MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-279E03
Chromosome	4 (Build37)
Map Location	139,731,142 - 139,852,318
singlet/doublet	doublet
Overlap gene	Igsf21, LOC100040728
Upstream gene	9530077C14Rik, Capzb, Pqlc2, LOC100042808, Akr7a5, LOC625977, LOC626000, Mrto4, C230096C10Rik, Zubr1, C79267, Aldh4a1, Tas1r2, Pax7, Gm1667, Klhdc7a
Downstream gene	Arhgef10l, Rcc2, Padi6, Padi4, Padi3, Padi1, Padi2, Sdhb, Atp13a2, Mfap2, Crocc, Necap2, LOC638991, Spata21, D4Ertd22e, Fbxo42, 6330545A04Rik, Arhgef19
Link	Open Mouse BAC browser

Click to get alignment info.

name	9530077C14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78454 MGI:1925704
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Capzb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12345 MGI:104652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pqlc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212555 MGI:2384837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042808 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Akr7a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110198 MGI:107796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625977 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC626000 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 56 ESTs, 10 Proteins pseudo : _no_value

name	Mrto4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69902 MGI:1917152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C230096C10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230866 MGI:2443696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zubr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69116 MGI:1916366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 350 ESTs, 8 Proteins

name	C79267 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212632 MGI:2140675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aldh4a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212647 MGI:2443883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas1r2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83770 MGI:1933546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pax7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18509 MGI:97491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1667 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381564 MGI:2686513
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Klhdc7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242721 MGI:2444612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igsf21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230868 MGI:2681842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040728 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Arhgef10l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72754 MGI:1920004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rcc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108911 MGI:1919784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Padi6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242726 MGI:2655198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Padi4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18602 MGI:1338898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Padi3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18601 MGI:1338891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Padi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18599 MGI:1338893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Padi2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18600 MGI:1338892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdhb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67680 MGI:1914930
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp13a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74772 MGI:1922022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mfap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17150 MGI:99559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crocc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230872 MGI:3529431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Necap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66147 MGI:1913397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC638991 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins pseudo : _no_value

name	Spata21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329972 MGI:3607787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D4Ertd22e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213491 MGI:1098672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Fbxo42 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213499 MGI:1924992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330545A04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76166 MGI:1923416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgef19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213649 MGI:1925912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9530077C14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253181 GeneID:78454 MGI:1925704
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 9530077C14 gene transcript_id : XM_001479413.1

name	Capzb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352714 GeneID:12345 MGI:104652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : capping protein (actin filament) muscle Z-line, beta transcript_id : NM_009798.3

name	Capzb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649736 GeneID:12345 MGI:104652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : capping protein (actin filament) muscle Z-line, beta transcript_id : NM_001037761.1

name	Pqlc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703767 GeneID:212555 MGI:2384837
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PQ loop repeat containing 2 transcript_id : NM_145384.1

name	LOC100042808 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253183 GeneID:100042808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100042808 transcript_id : XM_001479428.1

name	Akr7a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27659727 GeneID:110198 MGI:107796
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldo-keto reductase family 7, member A5 (aflatoxin aldehyde reductase) transcript_id : NM_025337.2

name	Mrto4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130329 GeneID:69902 MGI:1917152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MRT4, mRNA turnover 4, homolog (S. cerevisiae) transcript_id : NM_023536.2

name	C230096C10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861264 GeneID:230866 MGI:2443696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C230096C10 gene transcript_id : NM_146157.3

name	C230096C10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861259 GeneID:230866 MGI:2443696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C230096C10 gene transcript_id : NM_001039200.1

name	Zubr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253188 GeneID:69116 MGI:1916366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 349 ESTs, 7 Proteins product : zinc finger, UBR1 type 1, transcript variant 2 transcript_id : XM_001479455.1

name	Zubr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253186 GeneID:69116 MGI:1916366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 350 ESTs, 8 Proteins product : zinc finger, UBR1 type 1, transcript variant 1 transcript_id : XM_001479450.1

name	C79267 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147164 GeneID:212632 MGI:2140675
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C79267 transcript_id : NM_183148.1

name	Aldh4a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328414 GeneID:212647 MGI:2443883
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase 4 family, member A1 transcript_id : NM_175438.3

name	Tas1r2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13994202 GeneID:83770 MGI:1933546
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 1, member 2 transcript_id : NM_031873.1

name	Pax7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130502943 GeneID:18509 MGI:97491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired box gene 7 transcript_id : NM_011039.2

name	Gm1667 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372602 GeneID:381564 MGI:2686513
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : gene model 1667, (NCBI) transcript_id : XM_979440.1

