MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-276B03
Chromosome	4 (Build37)
Map Location	44,591,448 - 44,746,145
singlet/doublet	doublet
Overlap gene	Pax5, 5730488B01Rik
Upstream gene	1110029E03Rik, LOC100039672, LOC100040179, Npr2, Spag8, Hint2, Serf2-ps, 4930412F15Rik, Olfr70, Olfr71, LOC100039781, 5430416O09Rik, A630077J23Rik, GA_x5J8B7W5BNN-892919-892147, Olfr159, Olfr29-ps1, Olfr156, LOC100040268, Olfr155, Reck, Glipr2, Ccin, Clta, Gne, LOC100040313, OTTMUSG00000007209, Rnf38, Melk
Downstream gene	LOC545618, Zcchc7, D4Wsu132e, Grhpr, Zbtb5, 1700055D18Rik, Polr1e, Fbxo10, 1110019J04Rik, Frmpd1, Rg9mtd3, Exosc3, LOC666325, Wdr32, Mcart1, Shb, LOC100040140, LOC100040557, Gm829
Link	Open Mouse BAC browser

Click to get alignment info.

name	1110029E03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242406 MGI:1915956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039672 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039672
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040179 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Npr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230103 MGI:97372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spag8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433700 MGI:3056295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hint2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68917 MGI:1916167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serf2-ps (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:20366
definition	note : small EDRK-rich factor 2 pseudogene pseudo : _no_value

name	4930412F15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242408 MGI:2441678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr70 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56014 MGI:1860079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr71 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56015 MGI:1860080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039781 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs

name	5430416O09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71406 MGI:1918656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A630077J23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319973 MGI:2443089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	GA_x5J8B7W5BNN-892919-892147 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257810
definition	note : olfactory receptor GA_x5J8B7W5BNN-892919-892147 pseudo : _no_value

name	Olfr159 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29849 MGI:1352686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr29-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29848 MGI:1352685
definition	gene_synonym : MOR262-11; mOR37d; MTPCR52; Olfr158; Olfr29; Olfr37d note : olfactory receptor 29, pseudogene 1 pseudo : _no_value

name	Olfr156 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29846 MGI:1352683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040268 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040268
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2250 Proteins

name	Olfr155 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29845 MGI:1352681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Reck (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53614 MGI:1855698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glipr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384009 MGI:1917770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccin (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:442829 MGI:3045316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clta (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12757 MGI:894297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Gne (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50798 MGI:1354951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040313 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040313
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	OTTMUSG00000007209 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623796 MGI:3651567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 261 ESTs, 8 Proteins

name	Rnf38 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73469 MGI:1920719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Melk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17279 MGI:106924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pax5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18507 MGI:97489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730488B01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70602 MGI:1917852
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC545618 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 106 Proteins

name	Zcchc7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319885 MGI:2442912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D4Wsu132e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28027 MGI:107328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grhpr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76238 MGI:1923488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230119 MGI:1924601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700055D18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73405 MGI:1920655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs

name	Polr1e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64424 MGI:1929022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269529 MGI:2686937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 60 ESTs, 2 Proteins

name	1110019J04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68512 MGI:1915762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 178 ESTs

name	Frmpd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666060 MGI:2446274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rg9mtd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69934 MGI:1917184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Exosc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66362 MGI:1913612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666325 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Wdr32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242418 MGI:2140179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcart1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230125 MGI:2684984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230126 MGI:98294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 76 ESTs, 3 Proteins

name	LOC100040140 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 339 ESTs, 10 Proteins pseudo : _no_value

name	LOC100040557 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Gm829 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329839 MGI:2685675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110029E03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922687 GeneID:242406 MGI:1915956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110029E03 gene transcript_id : NM_172866.3

name	LOC100039672 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252339 GeneID:100039672
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100039672 transcript_id : XM_001473471.1

name	LOC100040179 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252366 GeneID:100040179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to HBxAg transactivated protein 2 transcript_id : XM_001474227.1

name	Npr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129825 GeneID:230103 MGI:97372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : natriuretic peptide receptor 2 transcript_id : NM_173788.3

name	Spag8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55925584 GeneID:433700 MGI:3056295
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm associated antigen 8 transcript_id : NM_001007463.1

name	Hint2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625718 GeneID:68917 MGI:1916167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histidine triad nucleotide binding protein 2 transcript_id : NM_026871.1

name	4930412F15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364998 GeneID:242408 MGI:2441678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930412F15 gene transcript_id : NM_175517.3

name	Olfr70 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11464982 GeneID:56014 MGI:1860079
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 70 transcript_id : NM_019485.1

name	Olfr71 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11464984 GeneID:56015 MGI:1860080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 71 transcript_id : NM_019486.1

name	LOC100039781 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252341 GeneID:100039781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs product : hypothetical protein LOC100039781 transcript_id : XM_001473603.1

name	5430416O09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383529 GeneID:71406 MGI:1918656
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5430416O09 gene transcript_id : NM_027789.3

name	A630077J23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371743 GeneID:319973 MGI:2443089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA A630077J23 gene transcript_id : XM_981990.1

name	Olfr159 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11464980 GeneID:29849 MGI:1352686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 159 transcript_id : NM_019476.1

name	Olfr156 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11276076 GeneID:29846 MGI:1352683
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 156 transcript_id : NM_019474.1

name	LOC100040268 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252368 GeneID:100040268
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2250 Proteins product : similar to olfactory receptor transcript_id : XM_001474382.1

