MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-271E16
Chromosome	4 (Build37)
Map Location	131,006,252 - 131,146,901
singlet/doublet	doublet
Overlap gene	Gm831, EG664832
Upstream gene	Zcchc17, Wdr57, 2610200G18Rik, Pum1, LOC622577, Sdc3, Laptm5, Matn1, LOC622681, LOC100041575
Downstream gene	LOC100039799, Ptpru, Mecr, Sfrs4, EG664865, EG623230, Epb4.1, LOC666480, LOC100039835, Oprd1, LOC664894, Ythdf2, LOC664903, Gmeb1, Rnu11, Taf12, 9530096D07Rik, LOC100039864, Trspap1, Rcc1, Snhg3, Phactr4, Med18, Sesn2, Atpif1, Dnajc8, Ptafr
Link	Open Mouse BAC browser

Click to get alignment info.

name	Zcchc17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619605 MGI:1919955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr57 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66585 MGI:1913835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610200G18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67149 MGI:1914399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pum1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80912 MGI:1931749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622577 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Sdc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20970 MGI:1349163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Laptm5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16792 MGI:108046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Matn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17180 MGI:106591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622681 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100041575 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Gm831 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329950 MGI:2685677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG664832 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664832 MGI:3643258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100039799 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ptpru (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19273 MGI:1321151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mecr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26922 MGI:1349441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfrs4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57317 MGI:1890577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG664865 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664865 MGI:3646623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG623230 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623230 MGI:3646343
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 216 ESTs, 1 Protein

name	Epb4.1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269587 MGI:95401
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666480 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100039835 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039835
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Oprd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18386 MGI:97438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 626 ESTs, 6 Proteins

name	Ythdf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213541 MGI:2444233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664903 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 804 ESTs, 1 Protein

name	Gmeb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56809 MGI:2135604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353373 MGI:2148804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66464 MGI:1913714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9530096D07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242681 MGI:2441753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039864 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039864
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs

name	Trspap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71787 MGI:1919037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rcc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100088 MGI:1913989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snhg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399101 MGI:2684817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phactr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100169 MGI:2140327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Med18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67219 MGI:1914469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sesn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230784 MGI:2651874
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atpif1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11983 MGI:1196457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68598 MGI:1915848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptafr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19204 MGI:106066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zcchc17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981968 GeneID:619605 MGI:1919955
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCHC domain containing 17 transcript_id : NM_153160.2

name	Wdr57 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115298669 GeneID:66585 MGI:1913835
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 57 (U5 snRNP specific) transcript_id : NM_025645.2

name	2610200G18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367659 GeneID:67149 MGI:1914399
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610200G18 gene transcript_id : NM_025998.2

name	Pum1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507675 GeneID:80912 MGI:1931749
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pumilio 1 (Drosophila) transcript_id : NM_030722.1

name	LOC622577 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372540 GeneID:622577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical LOC622577 transcript_id : XM_897188.2

name	Sdc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110349994 GeneID:20970 MGI:1349163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syndecan 3 transcript_id : NM_011520.3

name	Laptm5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543110 GeneID:16792 MGI:108046
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysosomal-associated protein transmembrane 5 transcript_id : NM_010686.2

name	Matn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6857809 GeneID:17180 MGI:106591
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrilin 1, cartilage matrix protein 1 transcript_id : NM_010769.1

name	LOC622681 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372541 GeneID:622681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC622681 transcript_id : XM_897250.2

name	LOC100041575 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253156 GeneID:100041575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041575 transcript_id : XM_001477132.1

name	Gm831 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253158 GeneID:329950 MGI:2685677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : gene model 831, (NCBI) transcript_id : XM_001477145.1

name	LOC100039799 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253139 GeneID:100039799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039799 transcript_id : XM_001473535.1

name	Ptpru (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031954 GeneID:19273 MGI:1321151
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, U transcript_id : NM_011214.2

name	Ptpru (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031996 GeneID:19273 MGI:1321151
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, U transcript_id : NM_001083119.2

name	Mecr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13384651 GeneID:26922 MGI:1349441
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial trans-2-enoyl-CoA reductase transcript_id : NM_025297.1

name	Sfrs4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10181125 GeneID:57317 MGI:1890577
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine-rich 4 (SRp75) transcript_id : NM_020587.1