name	Klhdc7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116063541 GeneID:242721 MGI:2444612
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch domain containing 7A transcript_id : NM_173427.2

name	Igsf21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348465 GeneID:230868 MGI:2681842
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobin superfamily, member 21 transcript_id : NM_198610.1

name	LOC100040728 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253153 GeneID:100040728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040728 transcript_id : XM_001475143.1

name	Arhgef10l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254211 GeneID:72754 MGI:1920004
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho guanine nucleotide exchange factor (GEF) 10-like transcript_id : NM_172415.2

name	Rcc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802188 GeneID:108911 MGI:1919784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of chromosome condensation 2 transcript_id : NM_173867.2

name	Padi6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119372293 GeneID:242726 MGI:2655198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidyl arginine deiminase, type VI transcript_id : NM_153106.2

name	Padi4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755017 GeneID:18602 MGI:1338898
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidyl arginine deiminase, type IV transcript_id : NM_011061.1

name	Padi3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353909 GeneID:18601 MGI:1338891
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidyl arginine deiminase, type III transcript_id : NM_011060.2

name	Padi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130215 GeneID:18599 MGI:1338893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidyl arginine deiminase, type I transcript_id : NM_011059.2

name	Padi2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679264 GeneID:18600 MGI:1338892
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidyl arginine deiminase, type II transcript_id : NM_008812.1

name	Sdhb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328285 GeneID:67680 MGI:1914930
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : succinate dehydrogenase complex, subunit B, iron sulfur (Ip) transcript_id : NM_023374.3

name	Atp13a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794173 GeneID:74772 MGI:1922022
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase type 13A2 transcript_id : NM_029097.1

name	Mfap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982203 GeneID:17150 MGI:99559
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microfibrillar-associated protein 2 transcript_id : NM_008546.2

name	Crocc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26006472 GeneID:230872 MGI:3529431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ciliary rootlet coiled-coil, rootletin transcript_id : NM_172122.1

name	Necap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560260 GeneID:66147 MGI:1913397
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NECAP endocytosis associated 2 transcript_id : NM_025383.2

name	Spata21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802358 GeneID:329972 MGI:3607787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated 21 transcript_id : NM_177867.3

name	D4Ertd22e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043938 GeneID:213491 MGI:1098672
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 4, ERATO Doi 22, expressed transcript_id : NM_174996.2

name	D4Ertd22e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043933 GeneID:213491 MGI:1098672
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 4, ERATO Doi 22, expressed transcript_id : NM_001025608.1

name	Fbxo42 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254216 GeneID:213499 MGI:1924992
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 42 transcript_id : NM_172518.2

name	6330545A04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487178 GeneID:76166 MGI:1923416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330545A04 gene transcript_id : NM_001081174.1

name	Arhgef19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361383 GeneID:213649 MGI:1925912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho guanine nucleotide exchange factor (GEF) 19 transcript_id : NM_172520.2

name	9530077C14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253182 GeneID:78454 MGI:1925704
definition	codon_start : 1 product : hypothetical protein LOC78454 protein_id : XP_001479463.1

name	Capzb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753262 CCDS:CCDS18841.1 GeneID:12345 MGI:104652
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0008290 - F-actin capping protein complex [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0051016 - barbed-end actin filament capping [Evidence IEA]; GO:0030030 - cell projection organization and biogenesis [Evidence IMP]; GO:0030032 - lamellipodium biogenesis [Evidence IMP] codon_start : 1 note : isoform b is encoded by transcript variant 2; capping protein beta 1; [b]1 cDNA; [b]2 cDNA product : capping protein (actin filament) muscle Z-line, beta isoform b protein_id : NP_033928.1

name	Capzb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649737 CCDS:CCDS18842.1 GeneID:12345 MGI:104652
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0008290 - F-actin capping protein complex [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0051016 - barbed-end actin filament capping [Evidence IEA]; GO:0030030 - cell projection organization and biogenesis [Evidence IMP]; GO:0030032 - lamellipodium biogenesis [Evidence IMP] codon_start : 1 note : isoform a is encoded by transcript variant 1; capping protein beta 1; [b]1 cDNA; [b]2 cDNA product : capping protein (actin filament) muscle Z-line, beta isoform a protein_id : NP_001032850.1

name	Pqlc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703768 CCDS:CCDS18843.1 GeneID:212555 MGI:2384837
definition	codon_start : 1 product : PQ loop repeat containing 2 protein_id : NP_663359.1

name	LOC100042808 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253184 GeneID:100042808
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479478.1