name	Olfr155 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11276074 GeneID:29845 MGI:1352681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 155 transcript_id : NM_019473.1

name	Reck (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7710063 GeneID:53614 MGI:1855698
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reversion-inducing-cysteine-rich protein with kazal motifs transcript_id : NM_016678.1

name	Glipr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130367 GeneID:384009 MGI:1917770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GLI pathogenesis-related 2 transcript_id : NM_027450.3

name	Ccin (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803074 GeneID:442829 MGI:3045316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calicin transcript_id : NM_001002787.2

name	Clta (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122939193 GeneID:12757 MGI:894297
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : clathrin, light polypeptide (Lca) transcript_id : NM_001080385.1

name	Clta (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122939197 GeneID:12757 MGI:894297
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : clathrin, light polypeptide (Lca) transcript_id : NM_016760.2

name	Clta (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122939191 GeneID:12757 MGI:894297
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : clathrin, light polypeptide (Lca) transcript_id : NM_001080384.1

name	Clta (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122939195 GeneID:12757 MGI:894297
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : clathrin, light polypeptide (Lca) transcript_id : NM_001080386.1

name	Gne (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980684 GeneID:50798 MGI:1354951
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucosamine transcript_id : NM_015828.2

name	LOC100040313 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252372 GeneID:100040313
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040313 transcript_id : XM_001474487.1

name	OTTMUSG00000007209 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252345 GeneID:623796 MGI:3651567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 261 ESTs, 8 Proteins product : predicted gene, OTTMUSG00000007209 transcript_id : XM_888292.3

name	Rnf38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363897 GeneID:73469 MGI:1920719
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 38 transcript_id : NM_001038993.2

name	Rnf38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129864 GeneID:73469 MGI:1920719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 38 transcript_id : NM_175201.4

name	Melk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981625 GeneID:17279 MGI:106924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : maternal embryonic leucine zipper kinase transcript_id : NM_010790.2

name	Pax5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130642 GeneID:18507 MGI:97489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired box gene 5 transcript_id : NM_008782.2

name	5730488B01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252350 GeneID:70602 MGI:1917852
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 5730488B01 gene transcript_id : XM_001473976.1

name	LOC545618 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252374 GeneID:545618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 106 Proteins product : similar to aurora kinase C transcript_id : XM_620030.4

name	Zcchc7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84452165 GeneID:319885 MGI:2442912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCHC domain containing 7 transcript_id : NM_177027.3

name	D4Wsu132e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542480 GeneID:28027 MGI:107328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 4, Wayne State University 132, expressed transcript_id : NM_138590.2

name	Grhpr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:17933767 GeneID:76238 MGI:1923488
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glyoxylate reductase/hydroxypyruvate reductase transcript_id : NM_080289.1

name	Zbtb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328403 GeneID:230119 MGI:1924601
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 5 transcript_id : NM_173399.2

name	Polr1e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872197 GeneID:64424 MGI:1929022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) I polypeptide E transcript_id : NM_022811.2

name	Fbxo10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371757 GeneID:269529 MGI:2686937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 60 ESTs, 2 Proteins product : F-box protein 10 transcript_id : XM_194139.6

name	1110019J04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252363 GeneID:68512 MGI:1915762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 171 ESTs product : RIKEN cDNA 1110019J04 gene transcript_id : XM_001474120.1

name	1110019J04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371732 GeneID:68512 MGI:1915762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 63 ESTs product : RIKEN cDNA 1110019J04 gene, transcript variant 2 transcript_id : XM_898905.2

name	Frmpd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922644 GeneID:666060 MGI:2446274
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FERM and PDZ domain containing 1 transcript_id : NM_001081172.2

name	Rg9mtd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378992 GeneID:69934 MGI:1917184
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA (guanine-9-) methyltransferase domain containing 3 transcript_id : NM_027266.3

name	Exosc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385428 GeneID:66362 MGI:1913612
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exosome component 3 transcript_id : NM_025513.2

name	Wdr32 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815803 GeneID:242418 MGI:2140179
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 32 transcript_id : NM_153167.2

name	Mcart1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57977298 GeneID:230125 MGI:2684984
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial carrier triple repeat 1 transcript_id : NM_001009949.1

name	Shb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252376 GeneID:230126 MGI:98294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 76 ESTs, 3 Proteins product : src homology 2 domain-containing transforming protein B transcript_id : XM_001474892.1

name	LOC100040557 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252378 GeneID:100040557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100040557 transcript_id : XM_001474903.1

name	Gm829 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701910 GeneID:329839 MGI:2685675
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 829, (NCBI) transcript_id : NM_001033412.1

name	1110029E03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370314 GeneID:242406 MGI:1915956
definition	codon_start : 1 product : hypothetical protein LOC242406 protein_id : NP_766454.1

name	LOC100039672 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252340 GeneID:100039672
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473521.1

name	LOC100040179 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252367 GeneID:100040179
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474277.1

name	Npr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28916675 CCDS:CCDS18105.1 GeneID:230103 MGI:97372
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004383 - guanylate cyclase activity [Evidence IDA]; GO:0042802 - identical protein binding [Evidence IPI]; GO:0016829 - lyase activity [Evidence IEA]; GO:0016941 - natriuretic peptide receptor activity [Evidence IDA]; GO:0008528 - peptide receptor activity, G-protein coupled [Evidence IEA]; GO:0016849 - phosphorus-oxygen lyase activity [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006182 - cGMP biosynthesis [Evidence IDA]; GO:0009190 - cyclic nucleotide biosynthesis [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : Nppb receptor; guanylyl cyclase-B; achondroplasia; natriuretic peptide receptor B type product : natriuretic peptide receptor 2 protein_id : NP_776149.1