name	EG664865 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372548 GeneID:664865 MGI:3646623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG664865 transcript_id : XM_973121.1

name	EG623230 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253160 GeneID:623230 MGI:3646343
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 216 ESTs, 1 Protein product : predicted gene, EG623230 transcript_id : XM_887671.3

name	Epb4.1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38570128 GeneID:269587 MGI:95401
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : erythrocyte protein band 4.1 transcript_id : NM_183428.2

name	LOC666480 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372617 GeneID:666480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC666480 transcript_id : XM_990133.1

name	Oprd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244063 GeneID:18386 MGI:97438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : opioid receptor, delta 1 transcript_id : NM_013622.3

name	LOC664894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253161 GeneID:664894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 626 ESTs, 6 Proteins product : similar to fusion protein: ubiquitin (bases 43_513); ribosomal protein S27a (bases 217_532) transcript_id : XM_973311.2

name	Ythdf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353711 GeneID:213541 MGI:2444233
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : YTH domain family 2 transcript_id : NM_145393.3

name	LOC664903 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253141 GeneID:664903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 804 ESTs, 1 Protein product : similar to hCG1994130 transcript_id : XM_973351.2

name	Gmeb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9937989 GeneID:56809 MGI:2135604
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucocorticoid modulatory element binding protein 1 transcript_id : NM_020273.1

name	Taf12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364052 GeneID:66464 MGI:1913714
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_025579.2

name	9530096D07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126116578 GeneID:242681 MGI:2441753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9530096D07 gene transcript_id : NM_001081651.1

name	LOC100039864 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253142 GeneID:100039864
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs product : hypothetical protein LOC100039864 transcript_id : XM_001473681.1

name	Trspap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110835713 GeneID:71787 MGI:1919037
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tRNA selenocysteine associated protein 1 transcript_id : NM_027925.3

name	Rcc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129804 GeneID:100088 MGI:1913989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of chromosome condensation 1 transcript_id : NM_133878.2

name	Phactr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387565 GeneID:100169 MGI:2140327
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatase and actin regulator 4 transcript_id : NM_175306.3

name	Med18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46358371 GeneID:67219 MGI:1914469
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 18 homolog (yeast) transcript_id : NM_026039.2

name	Sesn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450288 GeneID:230784 MGI:2651874
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sestrin 2 transcript_id : NM_144907.1

name	Atpif1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982863 GeneID:11983 MGI:1196457
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase inhibitory factor 1 transcript_id : NM_007512.2

name	Dnajc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349981 GeneID:68598 MGI:1915848
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 8 transcript_id : NM_172400.2

name	Ptafr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487078 GeneID:19204 MGI:106066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : platelet-activating factor receptor transcript_id : NM_001081211.1

name	Zcchc17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346607 GeneID:619605 MGI:1919955
definition	GO_component : GO:0005842 - cytosolic large ribosomal subunit (sensu Eukaryota) [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : putative S1 RNA binding domain protein protein_id : NP_694800.1

name	Wdr57 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115298670 GeneID:66585 MGI:1913835
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : U5 snRNP-specific protein (Prp8-binding) protein_id : NP_079921.2

name	2610200G18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385502 GeneID:67149 MGI:1914399
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67149 protein_id : NP_080274.1

name	LOC622577 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895205 GeneID:622577
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902281.1

name	Pum1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507676 CCDS:CCDS18710.1 GeneID:80912 MGI:1931749
definition	GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : pumilio 1 protein_id : NP_109647.1

name	Sdc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42476310 GeneID:20970 MGI:1349163
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008092 - cytoskeletal protein binding [Evidence IEA] codon_start : 1 product : syndecan 3 protein_id : NP_035650.2

name	Laptm5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754504 CCDS:CCDS18712.1 GeneID:16792 MGI:108046
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005764 - lysosome [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : lysosomal-associated protein transmembrane 5 protein_id : NP_034816.1

name	Matn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857810 CCDS:CCDS18713.1 GeneID:17180 MGI:106591
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA] GO_function : GO:0005518 - collagen binding [Evidence IEA]; GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030198 - extracellular matrix organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : matrilin 1, cartilage matrix protein 1 protein_id : NP_034899.1

name	LOC622681 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895207 GeneID:622681
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902343.1

name	LOC100041575 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253157 GeneID:100041575
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477182.1