name	Akr7a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27659728 CCDS:CCDS18844.1 GeneID:110198 MGI:107796
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004033 - aldo-keto reductase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : aflatoxin B1 aldehyde reductase product : aldo-keto reductase family 7, member A5 (aflatoxin aldehyde reductase) protein_id : NP_079613.2

name	Mrto4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37537520 CCDS:CCDS18845.1 GeneID:69902 MGI:1917152
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0042254 - ribosome biogenesis and assembly [Evidence IEA] codon_start : 1 note : novel protein containing ribosomal protein L10 domain product : muscle protein684 protein_id : NP_076025.1

name	C230096C10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542273 GeneID:230866 MGI:2443696
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; KIAA0090 protein-like; novel DUF1620 domain containing protein product : hypothetical protein LOC230866 isoform 1 protein_id : NP_666269.2

name	C230096C10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861260 CCDS:CCDS18846.1 GeneID:230866 MGI:2443696
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; KIAA0090 protein-like; novel DUF1620 domain containing protein product : hypothetical protein LOC230866 isoform 2 protein_id : NP_001034289.1

name	Zubr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253189 GeneID:69116 MGI:1916366
definition	codon_start : 1 product : retinoblastoma-associated factor 600 isoform 2 protein_id : XP_001479505.1

name	Zubr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253187 GeneID:69116 MGI:1916366
definition	codon_start : 1 product : retinoblastoma-associated factor 600 isoform 1 protein_id : XP_001479500.1

name	C79267 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147165 CCDS:CCDS18847.1 GeneID:212632 MGI:2140675
definition	codon_start : 1 product : hypothetical protein LOC212632 protein_id : NP_898971.1

name	Aldh4a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328415 CCDS:CCDS18848.1 GeneID:212647 MGI:2443883
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] [Evidence IDA] GO_process : GO:0006561 - proline biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : aldehyde dehydrogenase 4 family, member A1 protein_id : NP_780647.2

name	Tas1r2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13994203 CCDS:CCDS18849.1 GeneID:83770 MGI:1933546
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor 71; candidate taste receptor T1R2 product : taste receptor, type 1, member 2 protein_id : NP_114079.1

name	Pax7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328055 CCDS:CCDS18850.1 GeneID:18509 MGI:97491
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : paired box transcription factor PAX7 product : paired box gene 7 protein_id : NP_035169.1

name	Gm1667 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94372603 GeneID:381564 MGI:2686513
definition	codon_start : 1 product : hypothetical protein protein_id : XP_984534.1

name	Klhdc7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116063542 GeneID:242721 MGI:2444612
definition	codon_start : 1 note : novel kelch domain containing protein product : kelch domain containing 7A protein_id : NP_775603.2

name	Igsf21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348466 CCDS:CCDS18851.1 GeneID:230868 MGI:2681842
definition	codon_start : 1 note : novel protein containing immunoglobulin domains product : immunoglobin superfamily, member 21 protein_id : NP_941012.1

name	LOC100040728 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253154 GeneID:100040728
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475193.1

name	Arhgef10l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254212 GeneID:72754 MGI:1920004
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005829 - cytosol [Evidence ISS]; GO:0000118 - histone deacetylase complex [Evidence TAS]; GO:0005622 - intracellular [Evidence IEA]; GO:0015630 - microtubule cytoskeleton [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0004407 - histone deacetylase activity [Evidence TAS]; GO:0005100 - Rho GTPase activator activity [Evidence ISS]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence TAS] GO_process : GO:0035104 - positive regulation of sterol regulatory element binding-protein target gene transcription [Evidence ISS]; GO:0051496 - positive regulation of stress fiber formation [Evidence ISS]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : Rho guanine nucleotide exchange factor (GEF) 10-like protein_id : NP_766003.2

name	Rcc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239431 CCDS:CCDS18852.1 GeneID:108911 MGI:1919784
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 product : RCC1-like protein_id : NP_776292.1

name	Padi6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119372294 GeneID:242726 MGI:2655198
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0045111 - intermediate filament cytoskeleton [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004668 - protein-arginine deiminase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : arginine deiminase-like protein; peptidylarginine deiminase, type VI product : peptidyl arginine deiminase, egg and embryo abundant protein_id : NP_694746.2

name	Padi4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755018 CCDS:CCDS18854.1 GeneID:18602 MGI:1338898
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004668 - protein-arginine deiminase activity [Evidence TAS] [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : PAD type IV; peptidylarginine deiminase, type IV product : peptidyl arginine deiminase, type IV protein_id : NP_035191.1