name	Spag8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55925585 GeneID:433700 MGI:3056295
definition	GO_component : GO:0001669 - acrosome [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : sperm associated antigen 8-like protein product : sperm associated antigen 8 protein_id : NP_001007464.1

name	Hint2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625719 CCDS:CCDS18106.1 GeneID:68917 MGI:1916167
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : histidine triad nucleotide binding protein 2 protein_id : NP_081147.1

name	4930412F15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425280 CCDS:CCDS18107.1 GeneID:242408 MGI:2441678
definition	codon_start : 1 product : hypothetical protein LOC242408 protein_id : NP_780726.1

name	Olfr70 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11464983 GeneID:56014 MGI:1860079
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS] [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS] [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2N78B-16239704-16240654; olfactory receptor MOR262-10 product : olfactory receptor 70 protein_id : NP_062358.1

name	Olfr71 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11464985 CCDS:CCDS18110.1 GeneID:56015 MGI:1860080
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS] [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS] [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2N78B-16230286-16231224; olfactory receptor MOR262-4 product : olfactory receptor 71 protein_id : NP_062359.1

name	LOC100039781 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252342 GeneID:100039781
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473653.1

name	5430416O09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313348 GeneID:71406 MGI:1918656
definition	codon_start : 1 product : hypothetical protein LOC71406 protein_id : NP_082065.1

name	A630077J23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94371744 GeneID:319973 MGI:2443089
definition	codon_start : 1 product : hypothetical protein LOC319973 protein_id : XP_987084.1

name	Olfr159 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11464981 CCDS:CCDS18112.1 GeneID:29849 MGI:1352686
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS] [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS] [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor 37e; GA_x6K02T2N78B-16165641-16166600; olfactory receptor MOR262-5 product : olfactory receptor 159 protein_id : NP_062349.1

name	Olfr156 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11276077 CCDS:CCDS18113.1 GeneID:29846 MGI:1352683
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS] [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS] [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory receptor 37b; GA_x6K02T2N78B-16125144-16126100; olfactory receptor MOR262-6 product : olfactory receptor 156 protein_id : NP_062347.1

name	LOC100040268 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252369 GeneID:100040268
definition	codon_start : 1 product : similar to olfactory receptor protein_id : XP_001474432.1

name	Olfr155 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11276075 CCDS:CCDS18115.1 GeneID:29845 MGI:1352681
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS] [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS] [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor 37a; GA_x6K02T2N78B-16092200-16091241 product : olfactory receptor 155 protein_id : NP_062346.1

name	Reck (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710064 CCDS:CCDS18116.1 GeneID:53614 MGI:1855698
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0000300 - peripheral to membrane of membrane fraction [Evidence ISS] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence ISS] [Evidence IDA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0001955 - blood vessel maturation [Evidence IGI] [Evidence IMP]; GO:0007049 - cell cycle [Evidence IEA]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IMP]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : membrane-anchored glycoprotein RECK; suppression of tumorigenicity 15 (reversion-inducing-cysteine-rich protein with kazal motifs) product : reversion-inducing-cysteine-rich protein with kazal motifs protein_id : NP_057887.1

name	Glipr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059151 CCDS:CCDS18117.1 GeneID:384009 MGI:1917770
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : GLI pathogenesis-related 2 protein_id : NP_081726.1

name	Ccin (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50582595 CCDS:CCDS18118.1 GeneID:442829 MGI:3045316
definition	GO_component : GO:0005856 - cytoskeleton [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : novel protein containing BTB/POZ and Kelch motif domains (probable ortholog of human calicin (CCIN)) product : calicin protein_id : NP_001002787.1

name	Clta (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122939194 GeneID:12757 MGI:894297
definition	GO_component : GO:0030125 - clathrin vesicle coat [Evidence IEA]; GO:0005905 - coated pit [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; clathrin light polypeptide (Lca) product : clathrin, light polypeptide (Lca) isoform b protein_id : NP_001073854.1

name	Clta (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122939198 GeneID:12757 MGI:894297
definition	GO_component : GO:0030125 - clathrin vesicle coat [Evidence IEA]; GO:0005905 - coated pit [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 3; clathrin light polypeptide (Lca) product : clathrin, light polypeptide (Lca) isoform c protein_id : NP_058040.2

name	Clta (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122939192 GeneID:12757 MGI:894297
definition	GO_component : GO:0030125 - clathrin vesicle coat [Evidence IEA]; GO:0005905 - coated pit [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; clathrin light polypeptide (Lca) product : clathrin, light polypeptide (Lca) isoform a protein_id : NP_001073853.1

name	Clta (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122939196 GeneID:12757 MGI:894297
definition	GO_component : GO:0030125 - clathrin vesicle coat [Evidence IEA]; GO:0005905 - coated pit [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 note : isoform d is encoded by transcript variant 4; clathrin light polypeptide (Lca) product : clathrin, light polypeptide (Lca) isoform d protein_id : NP_001073855.1

