||||
seq2  CAAGCAAGGTCCCCTCACCCCGGGGGGGGGGGGGGGGAAGGGGAGAGAAA  150

seq1  GGAAG-AGGGGGCACAGGTCAGGGCCACTCCTGGGCTATAGGCTCCCACT  188
       |||| ||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGAAGGGGGCACAGGTCAGGGCCACTCCTGGGCTATAGGCTCCCACT  200

seq1  TAATAGTTGCATGCCTCCCTCCTGTCTTTCTGACTCTCTTGTCTCTGGTT  238
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATAGTTGCATGCCTCCCTCCTGTCTTTCTGACTCTCTTGTCTCTGGTT  250

seq1  CTATCCCTTTCCCTCCTTTGAATCTAGCCCTCCTCTTCCTCTCACCTCTT  288
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATCCCTTTCCCTCCTTTGAATCTAGCCCTCCTCTTCCTCTCACCTCTT  300

seq1  GGTGCCACCAAGCGACATAGGACCCAGAAGCTGTGACTGAGGTTGGGATT  338
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGCCACCAAGCGACATAGGACCCAGAAGCTGTGACTGAGGTTGGGATT  350

seq1  CAAGCCTTCTTCTCCTTCTGGGCTGCTACAGTCCCTCCCACGGCAAGCCT  388
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGCCTTCTTCTCCTTCTGGGCTGCTACAGTCCCTCCCACGGCAAGCCT  400

seq1  GAGTGCCCAGGGGAAAGGACCCCACACCAGTATGTGTGCCCCCTCCTGCT  438
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGCCCAGGGGAAAGGACCCCACACCAGTATGTGTGCCCCCTCCTGCT  450

seq1  TAGAAGGGGTAGGATACGGCTGAGCACCAGTGGGAGGGAGGGCAAGACAG  488
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAAGGGGTAGGATACGGCTGAGCACCAGTGGGAGGGAGGGCAAGACAG  500

seq1  AGGCAGCAATAGCAATTTCCCAGCTCCAGCCTCTGGCTGAGGTTGTGGAA  538
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAGCAATAGCAATTTCCCAGCTCCAGCCTCTGGCTGAGGTTGTGGAA  550

seq1  AAGGAGGCCGCCCCGATGTGAGTGAGTTGGGGGGGTGGGTATCCGCACCT  588
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAGGCCGCCCCGATGTGAGTGAGTTGGGGGGGTGGGTATCCGCACCT  600

seq1  GCTGTTGTGACCTCCAGAGCCGGAGATGGGGGCCCGTGGGGGGGGGGACA  638
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGTTGTGACCTCCAGAGCCGGAGATGGGGGCCCGTGGGGGGGGGGACA  650

seq1  CAGAGATTCCGATGGATTTTGGCAGCAGCCTGGACTCTAAGTGCTCACAC  688
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGATTCCGATGGATTTTGGCAGCAGCCTGGACTCTAAGTGCTCACAC  700

seq1  ACCCCCACCCCCAGCCTCTTGTACCGTGGGGACCCTGAGTTCAGCATGTG  738
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCCCACCCCCAGCCTCTTGTACCGTGGGGACCCTGAGTTCAGCATGTG  750

seq1  CGTGCCCTGCTTGTTGCACGTGTGTACAGGCGTGTTAGAAGAGCCTGGGG  788
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTGCCCTGCTTGTTGCACGTGTGTACAGGCGTGTTAGAAGAGCCTGGGG  800

seq1  CCCTCCTACGATGGGTCTGACTGAGCAGCTGGGGACATGTCCTGGGAAGA  838
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCCTACGATGGGTCTGACTGAGCAGCTGGGGACATGTCCTGGGAAGA  850

seq1  TGAGAATCCATCCCGCCAGCCTGAGCCCACATGGAGAGGTCCACTCAGAG  888
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGAATCCATCCCGCCAGCCTGAGCCCACATGGAGAGGTCCACTCAGAG  900

seq1  CCCTGGAACTGTACTCGGAGCAGACCTCTAGATGCAGGAGGTCTGGGCTT  938
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGGAACTGTACTCGGAGCAGACCTCTAGATGCAGGAGGTCTGGGCTT  950

seq1  GTCTCTTCAGAAGGCATTTGCTCCAGCAGCCCCTGCCTCTTGCACGGGGA  988
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTCTTCAGAAGGCATTTGCTCCAGCAGCCCCTGCCTCTTGCACGGGGA  1000

seq1  GCAGGAAAGAGCAGAGGAATTC  1010
      ||||||||||||||||||||||
seq2  GCAGGAAAGAGCAGAGGAATTC  1022

seq1: chr4_41483695_41484865
seq2: B6Ng01-268A18.g_66_1220

seq1  GAATTCAGGCCATCAAACCCGTCCATCATCTTCAGAGACAGCTCCAGCCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGGCCATCAAACCCGTCCATCATCTTCAGAGACAGCTCCAGCCC  50

seq1  TCATTTTCTGCTTCCCTCTGGGGAATCTTCTCTAAAGAATAGAATTTCCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTTTCTGCTTCCCTCTGGGGAATCTTCTCTAAAGAATAGAATTTCCC  100

seq1  CTGGGGAATCACCCGCTAGACAAAATATTCCTGACTTGAGGTTATCAATG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGGAATCACCCGCTAGACAAAATATTCCTGACTTGAGGTTATCAATG  150