name	Gm831 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253159 GeneID:329950 MGI:2685677
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477195.1

name	LOC100039799 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253140 GeneID:100039799
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473585.1

name	Ptpru (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134031955 CCDS:CCDS18714.1 GeneID:19273 MGI:1321151
definition	GO_component : GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0007185 - transmembrane receptor protein tyrosine phosphatase signaling pathway [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; protein tyrosine phosphatase, receptor type, L product : protein tyrosine phosphatase, receptor type, U isoform 1 protein_id : NP_035344.2

name	Ptpru (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778922 GeneID:19273 MGI:1321151
definition	GO_component : GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0007185 - transmembrane receptor protein tyrosine phosphatase signaling pathway [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; protein tyrosine phosphatase, receptor type, L product : protein tyrosine phosphatase, receptor type, U isoform 2 protein_id : NP_001076588.1

name	Mecr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384652 CCDS:CCDS18715.1 GeneID:26922 MGI:1349441
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0016922 - ligand-dependent nuclear receptor binding [Evidence ISS]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0019166 - trans-2-enoyl-CoA reductase (NADPH) activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : nuclear receptor binding factor 1 product : trans-2-enoyl-CoA reductase, mitochondrial precursor protein_id : NP_079573.1

name	Sfrs4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181126 GeneID:57317 MGI:1890577
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : splicing factor, arginine/serine-rich 4 (SRp75) protein_id : NP_065612.1

name	EG664865 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94372549 GeneID:664865 MGI:3646623
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978215.1

name	EG623230 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94372551 GeneID:623230 MGI:3646343
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892764.2

name	Epb4.1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38570129 CCDS:CCDS18717.1 GeneID:269587 MGI:95401
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence ISS] [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0008092 - cytoskeletal protein binding [Evidence IEA]; GO:0030507 - spectrin binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS]; GO:0030866 - cortical actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence ISS] codon_start : 1 exception : mismatches in translation product : erythrocyte protein band 4.1 protein_id : NP_906273.2

name	LOC666480 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94372618 GeneID:666480
definition	codon_start : 1 product : hypothetical protein protein_id : XP_995227.1

name	Oprd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244064 CCDS:CCDS18718.1 GeneID:18386 MGI:97438
definition	GO_component : GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0004986 - delta-opioid receptor activity [Evidence IDA] [Evidence IMP]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0008344 - adult locomotory behavior [Evidence IMP]; GO:0007191 - dopamine receptor, adenylate cyclase activating pathway [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007193 - G-protein signaling, adenylate cyclase inhibiting pathway [Evidence IDA]; GO:0007218 - neuropeptide signaling pathway [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : opioid receptor delta 1 product : opioid receptor, delta 1 protein_id : NP_038650.3

name	LOC664894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94372553 GeneID:664894
definition	codon_start : 1 product : similar to fusion protein: ubiquitin (bases 43_513); ribosomal protein S27a (bases 217_532) protein_id : XP_978405.1

name	Ythdf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30841028 CCDS:CCDS18719.1 GeneID:213541 MGI:2444233
definition	codon_start : 1 exception : mismatches in translation product : high glucose-regulated protein 8 protein_id : NP_663368.2

name	LOC664903 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94372555 GeneID:664903
definition	codon_start : 1 product : similar to hCG1994130 protein_id : XP_978445.1

name	Gmeb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9937990 CCDS:CCDS18720.1 GeneID:56809 MGI:2135604
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glucocorticoid modulatory element binding protein 1 protein_id : NP_064669.1

name	Taf12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385026 CCDS:CCDS18721.1 GeneID:66464 MGI:1913714
definition	GO_component : GO:0005669 - transcription factor TFIID complex [Evidence ISS] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20 kDa product : TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_079855.1

name	9530096D07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126116579 GeneID:242681 MGI:2441753
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : RAB42, member RAS oncogene family product : RIKEN cDNA 9530096D07 protein_id : NP_001075120.1

name	LOC100039864 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253143 GeneID:100039864
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473731.1

name	Trspap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62821783 CCDS:CCDS18722.1 GeneID:71787 MGI:1919037
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0001514 - selenocysteine incorporation [Evidence IDA] codon_start : 1 product : tRNA selenocysteine associated protein 1 protein_id : NP_082201.2