name	Gne (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980685 CCDS:CCDS18120.1 GeneID:50798 MGI:1354951
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence ISS]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0009384 - N-acylmannosamine kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008761 - UDP-N-acetylglucosamine 2-epimerase activity [Evidence IEA] GO_process : GO:0009103 - lipopolysaccharide biosynthesis [Evidence IEA]; GO:0006054 - N-acetylneuraminate metabolism [Evidence TAS]; GO:0006047 - UDP-N-acetylglucosamine metabolism [Evidence IEA] codon_start : 1 note : UDP-N-acetylglucosamine-2-epimerase/N- acetylmannosamine kinase product : glucosamine protein_id : NP_056643.2

name	LOC100040313 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252373 GeneID:100040313
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474537.1

name	OTTMUSG00000007209 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82893172 GeneID:623796 MGI:3651567
definition	codon_start : 1 product : hypothetical protein protein_id : XP_893385.1

name	Rnf38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781711 CCDS:CCDS18122.1 GeneID:73469 MGI:1920719
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : ring finger protein 38 isoform 1 protein_id : NP_780410.2

name	Rnf38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781709 CCDS:CCDS18123.1 GeneID:73469 MGI:1920719
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : ring finger protein 38 isoform 2 protein_id : NP_001034082.1

name	Melk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981626 CCDS:CCDS18124.1 GeneID:17279 MGI:106924
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : maternal embryonic leucine zipper kinase protein_id : NP_034920.2

name	Pax5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679213 CCDS:CCDS18125.1 GeneID:18507 MGI:97489
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence TAS]; GO:0016564 - transcriptional repressor activity [Evidence TAS] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : paired box gene 5 protein_id : NP_032808.1

name	5730488B01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252351 GeneID:70602 MGI:1917852
definition	codon_start : 1 product : hypothetical protein LOC70602 protein_id : XP_001474026.1

name	LOC545618 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252375 GeneID:545618
definition	codon_start : 1 product : similar to aurora kinase C protein_id : XP_620030.3

name	Zcchc7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892901 CCDS:CCDS18126.1 GeneID:319885 MGI:2442912
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, CCHC domain containing 7 protein_id : NP_796001.1

name	D4Wsu132e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070400 CCDS:CCDS18127.1 GeneID:28027 MGI:107328
definition	GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, CCHC domain containing 7 protein_id : NP_613056.1

name	Grhpr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17933768 CCDS:CCDS18128.1 GeneID:76238 MGI:1923488
definition	GO_function : GO:0030267 - glyoxylate reductase (NADP) activity [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016616 - oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor [Evidence IEA] GO_process : GO:0006564 - L-serine biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : glyoxylate reductase/hydroxypyruvate reductase protein_id : NP_525028.1

name	Zbtb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328404 CCDS:CCDS18129.1 GeneID:230119 MGI:1924601
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : expressed in brain and neural tube product : zinc finger and BTB domain containing 5 protein_id : NP_775575.2

name	Polr1e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12328816 CCDS:CCDS18131.1 GeneID:64424 MGI:1929022
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009303 - rRNA transcription [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : RNA polymerase I associated factor; polymerase (RNA) I associated factor 1; RNA polymerase I associated factor (Paf53) product : RNA polymerase I associated factor 53 protein_id : NP_073722.1

name	Fbxo10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94371758 GeneID:269529 MGI:2686937
definition	codon_start : 1 product : F-box protein 10 protein_id : XP_194139.6

name	1110019J04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252364 GeneID:68512 MGI:1915762
definition	codon_start : 1 product : hypothetical protein LOC68512 protein_id : XP_001474170.1

name	1110019J04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82893107 GeneID:68512 MGI:1915762
definition	codon_start : 1 product : hypothetical protein LOC68512 isoform 2 protein_id : XP_903998.1

name	Frmpd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487185 GeneID:666060 MGI:2446274
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : FERM and PDZ domain containing 1 protein_id : NP_001074641.1

name	Rg9mtd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560100 CCDS:CCDS18135.1 GeneID:69934 MGI:1917184
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008175 - tRNA methyltransferase activity [Evidence IEA] GO_process : GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 product : RNA (guanine-9-) methyltransferase domain containing 3 protein_id : NP_081542.2

name	Exosc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930417 CCDS:CCDS18136.1 GeneID:66362 MGI:1913612
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 product : exosome component 3 protein_id : NP_079789.1

name	Wdr32 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815804 GeneID:242418 MGI:2140179
definition	codon_start : 1 product : WD repeat domain 32 protein_id : NP_694807.2

name	Mcart1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57977299 CCDS:CCDS18137.1 GeneID:230125 MGI:2684984
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : mitochondrial carrier triple repeat 1 protein_id : NP_001009949.1

name	Shb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252377 GeneID:230126 MGI:98294
definition	codon_start : 1 product : src homology 2 domain-containing transforming protein B protein_id : XP_001474942.1

name	LOC100040557 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252379 GeneID:100040557
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474953.1

name	Gm829 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701911 GeneID:329839 MGI:2685675
definition	codon_start : 1 product : hypothetical protein LOC329839 protein_id : NP_001028584.1

name	LOC666325 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666325
definition	number : 1 pseudo : _no_value

name	1700055D18Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149252358 GeneID:73405 MGI:1920655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs product : RIKEN cDNA 1700055D18 gene transcript_id : XR_035225.1

name	LOC100040140 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252365 GeneID:100040140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 339 ESTs, 10 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_031676.1