seq1  AGGAACAAAAGGAAGGACAGGTTTGCCACAGTGAGGTTTGGGGAGGCTCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAACAAAAGGAAGGACAGGTTTGCCACAGTGAGGTTTGGGGAGGCTCT  200

seq1  AGTGATCACCAGTACTGCCTGGTAGCTGGCTATACATTTGGCATGCTCAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGATCACCAGTACTGCCTGGTAGCTGGCTATACATTTGGCATGCTCAT  250

seq1  TAGGTCCTTGCTCCTGCCAGCACACCAGCTGTGGTCCTTGCTCCTACCAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGTCCTTGCTCCTGCCAGCACACCAGCTGTGGTCCTTGCTCCTACCAG  300

seq1  CACACCATTGGTAGTAACCATGACTTGGTAGAGCCAGGAGGCAAACCTCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACCATTGGTAGTAACCATGACTTGGTAGAGCCAGGAGGCAAACCTCA  350

seq1  ACAAAGCAACTCCTTTGCTTTCGGACTTGGGCCAGGAGAACCAAGCAAAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAGCAACTCCTTTGCTTTCGGACTTGGGCCAGGAGAACCAAGCAAAA  400

seq1  TGTCCTGGAAGTTACTGAAGCTTGTATGGCAGTTTTTATGCTAAGATTTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCTGGAAGTTACTGAAGCTTGTATGGCAGTTTTTATGCTAAGATTTT  450

seq1  AAAAATGTGTGTGTGTGTGTGTGTGTGCATGTGTGTGTGCTGCATGTGTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAATGTGTGTGTGTGTGTGTGTGTGCATGTGTGTGTGCTGCATGTGTA  500

seq1  TATGGTGTGTGAGTGCACACATGTGGAGGTCAGCAGACGACTCTGTGGAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGGTGTGTGAGTGCACACATGTGGAGGTCAGCAGACGACTCTGTGGAA  550

seq1  CTGGTTCTCTTCACCTTTCTGTGGATTCTGAGGATCACACTGGGTCACGG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTTCTCTTCACCTTTCTGTGGATTCTGAGGATCACACTGGGTCACGG  600

seq1  GGCTCATCCCACAAGCACCTTTACCCACTGAGCAATCCTACCTACCACAC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTCATCCCACAAGCACCTTTACCCACTGAGCAATCCTACCTACCACAC  650

seq1  TCTTCCTTTTCTTTCCTTTCTTTAAAAAAAATATTTTTATGTGTAGCTCG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCCTTTTCTTTCCTTTCTTTAAAAAAAATATTTTTATGTGTAGCTCG  700

seq1  GAGTGGTGGTGCATGACTTTAATCCTAGCACTGGGGAGGCAGAGGTAGGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGGTGGTGCATGACTTTAATCCTAGCACTGGGGAGGCAGAGGTAGGT  750

seq1  GATCTCTGTGAGTTTGAGGCTAGCCTGGTCTACATAAATGAGTCTAGGAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTCTGTGAGTTTGAGGCTAGCCTGGTCTACATAAATGAGTCTAGGAC  800

seq1  GACCAGGGCTCTGTTATACAGAGAAACCCTGACTTAGGGAGAGAAGAAAA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCAGGGCTCTGTTATACAGAGAAACCCTGACTTAGGGAGAGAAGAAAA  850

seq1  AGGAAAAAGAATTTTTTATGTGTATGGGTATTTTGCCTGCGTGTGTCTGC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAAAAGAATTTTTTATGTGTATGGGTATTTTGCCTGCGTGTGTCTGC  900

seq1  ACTCCATGAGTGTCTGGAGCCAAGGGAGGCCAGAAGAGGGCAACATATCT  950
      ||||||||||||||||||||||||||| ||||| ||||||| ||||||||
seq2  ACTCCATGAGTGTCTGGAGCCAAGGGA-GCCAG-AGAGGGC-ACATATCT  947

seq1  CCTGGAACAAGAGTAACAGATGGTTGTGAGCCATCATATGGGTGCTGGGA  1000
      |||||||| ||||| |||||||| |||||||||||||||||||||||| |
seq2  CCTGGAAC-AGAGT-ACAGATGG-TGTGAGCCATCATATGGGTGCTGGAA  994

seq1  ATCAAACCCTGAACCTCCGGAGGAGCAGCCAGTGCTCTTACCTACCGAGC  1050
      ||| ||||||||| |||  |||||||||||||||||||   |||||||||
seq2  ATC-AACCCTGAA-CTC--GAGGAGCAGCCAGTGCTCT--ACTACCGAGC  1038

seq1  CACCTCTCTAGTCCCGTTCTTCTTTTCTTCCTTTTTTTGAAACAGGGTCC  1100
      |||||||||||  |||||||||||||||| | ||||| |||||| ||| |
seq2  CACCTCTCTAGGTCCGTTCTTCTTTTCTT-CGTTTTTGGAAACAAGGTTC  1087

seq1  CATGTAGCCCATGATGGCCTCACACTCACTGCACAGCTAAGAACGGCCTT  1150
      ||||||| |||||||| |  ||||||| ||||| |||| || |||| |||
seq2  CATGTAGTCCATGATGCCTCCACACTC-CTGCA-AGCTTAG-ACGGTCTT  1134

seq1  AACTTTTGATGCTCTTGCCGT  1171
      ||  ||  |  ||||||||||
seq2  AAACTTGAAGTCTCTTGCCGT  1155

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information