name	Rcc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527092 CCDS:CCDS18723.1 GeneID:100088 MGI:1913989
definition	GO_process : GO:0051301 - cell division [Evidence IEA] codon_start : 1 product : chromosome condensation 1 protein_id : NP_598639.1

name	Phactr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424978 CCDS:CCDS18724.1 GeneID:100169 MGI:2140327
definition	codon_start : 1 exception : mismatches in translation product : phosphatase and actin regulator 4 protein_id : NP_780515.1

name	Med18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313064 CCDS:CCDS18725.1 GeneID:67219 MGI:1914469
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] codon_start : 1 product : mediator of RNA polymerase II transcription, subunit 18 homolog protein_id : NP_080315.1

name	Sesn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450289 CCDS:CCDS18726.1 GeneID:230784 MGI:2651874
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007050 - cell cycle arrest [Evidence IEA] codon_start : 1 product : sestrin 2 protein_id : NP_659156.1

name	Atpif1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982864 CCDS:CCDS18727.1 GeneID:11983 MGI:1196457
definition	GO_component : GO:0009986 - cell surface [Evidence ISS]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IDA] GO_function : GO:0043532 - angiostatin binding [Evidence ISS]; GO:0051117 - ATPase binding [Evidence ISS]; GO:0042030 - ATPase inhibitor activity [Evidence ISS]; GO:0005516 - calmodulin binding [Evidence ISS]; GO:0004857 - enzyme inhibitor activity [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence ISS] GO_process : GO:0001937 - negative regulation of endothelial cell proliferation [Evidence ISS]; GO:0051346 - negative regulation of hydrolase activity [Evidence ISS]; GO:0045980 - negative regulation of nucleotide metabolism [Evidence IEA]; GO:0051289 - protein homotetramerization [Evidence ISS]; GO:0009268 - response to pH [Evidence ISS] codon_start : 1 product : ATPase inhibitory factor 1 protein_id : NP_031538.2

name	Dnajc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369493 GeneID:68598 MGI:1915848
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : DnaJ (Hsp40) homolog, subfamily C, member 8 protein_id : NP_765988.1

name	Ptafr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487079 GeneID:19204 MGI:106066
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004992 - platelet activating factor receptor activity [Evidence ISS] [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019735 - antimicrobial humoral response (sensu Vertebrata) [Evidence ISS]; GO:0006935 - chemotaxis [Evidence IEA] [Evidence ISS]; GO:0001816 - cytokine production [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] [Evidence ISS]; GO:0006954 - inflammatory response [Evidence ISS] [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : PAF receptor product : platelet-activating factor receptor protein_id : NP_001074680.1

name	EG664832 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664832
definition	number : 6 pseudo : _no_value

name	EG664832 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664832
definition	number : 5 pseudo : _no_value

name	EG664832 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664832
definition	number : 4 pseudo : _no_value

name	EG664832 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664832
definition	number : 3 pseudo : _no_value

name	EG664832 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664832
definition	number : 2 pseudo : _no_value

name	EG664832 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664832
definition	number : 1 pseudo : _no_value

name	LOC100039835 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039835
definition	number : 1 pseudo : _no_value

name	Rnu11 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872156 GeneID:353373 MGI:2148804
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : U11 small nuclear RNA transcript_id : NR_002865.1

name	Snhg3 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:118442851 GeneID:399101 MGI:2684817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA host gene (non-protein coding) 3 transcript_id : NR_003270.1