clone name	MSMg01-375H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321A14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-312L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275E13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-179N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357L17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-418I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138E14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-417N13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-309E06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-361M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042O08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-276B03.b	B6Ng01-276B03.g
ACC	GA076940	GA076941
length	1,053	1,086
definition	B6Ng01-276B03.b	B6Ng01-276B03.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(44,591,448 - 44,592,498)	(44,745,065 - 44,746,145)
sequence	gaattcattactctgacagtgtgcaaagccttcactttgaatgccacaga gtacacactcaactccccctccacctacctgatggtgagtgggagggaga gaaaggactgcaccccactctcactaccggggctgtcattaactgtgaag gagtttggggtggagtaggtgggcaggaagctagtgatggccttggccaa ggaaggggctgctgtccttggtcctgaccgtccttgttggactagaggtc ctgccctcggaccggaggtctctgcatgctgtctctccctccagctcagc tataaaggactttggtggaattgattggaaaagattcttcacaccaatgc tctgtgagttggtggccttattgctgacatggggacagaaagaaaggctg gttctggcctcgggtaagacgagcccagcagtgtctgcctgacagctgca cacagtccctgcttccccagagcctctgagctgcacccagtgagaagagg ttaaaggacagccttattgtcacgtgcccaggacagaaacctctcgaagg agacagggttgttggcctctgccacaggtctcctcactaaatatacacac gggtgtgcagaacctcttcagctagctgagagaagtcctggtttttactt ggtttcatttggaaccttttgactacatcaatgctaataactaatgtaac tttaaaacacacacacacacacatgatggttttctgcaggctttttacaa tcaagtttactttaaaaattaaaaacaaaatttaaacaaataaatacatc ccgaggaacaaagaaaatatgtccaaagcccatgtctaggcctcagactg ccagttttccaccataactcacccttacggcccccgagtcccatctcacc cacatcaccagcaccagcaccagccctgcccactgccaggcctggtgaga atcaggactgctgccctggtgcccagatacctgacagagaggaagtccct gagggcgagtacagagagaacagcatttggggagaatggtgtgtgtgtgt gtg	gaattcacatacccagtgatctctcatcgcaggaacacatgaatagctga cattatgtaatgctttgacatttgacattcccaaggcattaccccacccc tgatgcagaataagttgtcagagcatgaaattggtatttttacatattct taatgtacagatgtcagtctgaaaaccattcactagtattatgattgcat tcttttgtctcattctctgtctatgccaagatctgttcttgtgatttctt tcctttagggagtttcaaagagggaagataaaactttaatgatctagttt gggattctgccaaaagctgaaagttaactttaagactcctaccacatttg gtaatgacgcttctggggcaggggcaaagatgcaacaagaaggaccggat gcaagctggaagtgcaaccggtgaccaacttgatggtgtcagatgccttg gcatgtccaaaccaaataggctttgcagttgatatgtttgttgttctgtt ttaatgacatatgtgattagcataggttggaagaggaataatgtctaaaa acaaggccatagaaaacagcgaggcgaggaggggaggattctgggacact gaccaacactctattattctgccatgtccctataggattcctttgtaaat gggcatctggcctctatttgaacaggaccaatgatggatgtcttactaca tcacaaaacagtgtatttcatctttgtacagttgggagatactgctcagg atccttccctccttccaataacagcaccaccttccccaatggaactgctg cttcttcatccagggcaggacagcaagaactcacaggctccttgcccaca ggaatgattagagaagcattccctggaaaagctctaatcttcccagaaac ccctctggggtcaaccctggtccttattaccagaccacactgtgttctta gctcctccccacccctgtgcagctctgcccacctacagcttggaaccaga ccataaagtctacctccttgtctttccctgctgtacaggatgtgcctgtc cgcctgtgcttttttccagcttcctctcctgactgc
quality values	Open. Hide. 46 15 17 38 62 41 26 54 54 62 62 62 62 62 62 47 51 29 62 62 62 62 62 54 56 62 62 62 62 62 62 62 59 34 46 62 62 62 54 33 54 37 54 62 59 49 62 59 62 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 54 62 62 59 62 62 62 59 62 62 62 62 54 54 62 62 62 62 62 54 59 62 62 62 62 59 59 62 62 59 59 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 47 56 56 56 56 62 62 62 56 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 47 43 62 62 62 56 51 51 56 56 51 56 62 62 49 56 46 62 56 62 54 62 54 54 62 62 62 62 62 54 43 56 56 62 62 62 62 62 62 62 62 