MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-279H21
Chromosome	4 (Build37)
Map Location	143,588,021 - 143,589,192
singlet/doublet	singlet
Overlap gene	none
Upstream gene	6330411D24Rik, Prdm2, LOC666018, EG626575, LOC433776, Pdpn, Lrrc38, LOC621961, Pramel1, 4732496O08Rik, Oog4, LOC666015, LOC626700, OTTMUSG00000010207, LOC100040854, LOC100040861, BC080695, LOC666049, LOC279185, LOC277668, LOC100040924, OTTMUSG00000010333, LOC277666, OTTMUSG00000010009, OTTMUSG00000010328, OTTMUSG00000010433, LOC195555, LOC194224, LOC626889, LOC329984, LOC626922, LOC626943
Downstream gene	LOC100041127, LOC436146, Pramel4, LOC100041077, LOC100041144, Oog3, Oog2, C87977, Pramel5, LOC666150, LOC626995, OTTMUSG00000010537, EG627009, Pramef12, D530049N12Rik, 1700012P22Rik, Aadacl3, 9430007A20Rik, LOC100041232, LOC666194, LOC627085, LOC666215, LOC435815, Gm436, LOC546849, Gm438, LOC666242, LOC676844, Dhrs3, Vps13d
Link	Open Mouse BAC browser

Click to get alignment info.

name	6330411D24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70725 MGI:1917975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Prdm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110593 MGI:107628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666018 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	EG626575 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626575 MGI:3646960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC433776 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 850 ESTs, 2 Proteins

name	Pdpn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14726 MGI:103098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc38 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242735 MGI:2442845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 12 ESTs, 4 Proteins

name	LOC621961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 129 ESTs, 7 Proteins pseudo : _no_value

name	Pramel1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83491 MGI:1890541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4732496O08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242736 MGI:2140473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oog4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242737 MGI:2684051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666015 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666015
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC626700 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins pseudo : _no_value

name	OTTMUSG00000010207 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545693 MGI:3649690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040854 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 12 ESTs, 54 Proteins

name	LOC100040861 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 12 ESTs, 55 Proteins

name	BC080695 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329986 MGI:3525148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666049 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666049
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins pseudo : _no_value

name	LOC279185 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:279185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 37 Proteins

name	LOC277668 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:277668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 ESTs, 28 Proteins

name	LOC100040924 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs

name	OTTMUSG00000010333 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277667 MGI:3649972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 36 Proteins

name	LOC277666 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:277666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 45 Proteins

name	OTTMUSG00000010009 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194227 MGI:3650478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000010328 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381569 MGI:3650237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000010433 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194225 MGI:3650203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC195555 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:195555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 41 Proteins

name	LOC194224 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:194224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC626889 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC329984 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:329984
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 12 ESTs, 50 Proteins

name	LOC626922 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 9 ESTs, 55 Proteins

name	LOC626943 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 Proteins

name	LOC100041127 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	LOC436146 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436146
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Pramel4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:347710 MGI:2156377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041077 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 138 ESTs, 43 Proteins

name	LOC100041144 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Oog3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100012 MGI:2684047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oog2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381570 MGI:2684035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C87977 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97187 MGI:2140708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 199 ESTs, 48 Proteins

name	Pramel5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384077 MGI:2156389
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 116 ESTs, 39 Proteins

name	LOC666150 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC626995 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 50 Proteins

name	OTTMUSG00000010537 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433779 MGI:3651680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627009 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627009 MGI:3643657
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 Proteins

name	Pramef12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77632 MGI:1924882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D530049N12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78723 MGI:1925973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	1700012P22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69364 MGI:1916614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 7 ESTs, 2 Proteins

name	Aadacl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230883 MGI:2685281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	9430007A20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381572 MGI:2685880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041232 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 ESTs, 11 Proteins pseudo : _no_value

name	LOC666194 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 94 ESTs, 2 Proteins pseudo : _no_value

name	LOC627085 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	LOC666215 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 176 ESTs, 6 Proteins

name	LOC435815 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm436 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230890 MGI:2685282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC546849 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546849
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins

name	Gm438 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329993 MGI:2685284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 9 Proteins