name	Padi3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755016 CCDS:CCDS18855.1 GeneID:18601 MGI:1338891
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004668 - protein-arginine deiminase activity [Evidence TAS] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 exception : mismatches in translation note : PAD type III; peptidylarginine deiminase, type III product : peptidyl arginine deiminase, type III protein_id : NP_035190.1

name	Padi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755014 CCDS:CCDS18856.1 GeneID:18599 MGI:1338893
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004668 - protein-arginine deiminase activity [Evidence TAS] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : PAD type I; Pad type 1; peptidylarginine deiminase, type I product : peptidyl arginine deiminase, type I protein_id : NP_035189.1

name	Padi2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679265 CCDS:CCDS18857.1 GeneID:18600 MGI:1338892
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004668 - protein-arginine deiminase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 exception : mismatches in translation note : PAD type II; peptidylarginine deiminase, type II product : peptidyl arginine deiminase, type II protein_id : NP_032838.1

name	Sdhb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328286 CCDS:CCDS18858.1 GeneID:67680 MGI:1914930
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0051537 - 2 iron, 2 sulfur cluster binding [Evidence IEA]; GO:0051538 - 3 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008177 - succinate dehydrogenase (ubiquinone) activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : succinate dehydrogenase complex subunit B product : succinate dehydrogenase complex, subunit B, iron sulfur (Ip) protein_id : NP_075863.2

name	Atp13a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794174 CCDS:CCDS18859.1 GeneID:74772 MGI:1922022
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ATPase type 13A2 protein_id : NP_083373.1

name	Mfap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678784 CCDS:CCDS18860.1 GeneID:17150 MGI:99559
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0001527 - microfibril [Evidence IEA] codon_start : 1 note : microfibril-associated glycoprotein; microfibril-associated glycoprotein 1 product : microfibril-associated glycoprotein 2 protein_id : NP_032572.1

name	Crocc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26006473 CCDS:CCDS18861.1 GeneID:230872 MGI:3529431
definition	GO_component : GO:0005814 - centriole [Evidence IDA]; GO:0035253 - ciliary rootlet [Evidence IDA] GO_function : GO:0019894 - kinesin binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051297 - centrosome organization and biogenesis [Evidence ISS] codon_start : 1 exception : mismatches in translation note : rootletin product : ciliary rootlet coiled-coil, rootletin protein_id : NP_742120.1

name	Necap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384758 CCDS:CCDS18862.1 GeneID:66147 MGI:1913397
definition	GO_component : GO:0030125 - clathrin vesicle coat [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : clathrin-coated vesicle coat protein; likely ortholog of H. sapiens adaptin-ear-binding coat-associated protein 2 (NECAP2) product : adaptin-ear-binding coat-associated protein 2 protein_id : NP_079659.1

name	Spata21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244468 CCDS:CCDS18863.1 GeneID:329972 MGI:3607787
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : novel protein containing an EF hand domain product : spermatogenesis associated 21 protein_id : NP_808535.1

name	D4Ertd22e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043934 CCDS:CCDS18864.1 GeneID:213491 MGI:1098672
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : putative MAPK activating protein PM20,PM21 isoform 1 protein_id : NP_001020779.1

name	D4Ertd22e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239391 CCDS:CCDS18865.1 GeneID:213491 MGI:1098672
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : putative MAPK activating protein PM20,PM21 isoform 2 protein_id : NP_778161.1

name	Fbxo42 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254217 CCDS:CCDS18866.1 GeneID:213499 MGI:1924992
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box protein 42 protein_id : NP_766106.2

name	6330545A04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487179 GeneID:76166 MGI:1923416
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC76166 protein_id : NP_001074643.1

name	Arhgef19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369718 CCDS:CCDS18868.1 GeneID:213649 MGI:1925912
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 product : Rho guanine nucleotide exchange factor (GEF) 19 protein_id : NP_766108.1

name	LOC625977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625977
definition	number : 1 pseudo : _no_value

name	LOC625977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625977
definition	number : 2 pseudo : _no_value

name	LOC625977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625977
definition	number : 3 pseudo : _no_value

name	LOC626000 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253185 GeneID:626000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 56 ESTs, 10 Proteins product : similar to Cyclin D3 pseudo : _no_value transcript_id : XR_034198.1

name	LOC638991 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253155 GeneID:638991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins product : similar to ribosomal protein S2 pseudo : _no_value transcript_id : XR_001796.2