42 42 27 38 24 39 62 62 62 62 56 39 62 49 62 62 56 62 62 38 47 62 62 62 62 62 47 62 62 39 62 48 35 47 35 47 43 62 62 52 62 62 62 62 62 62 62 62 62 62 54 62 62 62 52 54 54 41 58 52 54 58 54 54 54 54 46 54 45 47 58 48 58 47 54 54 54 52 52 52 54 52 58 54 52 58 54 54 54 43 42 58 44 38 54 58 52 58 42 54 52 52 54 45 45 52 58 54 54 58 39 54 48 58 54 46 49 35 58 54 58 58 54 58 58 58 54 46 52 47 58 58 45 50 58 58 51 50 46 58 51 58 37 58 41 46 51 49 58 58 58 51 48 35 53 29 58 39 45 34 38 50 51 58 58 38 52 53 40 50 50 50 49 51 48 37 39 40 31 50 50 52 58 39 27 58 58 58 50 29 41 37 43 35 47 46 51 39 51 36 51 43 58 50 52 46 32 28 51 50 50 49 49 18 33 52 39 31 19 6 15 25 12 49 43 50 25 33 22 6 51 24 22 9 54 33 51 51 28 29 39 49 42 40 43 50 42 39 30 28 39 34 44 36 40 39 24 16 40 40 33 29 52 11 16 34 35 54 32 51 40 49 20 51 34 33 39 53 37 49 41 49 30 32 53 40 40 30 28 35 32 41 54 30 47 54 54 40 31 28 15 25 32 40 28 25 54 35 37 42 53 45 34 31 35 35 53 20 22 16 33 26 28 25 21 29 21 35 13 21 17 9 9 15 31 46 52 52 32 32 32 29 27 31 14 25 31 40 32 43 30 27 26 45 51 43 34 31 29 11 14 20 46 45 51 31 23 25 13 38 28 18 15 25 31 24 51 21 13 21 45 28 34 31 14 24 15 11 14 22 14 10 24 32 22 14 19 32 21 27 29 18 23 30 31 48 32 31 26 13 46 31 25 21 34 42 31 30 22 15 10 8 16 19 19 25 13 19 19 16 32 37 18 17 12 12 11 31 29 21 31 31 15 20 20 39 16 26 27 21 6 29 8 31 26 11 12 27 28 14 11 37 31 19 21 10 9 11 36 14 31 11 11 29 29 9 36 21 44 18 19 15 29 12 28 14 9 9 5 6 6 11 5 6 7 9 6 19 7 8 15 19 13 12 31 6 31 39 37 28 31 21 6 26 5 8 7 5 4 9 10 29 11 13 8 15 9 8 12 4 8 12 13 16	Open. Hide. 62 47 35 47 62 59 56 59 59 62 62 43 43 44 28 19 20 33 17 35 59 62 62 62 59 59 62 62 62 59 62 59 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 56 56 59 62 56 54 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 38 62 47 62 46 46 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 46 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 49 54 58 54 52 54 54 58 54 54 58 58 58 58 58 49 49 47 58 39 58 58 41 46 52 58 45 58 58 58 58 58 58 54 58 58 48 43 58 50 58 47 44 50 53 58 40 51 51 48 47 50 47 49 58 51 54 47 58 58 54 58 42 58 58 27 58 58 47 51 29 58 32 26 51 58 51 58 49 58 49 46 52 46 54 39 29 28 37 38 58 49 52 51 58 58 53 51 49 39 52 41 58 58 58 47 46 51 46 49 58 49 51 58 58 51 52 53 39 39 58 37 25 50 50 49 33 58 49 41 47 40 58 39 39 58 58 44 44 50 50 54 50 58 41 33 58 49 52 49 53 53 49 44 40 50 44 44 41 44 49 31 32 49 24 49 41 51 32 35 54 49 41 45 54 45 52 51 41 52 37 23 26 52 38 54 37 34 49 40 54 54 40 38 42 37 52 51 31 38 28 54 52 52 32 53 53 43 54 35 31 18 31 37 37 37 20 20 29 44 44 37 25 37 34 37 37 47 54 37 51 33 32 9 40 26 21 32 53 31 53 34 40 40 36 35 34 32 16 20 35 32 32 35 26 32 42 28 31 45 40 34 31 27 53 32 47 53 25 41 40 30 26 42 29 27 14 27 32 31 31 31 39 31 31 31 28 35 31 33 31 32 32 32 33 20 25 38 35 46 26 31 17 27 30 17 31 27 27 9 32 21 17 6 9 28 31 30 27 23 26 41 28 35 28 31 15 41 31 30 41 36 18 30 28 33 31 27 17 31 38 30 32 24 30 23 31 21 35 44 17 37 24 36 36 30 37 30 20 19 14 25 41 37 37 21 32 31 29 31 23 21 29 31 25 22 21 31 18 19 22 44 38 22 17 38 38 26 29 31 31 26 41 38 32 22 21 14 16 6 38 21 31 17 19 5 17 32 32 19 31 17 21 20 22 33 25 18 31 25 21 25 31 21 17 11 18 18 25 14 20 30 17 15 26 19 29 32 32 19 19 10 30 43 18 20 9 37 39 22 23 19 19 30 31 34 17 29 30 31 32 27 37 48 16 8 14 27 10 11 32 27 22 13 12 12 27 25 5 13 15 17 5 14 28 6 15 27 28 18 47 24 27 24 26 13 9 19 15 25 11 27 8 8 14 5 8 4 40 18 7 21 22 21 21 12 17 10 6 21 20 11 21 3 3 3 23 8 20 5 8 16 14 14 13 8 6 16 25 12 14 9 14 3 4 28 17 17 17 4 16 13 15 11 8 8 7 6 7 8 12 11 12 20 10 18 14 8 11 22 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_44591448_44592498
seq2: B6Ng01-276B03.b_47_1099