name	LOC666242 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC676844 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676844
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Dhrs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20148 MGI:1315215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps13d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230895 MGI:2448530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 88 ESTs, 2 Proteins

name	Prdm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486860 GeneID:110593 MGI:107628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PR domain containing 2, with ZNF domain transcript_id : NM_001081355.1

name	EG626575 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253249 GeneID:626575 MGI:3646960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG626575 transcript_id : XM_899431.3

name	LOC433776 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253257 GeneID:433776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 850 ESTs, 2 Proteins product : similar to Eukaryotic translation elongation factor 2 transcript_id : XM_001475562.1

name	Pdpn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113462004 GeneID:14726 MGI:103098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : podoplanin transcript_id : NM_010329.2

name	Lrrc38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372710 GeneID:242735 MGI:2442845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 12 ESTs, 4 Proteins product : leucine rich repeat containing 38 transcript_id : XM_144076.5

name	Pramel1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878196 GeneID:83491 MGI:1890541
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : preferentially expressed antigen in melanoma-like 1 transcript_id : NM_031377.1

name	4732496O08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375940 GeneID:242736 MGI:2140473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732496O08 gene transcript_id : NM_172877.2

name	Oog4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30424638 GeneID:242737 MGI:2684051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oogenesin 4 transcript_id : NM_173773.1

name	OTTMUSG00000010207 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131175 GeneID:545693 MGI:3649690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000010207 transcript_id : NM_001039595.2

name	LOC100040854 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253251 GeneID:100040854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 12 ESTs, 54 Proteins product : similar to Predicted gene, OTTMUSG00000010207 transcript_id : XM_001476396.1

name	LOC100040861 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253253 GeneID:100040861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 12 ESTs, 55 Proteins product : similar to Predicted gene, OTTMUSG00000010207 transcript_id : XM_001476412.1

name	BC080695 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371044 GeneID:329986 MGI:3525148
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC080695 transcript_id : NM_001007579.2

name	LOC279185 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253261 GeneID:279185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 37 Proteins product : hypothetical LOC279185 transcript_id : XM_205435.7

name	LOC277668 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372716 GeneID:277668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 28 Proteins product : similar to Predicted gene, OTTMUSG00000010433 transcript_id : XM_204040.4

name	LOC100040924 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253255 GeneID:100040924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs product : similar to Rab6 protein transcript_id : XM_001476459.1

name	LOC277666 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253264 GeneID:277666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 45 Proteins product : novel protein similar to preferentially expressed antigen in melanoma-like family (Pramel) transcript_id : XM_205433.5

name	OTTMUSG00000010009 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55741546 GeneID:194227 MGI:3650478
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000010009 transcript_id : NM_001007077.1

name	OTTMUSG00000010328 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802069 GeneID:381569 MGI:3650237
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000010328 transcript_id : NM_001005371.2

name	OTTMUSG00000010433 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248521 GeneID:194225 MGI:3650203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000010433 transcript_id : NM_177571.3

name	LOC195555 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253267 GeneID:195555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 41 Proteins product : novel protein similar to preferentially expressed antigen in melanoma-like family (Pramel) transcript_id : XM_112266.7

name	LOC329984 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253259 GeneID:329984
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 50 Proteins product : hypothetical LOC329984 transcript_id : XM_285846.7

name	LOC626922 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253269 GeneID:626922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 9 ESTs, 55 Proteins product : novel protein similar to the preferentially expressed antigen in melanoma like (Pramel) family transcript_id : XM_891538.3

name	LOC626943 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82895671 GeneID:626943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 Proteins product : novel protein similar to the preferentially expressed antigen in melanoma like (Pramel) family transcript_id : XM_891565.1

name	LOC100041127 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253275 GeneID:100041127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : similar to pol protein transcript_id : XM_001475845.1

name	Pramel4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373617 GeneID:347710 MGI:2156377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : preferentially expressed antigen in melanoma like 4 transcript_id : NM_001001319.3

name	LOC100041077 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253265 GeneID:100041077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 138 ESTs, 43 Proteins product : similar to preferentially expressed antigen in melanoma like 4 transcript_id : XM_001476560.1