clone name	MSMg01-380M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471I02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-506O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-208J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144F02
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-279E03.b	B6Ng01-279E03.g
ACC	GA079284	GA079285
length	1,051	866
definition	B6Ng01-279E03.b	B6Ng01-279E03.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(139,731,142 - 139,732,192)	(139,851,453 - 139,852,318)
sequence	gaattctcagctttttgccaggagccctggaccctcatcatgagactctg tggccatgaggggctgtggtgttgtgattgttacaccatgtatcctagcc aggaaatagtccgacccttggtgggtaggtctttccatgtcaattgacaa taatcaagataatctccgtgttcagaagtctgtcttctagatgactttag attctgttgaaattaaccatctcagaacctgtcacgaaaaatatgattaa ggaagacactcagtgcagatctctggcttcaatagtacatacatgtacac ctctgtgtgtgcacacacatacatacaggcacacaggcatgcattctttc attcgtgcaatcacagtggtagggctgtagtgggcctgtgagaccacacc agctcacttacaagtggatagtgttcttccacgtgggacacatggaggcc agagaagattcaagtccaaggactcgacatgccctcgcttgacacactag gaacaaccagcaaaggggcagggacctcactcaggtactcgccgagaatt gacctctgccaagataccagtgggtgtgaaagctcttgcttagatcctgt ggtgaaaacccagtcagacaacacaagctgactttacctttgtgagacct acaccagaggattgaagggagctctccctgactttgaacccacagagctg gagagatatcagataaaatttattgaagcggtttttggatcaacactttg ttttggtgccagaatgaactaacactactctggctctaaggtggaagcag cctgttgatgaatcagtatgcgtgtactgcctcagtcctgaaactttaat agttcctgtcaagttgaacagtcctgttagggtcatagcttgcatgtcaa ccctgcgtgtgtgtgcgtgcgcgagtgtgcatgtgtgtgtgtgtatgaat gtgtgagagcagtactcatgcatgtgttgtgtgtatgtgtgtagatacac agatgtgtgtgtgtgtgcaggtacaccatgcctcctggtgtggtgtgtgt g	gaattccatgctaagttcaaaggatacgtgttttattaagtaatggctcc aactgcaaataggggacagaaaggtgacgctgggacctaacacacaaagg gtcaagttaattctggttcacactgcagctcaataagaataaacagtata aatgaagcccaccactacccacagtttgtcctctcattggggatcttgga ccaagtccatcctggataacggggacgctgcattttgtagactggctttg cacagggtgtgagccctcatggctcttcagggtaggcaataacaacagag aataaggagagaagcacacatcattacatgggattggtctcttcatccag ggagacttaaaaggggccgatctggactggggtgggccagcagggagatc cgtagaagctcctaagctctctgggaagttctcataaacataaggtccac tgcttgtagggctgctgcagacagcaaaaaaaaaatctctggtcataaag tagtcctcataaaacaaagatgaaaaggaaaaaaaagcgcaataaatgca gcaatgtcctttagggaaggagcagagaaaggctaagcttcgaagccacc cccgcaggctgggtaaacccaggtccaagccagggaagcaagtgtgtagc cagcatgaggggtgcaccgccagaaacggttgctggtactgtggcttgga tggaggttgctgtggggatcccagtgtctccaaacactttcccgagtgtt cctttgtcatgtgtaattggagatggcctgtcccatctctcctggaagga tgagagaagaccactgtgcagtgtgaggtctggacttgctgagggtggga gtggggtgtgggcaag
quality values	Open. Hide. 58 26 21 29 58 48 54 25 20 52 58 58 58 58 58 58 36 54 35 25 62 62 28 45 62 62 62 62 54 62 31 37 62 56 50 28 32 50 37 37 62 62 47 47 47 54 62 62 62 62 62 49 49 62 59 59 62 59 44 49 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 49 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 54 62 62 62 49 62 62 62 62 62 62 54 47 47 62 62 62 62 62 54 47 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 52 62 62 62 62 62 62 62 62 62 58 54 58 58 58 54 58 58 58 58 58 58 58 58 58 58 54 54 58 58 41 45 58 58 58 54 44 58 58 52 41 58 58 52 46 58 58 54 58 58 54 58 31 58 54 49 58 58 46 47 58 58 58 58 58 58 42 46 58 48 54 42 54 54 54 48 