seq1  GAATTCATTACTCTGACAGTGTGCAAAGCCTTCACTTTGAATGCCACAGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATTACTCTGACAGTGTGCAAAGCCTTCACTTTGAATGCCACAGA  50

seq1  GTACACACTCAACTCCCCCTCCACCTACCTGATGGTGAGTGGGAGGGAGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACACACTCAACTCCCCCTCCACCTACCTGATGGTGAGTGGGAGGGAGA  100

seq1  GAAAGGACTGCACCCCACTCTCACTACCGGGGCTGTCATTAACTGTGAAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGGACTGCACCCCACTCTCACTACCGGGGCTGTCATTAACTGTGAAG  150

seq1  GAGTTTGGGGTGGAGTAGGTGGGCAGGAAGCTAGTGATGGCCTTGGCCAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTTTGGGGTGGAGTAGGTGGGCAGGAAGCTAGTGATGGCCTTGGCCAA  200

seq1  GGAAGGGGCTGCTGTCCTTGGTCCTGACCGTCCTTGTTGGACTAGAGGTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGGGGCTGCTGTCCTTGGTCCTGACCGTCCTTGTTGGACTAGAGGTC  250

seq1  CTGCCCTCGGACCGGAGGTCTCTGCATGCTGTCTCTCCCTCCAGCTCAGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCCTCGGACCGGAGGTCTCTGCATGCTGTCTCTCCCTCCAGCTCAGC  300

seq1  TATAAAGGACTTTGGTGGAATTGATTGGAAAAGATTCTTCACACCAATGC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAAAGGACTTTGGTGGAATTGATTGGAAAAGATTCTTCACACCAATGC  350

seq1  TCTGTGAGTTGGTGGCCTTATTGCTGACATGGGGACAGAAAGAAAGGCTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTGAGTTGGTGGCCTTATTGCTGACATGGGGACAGAAAGAAAGGCTG  400

seq1  GTTCTGGCCTCGGGTAAGACGAGCCCAGCAGTGTCTGCCTGACAGCTGCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTGGCCTCGGGTAAGACGAGCCCAGCAGTGTCTGCCTGACAGCTGCA  450

seq1  CACAGTCCCTGCTTCCCCAGAGCCTCTGAGCTGCACCCAGTGAGAAGAGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGTCCCTGCTTCCCCAGAGCCTCTGAGCTGCACCCAGTGAGAAGAGG  500

seq1  TTAAAGGACAGCCTTATTGTCACGTGCCCAGGACAGAAACCTCTCGAAGG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAGGACAGCCTTATTGTCACGTGCCCAGGACAGAAACCTCTCGAAGG  550

seq1  AGACAGGGTTGTTGGCCTCTGCCACAGGTCTCCTCACTAAATATACACAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACAGGGTTGTTGGCCTCTGCCACAGGTCTCCTCACTAAATATACACAC  600

seq1  GGGTGTGCAGAACCTCTTCAGCTAGCTGAGAGAAGTCCTGGTTTTTACTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTGTGCAGAACCTCTTCAGCTAGCTGAGAGAAGTCCTGGTTTTTACTT  650

seq1  GGTTTCATTTGGAACCTTTTGACTACATCAATGCTAATAACTAATGTAAC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTTCATTTGGAACCTTTTGACTACATCAATGCTAATAACTAATGTAAC  700

seq1  TTTAAAACACACACACACACACATGATGGTTTTCTGCAGGC-TTTTACAA  749
      ||||||||||||||||||||||||||||||||||||||||| ||||||||
seq2  TTTAAAACACACACACACACACATGATGGTTTTCTGCAGGCTTTTTACAA  750

seq1  TCAAGTTTACTTTAAAAATTAAAAACAAAATTAAAACAAATAAATACATC  799
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  TCAAGTTTACTTTAAAAATTAAAAACAAAATTTAAACAAATAAATACATC  800

seq1  CCGAGGAACAAAGAAAATATGTCCAAAGCCCATGTCTAGGCCTCAGACTG  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGAGGAACAAAGAAAATATGTCCAAAGCCCATGTCTAGGCCTCAGACTG  850

seq1  CCAGTTTTCCACCATAACTCACCCTTACGGCCCCCGAGTCCCATCTCACC  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGTTTTCCACCATAACTCACCCTTACGGCCCCCGAGTCCCATCTCACC  900

seq1  CACATCACCAGCACCAGCACCAGCCCTGCCCACTGCCAGGCCTGGTGAGA  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATCACCAGCACCAGCACCAGCCCTGCCCACTGCCAGGCCTGGTGAGA  950

seq1  ATCAGGACTGCTG-CCTGGTGCCCAGATACCTGACAGAGAGGAAAGTCCC  998
      ||||||||||||| |||||||||||||||||||||||||||| |||||||
seq2  ATCAGGACTGCTGCCCTGGTGCCCAGATACCTGACAGAGAGG-AAGTCCC  999

seq1  TGAGGGCGGAGAACAGAGAG-ACAGCATTTGGGAAG-ATGGTGTGTGTGT  1046
      ||||||| ||| |||||||| |||||||||||| || |||||||||||||
seq2  TGAGGGC-GAGTACAGAGAGAACAGCATTTGGGGAGAATGGTGTGTGTGT  1048

seq1  GTGTG  1051
      |||||
seq2  GTGTG  1053

seq1: chr4_44745065_44746145
seq2: B6Ng01-276B03.g_63_1148 (reverse)

seq1  GCAGTCAGGAGAG--AGCTGGAAAAAGCCACAGGC-GACAGCCACAACCC  47
      |||||||||||||  |||||||||||  ||||||| ||||| ||| | ||
seq2  GCAGTCAGGAGAGGAAGCTGGAAAAAAGCACAGGCGGACAGGCAC-ATCC  49