name	LOC100041144 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253277 GeneID:100041144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : similar to pol protein transcript_id : XM_001475876.1

name	Oog3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41054937 GeneID:100012 MGI:2684047
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oogenesin 3 transcript_id : NM_201258.1

name	Oog2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802198 GeneID:381570 MGI:2684035
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oogenesin 2 transcript_id : NM_198661.2

name	C87977 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253273 GeneID:97187 MGI:2140708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 95 ESTs product : expressed sequence C87977, transcript variant 2 transcript_id : XM_001476630.1

name	C87977 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253271 GeneID:97187 MGI:2140708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 192 ESTs, 48 Proteins product : expressed sequence C87977, transcript variant 1 transcript_id : XM_001476610.1

name	Pramel5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253279 GeneID:384077 MGI:2156389
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 116 ESTs, 39 Proteins product : preferentially expressed antigen in melanoma like 5, transcript variant 3 transcript_id : XM_987884.2

name	LOC626995 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82895679 GeneID:626995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 50 Proteins product : novel protein similar to the preferentially expressed antigen in melanoma like (Pramel) family transcript_id : XM_891619.1

name	OTTMUSG00000010537 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113461987 GeneID:433779 MGI:3651680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000010537 transcript_id : NM_001034101.2

name	EG627009 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82895681 GeneID:627009 MGI:3643657
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 Proteins product : predicted gene, EG627009 transcript_id : XM_891640.1

name	Pramef12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377452 GeneID:77632 MGI:1924882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PRAME family member 12 transcript_id : NM_029948.2

name	D530049N12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253281 GeneID:78723 MGI:1925973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA D530049N12 gene transcript_id : XM_001476737.1

name	1700012P22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372727 GeneID:69364 MGI:1916614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 7 ESTs, 2 Proteins product : RIKEN cDNA 1700012P22 gene transcript_id : XM_131817.3

name	Aadacl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20849382 GeneID:230883 MGI:2685281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : arylacetamide deacetylase-like 3 transcript_id : XM_144109.1

name	9430007A20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376265 GeneID:381572 MGI:2685880
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9430007A20 gene transcript_id : NM_198662.2

name	LOC627085 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82895690 GeneID:627085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : similar to arylacetamide deacetylase transcript_id : XM_891737.1

name	LOC666215 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253286 GeneID:666215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 176 ESTs, 6 Proteins product : similar to Microspherule protein 1 transcript_id : XM_982352.2

name	LOC435815 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:124486966 GeneID:435815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : similar to arylacetamide deacetylase transcript_id : NM_001081248.1

name	Gm436 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63517497 GeneID:230890 MGI:2685282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : gene model 436, (NCBI) transcript_id : XM_144113.4

name	LOC546849 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:63517501 GeneID:546849
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins product : similar to arylacetamide deacetylase transcript_id : XM_621645.1

name	Gm438 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372737 GeneID:329993 MGI:2685284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 9 Proteins product : gene model 438, (NCBI) transcript_id : XM_144115.6

name	Dhrs3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370009 GeneID:20148 MGI:1315215
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dehydrogenase/reductase (SDR family) member 3 transcript_id : NM_011303.3

name	Vps13d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253287 GeneID:230895 MGI:2448530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 88 ESTs, 2 Proteins product : vacuolar protein sorting 13 D (yeast) transcript_id : XM_001476900.1

name	Prdm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486861 GeneID:110593 MGI:107628
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : PR domain containing 2, with ZNF domain protein_id : NP_001074824.1

name	EG626575 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82895635 GeneID:626575 MGI:3646960
definition	codon_start : 1 product : hypothetical protein protein_id : XP_904524.1

name	LOC433776 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253258 GeneID:433776
definition	codon_start : 1 product : similar to Eukaryotic translation elongation factor 2 protein_id : XP_001475612.1