58 54 58 58 58 54 58 58 58 58 58 58 50 58 58 58 54 58 58 58 58 49 49 37 48 51 49 47 48 58 54 51 58 51 58 58 58 49 38 37 58 51 47 52 58 53 50 48 58 40 42 58 50 50 49 48 43 50 58 51 41 15 20 58 58 50 50 46 43 50 58 51 53 51 58 58 40 39 29 51 50 52 51 39 46 53 53 42 44 26 58 28 23 58 49 50 51 40 58 58 49 29 50 58 53 54 50 58 35 41 47 32 25 51 58 51 39 39 40 40 58 51 39 51 50 39 46 28 52 52 40 49 46 33 51 28 39 29 34 39 42 52 37 46 23 26 54 54 33 31 54 52 37 42 53 53 47 53 32 51 50 51 24 54 54 54 51 47 35 40 30 40 35 37 45 40 34 33 36 33 47 45 54 54 42 51 40 45 37 26 53 35 34 48 35 37 52 45 45 37 40 40 41 42 42 39 32 40 45 52 52 31 47 34 32 32 42 33 24 44 8 46 28 34 51 41 52 23 52 34 31 40 53 26 41 32 42 32 39 31 31 47 30 31 35 34 36 42 37 31 30 40 31 30 45 31 29 30 31 30 12 46 41 39 31 31 35 37 32 28 31 37 51 29 31 32 51 30 29 36 27 33 28 31 42 32 35 31 41 30 31 30 31 34 32 32 30 35 32 31 29 31 32 34 33 19 31 22 37 36 30 46 33 23 36 32 30 32 20 32 37 33 34 25 23 30 31 29 30 25 29 37 48 32 37 36 37 30 30 37 34 43 36 32 31 31 41 24 41 31 31 18 36 16 37 12 32 32 29 33 32 25 34 30 29 34 25 32 28 29 33 31 31 31 31 31 27 26 25 33 22 29 31 33 24 22 28 16 38 11 37 5 5 9 21 33 32 26 16 27 34 34 22 34 23 30 16 12 28 30 18 33 22 21 19 22 29 31 32 24 13 12 15 32 17 29 16 19 19 13 4 5 20 33 7 14 12 20 17 15 8 6 11 11 8 9 11 20 28 27 15 24 19 13 14 7 6 4 5 20 27 12 6 3 5 10 13 20 20 11 27 11 7 6 6 9 6 10 15 9 8 7	Open. Hide. 62 47 42 47 62 62 44 23 62 62 59 44 45 32 32 46 62 59 41 62 62 62 62 46 59 62 59 62 62 62 62 62 54 54 59 62 59 62 62 62 59 62 62 59 62 62 62 62 54 54 59 62 62 62 59 59 59 49 54 62 59 62 62 62 62 59 51 62 59 59 54 49 54 62 62 62 59 59 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 54 62 56 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 45 47 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 52 52 52 34 46 47 58 54 58 54 58 58 58 58 58 58 58 54 58 52 58 58 52 58 58 54 58 58 58 58 58 58 54 58 58 54 58 58 58 58 58 58 54 52 58 54 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 52 54 54 58 58 58 54 58 54 58 58 58 58 58 58 58 53 58 58 54 51 53 58 58 54 51 42 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 50 51 54 58 58 58 58 54 58 58 58 58 50 51 51 58 52 51 58 58 51 49 44 50 54 58 51 33 58 58 58 48 41 58 58 51 58 58 42 51 25 58 58 51 53 58 32 49 50 58 50 58 58 53 53 37 58 53 32 54 53 39 51 58 58 58 54 50 51 50 40 58 50 51 58 58 58 49 54 58 44 52 54 54 50 40 54 53 53 51 35 54 45 54 49 40 54 54 54 54 51 32 51 54 44 50 52 54 49 54 53 53 39 54 50 29 52 52 42 50 52 51 19 54 49 54 39 52 47 40 42 46 44 52 53 31 42 54 54 45 33 38 54 45 52 53 38 52 54 49 37 32 42 52 52 40 53 42 31 36 31 40 30 37 32 52 47 32 26 53 40 34 52 33 53 52 32 41 52 53 53 31 31 25 46 40 33 31 33 47 37 31 42 30 41 32 51 32 33 27 32 51 51 30 31 51 42 31 51 31 35 43 32 31 24 35 38 51 45 31 31 31 33 31 42 31 43 28 32 35 38 31 31 27 42 32 36 31 38 42 30 30 30 32 14 19 41 23 24 31 31 38 43 27 31 37 32 41 9 43 33 17 42 25 21 31 39 14 41 24 33 32 25 26 6 31 26 31 31 31 31 31 31 31 26 23 37 31 30 30 23 39 29 37 27 29 31 31 31 31 30 31 34 34 22 29 17 48 44 21 35 44 30 38 15 21 25 43 43 29 14 30 24 21 43 14 8 5 7 12