clone name	MSMg01-492O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528B01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325H09
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-271E16.b	B6Ng01-271E16.g
ACC	GA073417	GA073418
length	287	1,110
definition	B6Ng01-271E16.b	B6Ng01-271E16.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(131,006,252 - 131,006,539)	(131,145,787 - 131,146,901)
sequence	agatttatggggtgtggtgtgaataagccctggcctgggggttgcactat taggagatgtggccttgttggaatgggtgtggccttgctggagtgggtgt gaccttgctggagtgggtatggccttgctagagtgggtatggccttgctg gagtgggtgtggccttgctggagtgggtgtggccttgttaaagtgagttt ggccttgttggggtaggtgtggtcttgttggagtgggtgtggccttgttg gagtggatgtggccttgttgcactcgtgtggccttgt	gaattctgctctcaagtcagggcagtaatcagcttcctggcttttagcac tgtgtgatagatgagtgtcatacaaacacactggcttgggttcccatttc ctgtggctccagcattacacctggcaatgtgcataggcagccatgcagaa cacgactttgtttattcctgtccctgtggttcctgtgtattagacaaata ccaaatcatttgccatcctgtgcattgcagtgctgggccggtgtaagcac tggcatgggcattgatgtggaatcactacattgtatccctgtcatataca agatcatccacctgtagaatcgctagagtgtatccaggacacatacagga tcaccagcagatgctgccaaatggtctgtagagttgcctttgcggtttat attcccaccagcagtgtccagagccacattttgtccccagattgcctact ccacatcctcgtctgcctgtatcagctccttttggtccagatgtttagct ctatgagtcttcacccctggaacattgatgtaggagggtaccttgctccc atgtgctgactttggctcctttcaggtcgtggcctcagagatgcacactc aagctgccctgtgatgtcatcagggcctagcatcaaattgttgcccacat ggggccttccttgccagaagagtcgctcatgcatgtgacctacttactgt ggaccttgtcccccgtcaggcattctgcagagagctgcagtctttgatga atcagggtactaaccttgtggggttcacagactaatgttggagacagagt gtggggctttttatttgaggtatgaaataagggtagttggacttgggagg aaagatgggatggaggacatgcagaggagaaaacaggagatgaacattta gggggtgatgcggcagcagacattttgagctcgaaccccaaccttagtgt ctggaagatactagccccatctccacgataggacacatcaggacactgac atgtatatccacatgtctggcaaaccaggtcactgggaagacctgaaggt agatggaactcttgggagaggcctcaggctctatgtccttttgtggttgc actccagagt
quality values	Open. Hide. 20 37 47 44 62 62 56 41 62 62 62 59 59 59 59 62 59 59 59 59 62 62 62 62 59 59 49 62 62 62 62 62 54 54 62 62 62 62 54 49 54 62 54 62 62 62 59 59 62 62 59 59 59 62 62 62 59 49 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 49 42 42 49 56 38 43 42 28 34 34 28 33 31 28 27 26 24 10 24 24 18 19 10 12 13 7 24 10 8 10 11 10 10 8 8 8 13 18 11 10 13 12	Open. Hide. 62 47 40 33 62 62 62 54 62 62 62 62 47 24 43 56 62 54 47 62 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 59 54 59 59 62 59 62 62 62 59 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 56 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 52 58 58 58 58 58 54 58 58 58 54 52 58 58 58 45 54 58 52 58 54 58 58 45 58 58 54 52 47 58 58 54 58 58 58 54 58 54 40 54 58 58 58 58 58 58 58 52 58 58 58 58 49 53 58 51 58 58 58 58 53 53 42 58 50 58 54 50 58 41 43 58 58 51 38 32 58 34 42 41 51 50 46 51 52 51 58 49 39 52 52 58 58 58 51 58 58 49 58 51 58 29 32 58 50 46 37 54 50 46 39 58 54 51 58 50 53 32 51 50 52 53 51 49 48 50 54 54 41 58 41 39 58 40 40 52 50 51 50 58 58 50 51 51 50 50 40 43 43 43 40 44 40 37 43 58 52 39 58 26 52 42 52 46 51 50 39 52 52 52 38 51 58 52 51 38 31 54 39 42 45 54 44 28 37 49 51 38 38 29 47 28 52 52 40 40 34 50 49 49 50 44 32 40 37 35 24 54 29 32 50 49 40 52 52 37 33 26 54 22 41 26 52 52 42 38 31 31 33 43 40 54 53 31 34 32 34 52 35 37 25 9 10 36 24 37 34 28 40 34 31 22 45 51 31 39 29 35 49 51 42 31 37 31 40 37 40 35 42 31 31 31 42 40 51 29 25 25 32 47 21 31 16 27 31 35 19 26 42 39 42 51 51 46 30 38 51 51 51 48 30 36 51 44 26 45 24 36 28 31 35 34 46 51 30 31 31 9 10 32 22 32 42 28 32 31 31 26 32 17 33 32 31 46 28 22 19 31 31 46 37 30 33 18 16 46 13 31 24 31 41 31 23 41 31 18 17 29 34 36 20 11 17 9 30 39 13 31 41 48 28 30 15 10 5 36 7 9 16 27 30 28 20 13 37 37 21 7 6 31 48 48 33 14 21 26 18 34 23 21 23 17 19 18 33 20 15 36 13 15 8 43 48 30 16 31 27 34 32 22 16 29 18 14 30 30 17 17 15 4 15 10 14 32 13 22 21 10 23 22 32 30 33 19 14 30 18 11 23 32 34 15 17 34 31 7 25 15 21 31 25 9 19 19 11 30 43 13 7 11 33 11 7 4 10 28 20 30 7 10 27 8 6 9 19 11 21 3 8 21 21 22 13 20 18 27 14 5 3 6 12 27 13 16 20 13 13 18 14 11 29 16 13 13 20 14 18 27 11 9 26 27 28 47 7 20 8 7 16 8 31 3 4 8 12 8 9 6 12 8 22 23 7 7 2 3 3 3 6 16 15 9 25 15 3 3 7 4 6 24 5 13 8 16 9 6 10 6 6 10 6 8 21 22 19 14 7 19 21 10 10 7 11 7 5 4 4 5 3 4 3 2 5 4 5 19 5 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_131006252_131006539
seq2: B6Ng01-271E16.b_48_334