name	Pdpn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113462005 GeneID:14726 MGI:103098
definition	GO_component : GO:0030175 - filopodium [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IDA]; GO:0008517 - folic acid transporter activity [Evidence IDA]; GO:0015250 - water channel activity [Evidence IDA]; GO:0005372 - water transporter activity [Evidence IDA] GO_process : GO:0006865 - amino acid transport [Evidence IDA]; GO:0007155 - cell adhesion [Evidence ISS]; GO:0007275 - development [Evidence IEA]; GO:0015884 - folic acid transport [Evidence IDA]; GO:0030324 - lung development [Evidence IMP]; GO:0001946 - lymphangiogenesis [Evidence IMP]; GO:0030335 - positive regulation of cell migration [Evidence ISS]; GO:0051272 - positive regulation of cell motility [Evidence IDA]; GO:0008360 - regulation of cell shape [Evidence IEA]; GO:0035239 - tube morphogenesis [Evidence ISS]; GO:0006833 - water transport [Evidence IDA] codon_start : 1 note : Aggrus; glycoprotein 38 product : podoplanin protein_id : NP_034459.2

name	Lrrc38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38078948 GeneID:242735 MGI:2442845
definition	codon_start : 1 product : similar to Lrrc38 protein protein_id : XP_144076.2

name	Pramel1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878197 CCDS:CCDS18888.1 GeneID:83491 MGI:1890541
definition	codon_start : 1 product : preferentially expressed antigen in melanoma-like 1 protein_id : NP_113554.1

name	Oog4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424639 CCDS:CCDS18890.1 GeneID:242737 MGI:2684051
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : oogenesin 4 protein_id : NP_776134.1

name	OTTMUSG00000010207 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88853565 CCDS:CCDS18891.1 GeneID:545693 MGI:3649690
definition	codon_start : 1 note : novel protein similar to the preferentially expressed antigen in melanoma like (Pramel) family product : hypothetical protein LOC545693 protein_id : NP_001034684.1

name	LOC100040854 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253252 GeneID:100040854
definition	codon_start : 1 product : similar to Predicted gene, OTTMUSG00000010207 protein_id : XP_001476446.1

name	LOC100040861 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253254 GeneID:100040861
definition	codon_start : 1 product : similar to Predicted gene, OTTMUSG00000010207 protein_id : XP_001476462.1

name	BC080695 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56090469 GeneID:329986 MGI:3525148
definition	codon_start : 1 note : novel protein similar to the preferentially expressed antigen in melanoma like (Pramel) family product : hypothetical protein LOC329986 protein_id : NP_001007580.1

name	LOC279185 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253262 GeneID:279185
definition	codon_start : 1 product : hypothetical protein protein_id : XP_205435.5

name	LOC277668 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:28498570 GeneID:277668
definition	codon_start : 1 product : similar to Predicted gene, OTTMUSG00000010433 protein_id : XP_204040.2

name	LOC100040924 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253256 GeneID:100040924
definition	codon_start : 1 product : similar to Rab6 protein protein_id : XP_001476509.1

name	LOC277666 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895655 GeneID:277666
definition	codon_start : 1 product : hypothetical protein LOC277666 protein_id : XP_205433.4

name	OTTMUSG00000010009 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55741547 CCDS:CCDS18894.1 GeneID:194227 MGI:3650478
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC194227 protein_id : NP_001007078.1

name	OTTMUSG00000010328 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52851398 GeneID:381569 MGI:3650237
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC381569 protein_id : NP_001005371.1

name	OTTMUSG00000010433 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248522 GeneID:194225 MGI:3650203
definition	codon_start : 1 note : novel protein similar to oogenesin 3 (Oog3) product : hypothetical protein LOC194225 protein_id : NP_808239.2

name	LOC195555 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253268 GeneID:195555
definition	codon_start : 1 product : hypothetical protein LOC195555 protein_id : XP_112266.5

name	LOC329984 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895664 GeneID:329984
definition	codon_start : 1 product : hypothetical protein protein_id : XP_285846.5

name	LOC626922 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253270 GeneID:626922
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896631.3

name	LOC626943 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895672 GeneID:626943
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896658.1

name	LOC100041127 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253276 GeneID:100041127
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001475895.1

name	Pramel4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75812918 CCDS:CCDS18900.1 GeneID:347710 MGI:2156377
definition	codon_start : 1 product : preferentially expressed antigen in melanoma like 4 protein_id : NP_001001319.2