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_139731142_139732192
seq2: B6Ng01-279E03.b_46_1096

seq1  GAATTCTCAGCTTTTTGCCAGGAGCCCTGGACCCTCATCATGAGACTCTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCAGCTTTTTGCCAGGAGCCCTGGACCCTCATCATGAGACTCTG  50

seq1  TGGCCATGAGGGGCTGTGGTGTTGTGATTGTTACACCATGTATCCTAGCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCCATGAGGGGCTGTGGTGTTGTGATTGTTACACCATGTATCCTAGCC  100

seq1  AGGAAATAGTCCGACCCTTGGTGGGTAGGTCTTTCCATGTCAATTGACAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAATAGTCCGACCCTTGGTGGGTAGGTCTTTCCATGTCAATTGACAA  150

seq1  TAATCAAGATAATCTCCGTGTTCAGAAGTCTGTCTTCTAGATGACTTTAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATCAAGATAATCTCCGTGTTCAGAAGTCTGTCTTCTAGATGACTTTAG  200

seq1  ATTCTGTTGAAATTAACCATCTCAGAACCTGTCACGAAAAATATGATTAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTGTTGAAATTAACCATCTCAGAACCTGTCACGAAAAATATGATTAA  250

seq1  GGAAGACACTCAGTGCAGATCTCTGGCTTCAATAGTACATACATGTACAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGACACTCAGTGCAGATCTCTGGCTTCAATAGTACATACATGTACAC  300

seq1  CTCTGTGTGTGCACACACATACATACAGGCACACAGGCATGCATTCTTTC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGTGTGTGCACACACATACATACAGGCACACAGGCATGCATTCTTTC  350

seq1  ATTCGTGCAATCACAGTGGTAGGGCTGTAGTGGGCCTGTGAGACCACACC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCGTGCAATCACAGTGGTAGGGCTGTAGTGGGCCTGTGAGACCACACC  400

seq1  AGCTCACTTACAAGTGGATAGTGTTCTTCCACGTGGGACACATGGAGGCC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCACTTACAAGTGGATAGTGTTCTTCCACGTGGGACACATGGAGGCC  450

seq1  AGAGAAGATTCAAGTCCAAGGACTCGACATGCCCTCGCTTGACACACTAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAAGATTCAAGTCCAAGGACTCGACATGCCCTCGCTTGACACACTAG  500

seq1  GAACAACCAGCAAAGGGGCAGGGACCTCACTCAGGTACTCGCCGAGAATT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACAACCAGCAAAGGGGCAGGGACCTCACTCAGGTACTCGCCGAGAATT  550

seq1  GACCTCTGCCAAGATACCAGTGGGTGTGAAAGCTCTTGCTTAGATCCTGT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCTCTGCCAAGATACCAGTGGGTGTGAAAGCTCTTGCTTAGATCCTGT  600

seq1  GGTGAAAACCCAGTCAGACAACACAAGCTGACTTTACCTTTGTGAGACCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGAAAACCCAGTCAGACAACACAAGCTGACTTTACCTTTGTGAGACCT  650

seq1  ACACCAGAGGATTGAAGGGAGCTCTCCCTGACTTTGAACCCACAGAGCTG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACCAGAGGATTGAAGGGAGCTCTCCCTGACTTTGAACCCACAGAGCTG  700

seq1  GAGAGATATCAGATAAAATTTATTGAAGCGGTTTTTGGATCAACACTTTG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGATATCAGATAAAATTTATTGAAGCGGTTTTTGGATCAACACTTTG  750

seq1  TTTTGGTGCCAGAATGAACTAACACTACTCTGGCTCTAAGGTGGAAGCAG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTGGTGCCAGAATGAACTAACACTACTCTGGCTCTAAGGTGGAAGCAG  800

seq1  CCTGTTGATGAATCAGTATGCGTGTACTGCCTCAGTCCTGAAACTTTAAT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTTGATGAATCAGTATGCGTGTACTGCCTCAGTCCTGAAACTTTAAT  850

seq1  AGTTCCTGTCAAGTTGAACAGTCCTGTTAGGGTCATAGCTTGCATGTCAA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCCTGTCAAGTTGAACAGTCCTGTTAGGGTCATAGCTTGCATGTCAA  900

seq1  CCCTGCGTGTGTGTGCGTGCGCGAGTGTGCATGTGTGTGTGTGTATGAAT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGCGTGTGTGTGCGTGCGCGAGTGTGCATGTGTGTGTGTGTATGAAT  950

seq1  GTGTGAGAGCAGGTACTCATGCATGTGTTGTGTGTATGTGTGTAGATACA  1000
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  GTGTGAGAGCA-GTACTCATGCATGTGTTGTGTGTATGTGTGTAGATACA  999