seq1  AGATTTATGGGGTGTGGTGTGAATAAGCCCTGGCCTGGGGGTTGCACTAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATTTATGGGGTGTGGTGTGAATAAGCCCTGGCCTGGGGGTTGCACTAT  50

seq1  TAGGAGATGTGGCCTTGTTGGAATGGGTGTGGCCTTGCTGGAGTGGGTGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGAGATGTGGCCTTGTTGGAATGGGTGTGGCCTTGCTGGAGTGGGTGT  100

seq1  GACCTTGCTGGAGTGGGTATGGCCTTGCTAGAGTGGGTATGGCCTTGCTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCTTGCTGGAGTGGGTATGGCCTTGCTAGAGTGGGTATGGCCTTGCTG  150

seq1  GAGTGGGTGTGGCCTTGCTGGAGTGGGTGTGGCCTTGTTAAAGTGAGTTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGGGTGTGGCCTTGCTGGAGTGGGTGTGGCCTTGTTAAAGTGAGTTT  200

seq1  GGCCTTGTTGGGGTAGGTGTGGTCTTGTTGGAGTGGGTGTGGCCTTGTTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCTTGTTGGGGTAGGTGTGGTCTTGTTGGAGTGGGTGTGGCCTTGTTG  250

seq1  GAGTGGATGTGGCCTTGTTGGAGTAGGTGTGGCCTTGT  288
      |||||||||||||||||||| | |  ||||||||||||
seq2  GAGTGGATGTGGCCTTGTTGCACT-CGTGTGGCCTTGT  287

seq1: chr4_131145787_131146901
seq2: B6Ng01-271E16.g_67_1176 (reverse)

seq1  ACTCTGGTAGCTGCACACCACAAAGGGACATAGAG-CTGAGGCTTCTCCC  49
      ||||||| || |||| |||||||| |||||||||| ||||||| ||||||
seq2  ACTCTGG-AG-TGCA-ACCACAAAAGGACATAGAGCCTGAGGCCTCTCCC  47

seq1  AAGTGTCCAATCTACCTCTGGGTCTTTCCCAGTGACCTTGGTTTGCCAGA  99
      ||| || | ||||||||   |||| |||||||||||| ||||||||||||
seq2  AAGAGTTCCATCTACCTTCAGGTC-TTCCCAGTGACC-TGGTTTGCCAGA  95

seq1  CATGTGGATATACATGTTCAGTGTCTTGATGTGTCCTAATCGTGGAGATT  149
      |||||||||||||||| |||||||| ||||||||||| ||||||||||| 
seq2  CATGTGGATATACATG-TCAGTGTCCTGATGTGTCCT-ATCGTGGAGATG  143

seq1  GGGCTAGTATCTTCCAGACACTAGGTTTGGGGTTCGAGCTCAAAATTGTC  199
      ||||||||||||||||||||||| | ||||||||||||||||||| ||||
seq2  GGGCTAGTATCTTCCAGACACTAAGGTTGGGGTTCGAGCTCAAAA-TGTC  192

seq1  TGCTGCCGCATCACCCCCTAAATGTTCATCT-CTGTTTTCTCCTCTGCAT  248
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  TGCTGCCGCATCACCCCCTAAATGTTCATCTCCTGTTTTCTCCTCTGCAT  242