seq1  TGTACAGCAGGGAAAGACAAGGAGGTAGACTTTATGGTCTGGGTCCCAGC  97
      |||||||||||||||||||||||||||||||||||||||||| ||| |||
seq2  TGTACAGCAGGGAAAGACAAGGAGGTAGACTTTATGGTCTGGTTCCAAGC  99

seq1  TGTAGGTGGGCAGAGCTGCACAGGG--TGGGAGGAGCTAAGAACACAGTG  145
      |||||||||||||||||||||||||   ||||||||||||||||||||||
seq2  TGTAGGTGGGCAGAGCTGCACAGGGGTGGGGAGGAGCTAAGAACACAGTG  149

seq1  TGGTCTGGTAATAAGGACCA-GGTTGACCCCAGAGGGGTTTCTGGGAAGA  194
      |||||||||||||||||||| |||||||||||||||||||||||||||||
seq2  TGGTCTGGTAATAAGGACCAGGGTTGACCCCAGAGGGGTTTCTGGGAAGA  199

seq1  TTAGAGCTTTTCCAGGGAATGCTTCTCTAATCATTCCTGTGGGCAAGGAG  244
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGAGCTTTTCCAGGGAATGCTTCTCTAATCATTCCTGTGGGCAAGGAG  249

seq1  CCTGTGAGTTCTTGCTGTCCTGCCCTGGATGAAGAAGCAGCAGTTCCATT  294
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTGAGTTCTTGCTGTCCTGCCCTGGATGAAGAAGCAGCAGTTCCATT  299

seq1  GGGGAAGGTGGTGCTGTTATTGGAAGGAGGGAAGGATCCTGAGCAGTATC  344
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGAAGGTGGTGCTGTTATTGGAAGGAGGGAAGGATCCTGAGCAGTATC  349

seq1  TCCCAACTGTACAAAGATGAAATACACTGTTTTGTGATGTAGTAAGACAT  394
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCAACTGTACAAAGATGAAATACACTGTTTTGTGATGTAGTAAGACAT  399

seq1  CCATCATTGGTCCTGTTCAAATAGAGGCCAGATGCCCATTTACAAAGGAA  444
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATCATTGGTCCTGTTCAAATAGAGGCCAGATGCCCATTTACAAAGGAA  449

seq1  TCCTATAGGGACATGGCAGAATAATAGAGTGTTGGTCAGTGTCCCAGAAT  494
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTATAGGGACATGGCAGAATAATAGAGTGTTGGTCAGTGTCCCAGAAT  499

seq1  CCTCCCCTCCTCGCCTCGCTGTTTTCTATGGCCTTGTTTTTAGACATTAT  544
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCCCTCCTCGCCTCGCTGTTTTCTATGGCCTTGTTTTTAGACATTAT  549

seq1  TCCTCTTCCAACCTATGCTAATCACATATGTCATTAAAACAGAACAACAA  594
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCTTCCAACCTATGCTAATCACATATGTCATTAAAACAGAACAACAA  599

seq1  ACATATCAACTGCAAAGCCTATTTGGTTTGGACATGCCAAGGCATCTGAC  644
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATATCAACTGCAAAGCCTATTTGGTTTGGACATGCCAAGGCATCTGAC  649

seq1  ACCATCAAGTTGGTCACCGGTTGCACTTCCAGCTTGCATCCGGTCCTTCT  694
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCATCAAGTTGGTCACCGGTTGCACTTCCAGCTTGCATCCGGTCCTTCT  699

seq1  TGTTGCATCTTTGCCCCTGCCCCAGAAGCGTCATTACCAAATGTGGTAGG  744
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTGCATCTTTGCCCCTGCCCCAGAAGCGTCATTACCAAATGTGGTAGG  749

seq1  AGTCTTAAAGTTAACTTTCAGCTTTTGGCAGAATCCCAAACTAGATCATT  794
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCTTAAAGTTAACTTTCAGCTTTTGGCAGAATCCCAAACTAGATCATT  799

seq1  AAAGTTTTATCTTCCCTCTTTGAAACTCCCTAAAGGAAAGAAATCACAAG  844
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTTTTATCTTCCCTCTTTGAAACTCCCTAAAGGAAAGAAATCACAAG  849

seq1  AACAGATCTTGGCATAGACAGAGAATGAGACAAAAGAATGCAATCATAAT  894
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAGATCTTGGCATAGACAGAGAATGAGACAAAAGAATGCAATCATAAT  899

seq1  ACTAGTGAATGGTTTTCAGACTGACATCTGTACATTAAGAATATGTAAAA  944
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTAGTGAATGGTTTTCAGACTGACATCTGTACATTAAGAATATGTAAAA  949

seq1  ATACCAATTTCATGCTCTGACAACTTATTCTGCATCAGGGGTGGGGTAAT  994
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACCAATTTCATGCTCTGACAACTTATTCTGCATCAGGGGTGGGGTAAT  999

seq1  GCCTTGGGAATGTCAAATGTCAAAGCATTACATAATGTCAGCTATTCATG  1044
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTTGGGAATGTCAAATGTCAAAGCATTACATAATGTCAGCTATTCATG  1049

seq1  TGTTCCTGCGATGAGAGATCACTGGGTATGTGAATTC  1081
      |||||||||||||||||||||||||||||||||||||
seq2  TGTTCCTGCGATGAGAGATCACTGGGTATGTGAATTC  1086

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information