seq1  CAGATGTGTGTGTGTGTGCAGGTACA-CATGCAT-CTGGTGTGTGTGTGT  1048
      |||||||||||||||||||||||||| ||||| | |||||||| ||||||
seq2  CAGATGTGTGTGTGTGTGCAGGTACACCATGCCTCCTGGTGTG-GTGTGT  1048

seq1  GTG  1051
      |||
seq2  GTG  1051

seq1: chr4_139851453_139852318
seq2: B6Ng01-279E03.g_65_930 (reverse)

seq1  CCTGCCCACACCCCACTCCCACCCTCAGCAAGTCCAGACCTCACACTGCA  50
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGCCCACACCCCACTCCCACCCTCAGCAAGTCCAGACCTCACACTGCA  50

seq1  CAGTGGTCTTCTCTCATCCTTCCAGGAGAGATGGGACAGGCCATCTCCAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGGTCTTCTCTCATCCTTCCAGGAGAGATGGGACAGGCCATCTCCAA  100

seq1  TTACACATGACAAAGGAACACTCGGGAAAGTGTTTGGAGACACTGGGATC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACACATGACAAAGGAACACTCGGGAAAGTGTTTGGAGACACTGGGATC  150

seq1  CCCACAGCAACCTCCATCCAAGCCACAGTACCAGCAACCGTTTCTGGCGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCACAGCAACCTCCATCCAAGCCACAGTACCAGCAACCGTTTCTGGCGG  200

seq1  TGCACCCCTCATGCTGGCTACACACTTGCTTCCCTGGCTTGGACCTGGGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCACCCCTCATGCTGGCTACACACTTGCTTCCCTGGCTTGGACCTGGGT  250

seq1  TTACCCAGCCTGCGGGGGTGGCTTCGAAGCTTAGCCTTTCTCTGCTCCTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACCCAGCCTGCGGGGGTGGCTTCGAAGCTTAGCCTTTCTCTGCTCCTT  300

seq1  CCCTAAAGGACATTGCTGCATTTATTGCGCTTTTTTTTCCTTTTCATCTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTAAAGGACATTGCTGCATTTATTGCGCTTTTTTTTCCTTTTCATCTT  350

seq1  TGTTTTATGAGGACTACTTTATGACCAGAGATTTTTTTTTTGCTGTCTGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTTATGAGGACTACTTTATGACCAGAGATTTTTTTTTTGCTGTCTGC  400

seq1  AGCAGCCCTACAAGCAGTGGACCTTATGTTTATGAGAACTTCCCAGAGAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGCCCTACAAGCAGTGGACCTTATGTTTATGAGAACTTCCCAGAGAG  450

seq1  CTTAGGAGCTTCTACGGATCTCCCTGCTGGCCCACCCCAGTCCAGATCGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGGAGCTTCTACGGATCTCCCTGCTGGCCCACCCCAGTCCAGATCGG  500

seq1  CCCCTTTTAAGTCTCCCTGGATGAAGAGACCAATCCCATGTAATGATGTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCTTTTAAGTCTCCCTGGATGAAGAGACCAATCCCATGTAATGATGTG  550

seq1  TGCTTCTCTCCTTATTCTCTGTTGTTATTGCCTACCCTGAAGAGCCATGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTTCTCTCCTTATTCTCTGTTGTTATTGCCTACCCTGAAGAGCCATGA  600

seq1  GGGCTCACACCCTGTGCAAAGCCAGTCTACAAAATGCAGCGTCCCCGTTA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCTCACACCCTGTGCAAAGCCAGTCTACAAAATGCAGCGTCCCCGTTA  650

seq1  TCCAGGATGGACTTGGTCCAAGATCCCCAATGAGAGGACAAACTGTGGGT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGGATGGACTTGGTCCAAGATCCCCAATGAGAGGACAAACTGTGGGT  700

seq1  AGTGGTGGGCTTCATTTATACTGTTTATTCTTATTGAGCTGCAGTGTGAA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGGTGGGCTTCATTTATACTGTTTATTCTTATTGAGCTGCAGTGTGAA  750

seq1  CCAGAATTAACTTGACCCTTTGTGTGTTAGGTCCCAGCGTCACCTTTCTG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGAATTAACTTGACCCTTTGTGTGTTAGGTCCCAGCGTCACCTTTCTG  800

seq1  TCCCCTATTTGCAGTTGGAGCCATTACTTAATAAAACACGTATCCTTTGA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCTATTTGCAGTTGGAGCCATTACTTAATAAAACACGTATCCTTTGA  850

seq1  ACTTAGCATGGAATTC  866
      ||||||||||||||||
seq2  ACTTAGCATGGAATTC  866

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information