seq1  GTCCTCCAT-CCATCTTTCCTCCCAAGTCCAACTACCCTTATTTCATACC  297
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  GTCCTCCATCCCATCTTTCCTCCCAAGTCCAACTACCCTTATTTCATACC  292

seq1  TCAAATAAAAAGCCCCACACTCTGTCTCCAACATTAGTCTGTGAACCCCA  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAATAAAAAGCCCCACACTCTGTCTCCAACATTAGTCTGTGAACCCCA  342

seq1  CAAGGTTAGTACCCTGATTCATCAAAGACTGCAGCTCTCTGCAGAATGCC  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGGTTAGTACCCTGATTCATCAAAGACTGCAGCTCTCTGCAGAATGCC  392

seq1  TGACGGGGGACAAGGTCCACAGTAAGTAGGTCACATGCATGAGCGACTCT  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACGGGGGACAAGGTCCACAGTAAGTAGGTCACATGCATGAGCGACTCT  442

seq1  TCTGGCAAGGAAGGCCCCATGTGGGCAACAATTTGATGCTAGGCCCTGAT  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGCAAGGAAGGCCCCATGTGGGCAACAATTTGATGCTAGGCCCTGAT  492

seq1  GACATCACAGGGCAGCTTGAGTGTGCATCTCTGAGGCCACGACCTGAAAG  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACATCACAGGGCAGCTTGAGTGTGCATCTCTGAGGCCACGACCTGAAAG  542

seq1  GAGCCAAAGTCAGCACATGGGAGCAAGGTACCCTCCTACATCAATGTTCC  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCAAAGTCAGCACATGGGAGCAAGGTACCCTCCTACATCAATGTTCC  592

seq1  AGGGGTGAAGACTCATAGAGCTAAACATCTGGACCAAAAGGAGCTGATAC  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGGTGAAGACTCATAGAGCTAAACATCTGGACCAAAAGGAGCTGATAC  642

seq1  AGGCAGACGAGGATGTGGAGTAGGCAATCTGGGGACAAAATGTGGCTCTG  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAGACGAGGATGTGGAGTAGGCAATCTGGGGACAAAATGTGGCTCTG  692

seq1  GACACTGCTGGTGGGAATATAAACCGCAAAGGCAACTCTACAGACCATTT  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACACTGCTGGTGGGAATATAAACCGCAAAGGCAACTCTACAGACCATTT  742

seq1  GGCAGCATCTGCTGGTGATCCTGTATGTGTCCTGGATACACTCTAGCGAT  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAGCATCTGCTGGTGATCCTGTATGTGTCCTGGATACACTCTAGCGAT  792

seq1  TCTACAGGTGGATGATCTTGTATATGACAGGGATACAATGTAGTGATTCC  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTACAGGTGGATGATCTTGTATATGACAGGGATACAATGTAGTGATTCC  842

seq1  ACATCAATGCCCATGCCAGTGCTTACACCGGCCCAGCACTGCAATGCACA  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCAATGCCCATGCCAGTGCTTACACCGGCCCAGCACTGCAATGCACA  892

seq1  GGATGGCAAATGATTTGGTATTTGTCTAATACACAGGAACCACAGGGACA  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATGGCAAATGATTTGGTATTTGTCTAATACACAGGAACCACAGGGACA  942

seq1  GGAATAAACAAAGTCGTGTTCTGCATGGCTGCCTATGCACATTGCCAGGT  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAATAAACAAAGTCGTGTTCTGCATGGCTGCCTATGCACATTGCCAGGT  992

seq1  GTAATGCTGGAGCCACAGGAAATGGGAACCCAAGCCAGTGTGTTTGTATG  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAATGCTGGAGCCACAGGAAATGGGAACCCAAGCCAGTGTGTTTGTATG  1042

seq1  ACACTCATCTATCACACAGTGCTAAAAGCCAGGAAGCTGATTACTGCCCT  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACTCATCTATCACACAGTGCTAAAAGCCAGGAAGCTGATTACTGCCCT  1092

seq1  GACTTGAGAGCAGAATTC  1115
      ||||||||||||||||||
seq2  GACTTGAGAGCAGAATTC  1110

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information