name	LOC100041077 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253266 GeneID:100041077
definition	codon_start : 1 product : similar to preferentially expressed antigen in melanoma like 4 protein_id : XP_001476610.1

name	LOC100041144 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253278 GeneID:100041144
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001475926.1

name	Oog3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41054938 GeneID:100012 MGI:2684047
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : oogenesin 3 protein_id : NP_957710.1

name	Oog2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348556 CCDS:CCDS18901.1 GeneID:381570 MGI:2684035
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : oogenesin 2 protein_id : NP_941063.1

name	C87977 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253272 GeneID:97187 MGI:2140708
definition	codon_start : 1 product : hypothetical protein LOC97187 isoform 1 protein_id : XP_001476660.1

name	C87977 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253274 GeneID:97187 MGI:2140708
definition	codon_start : 1 product : hypothetical protein LOC97187 isoform 2 protein_id : XP_001476680.1

name	Pramel5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253280 GeneID:384077 MGI:2156389
definition	codon_start : 1 product : preferentially expressed antigen in melanoma like 5 isoform 3 protein_id : XP_992978.2

name	LOC626995 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895680 GeneID:626995
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896712.1

name	OTTMUSG00000010537 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113461988 CCDS:CCDS18904.1 GeneID:433779 MGI:3651680
definition	codon_start : 1 product : hypothetical protein LOC433779 protein_id : NP_001029273.2

name	EG627009 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82895682 GeneID:627009 MGI:3643657
definition	codon_start : 1 product : similar to hCG2042963 protein_id : XP_896733.1

name	Pramef12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313388 CCDS:CCDS18905.1 GeneID:77632 MGI:1924882
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : novel protein similar to the preferentially expressed antigen in melanoma like (Pramel) family product : PRAME family member 12 protein_id : NP_084224.1

name	D530049N12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253282 GeneID:78723 MGI:1925973
definition	codon_start : 1 product : hypothetical protein LOC78723 protein_id : XP_001476787.1

name	1700012P22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253283 GeneID:69364 MGI:1916614
definition	codon_start : 1 product : hypothetical protein LOC69364 protein_id : XP_131817.2

name	Aadacl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20849383 GeneID:230883 MGI:2685281
definition	codon_start : 1 product : similar to gene model 435 protein_id : XP_144109.1

name	9430007A20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348558 GeneID:381572 MGI:2685880
definition	codon_start : 1 exception : unclassified translation discrepancy product : similar to arylacetamide deacetylase (esterase) protein_id : NP_941064.1

name	LOC627085 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895691 GeneID:627085
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896830.1

name	LOC666215 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94372736 GeneID:666215
definition	codon_start : 1 product : similar to Microspherule protein 1 protein_id : XP_987446.1

name	LOC435815 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:124486967 GeneID:435815
definition	codon_start : 1 product : similar to arylacetamide deacetylase protein_id : NP_001074717.1

name	Gm436 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63517498 GeneID:230890 MGI:2685282
definition	codon_start : 1 product : hypothetical protein protein_id : XP_144113.4

name	LOC546849 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:63517502 GeneID:546849
definition	codon_start : 1 product : hypothetical protein protein_id : XP_621645.1

name	Gm438 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82895698 GeneID:329993 MGI:2685284
definition	codon_start : 1 product : hypothetical protein protein_id : XP_144115.5

name	Dhrs3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755380 CCDS:CCDS18912.1 GeneID:20148 MGI:1315215
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : retinal short-chain dehydrogenase/reductase 1 product : dehydrogenase/reductase (SDR family) member 3 protein_id : NP_035433.1

name	Vps13d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253288 GeneID:230895 MGI:2448530
definition	codon_start : 1 product : vacuolar protein sorting 13D protein_id : XP_001476950.1

name	LOC666018 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666018
definition	number : 1 pseudo : _no_value

name	LOC666015 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666015
definition	number : 4 pseudo : _no_value

name	LOC666015 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666015
definition	number : 3 pseudo : _no_value

name	LOC666015 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666015
definition	number : 2 pseudo : _no_value

name	LOC666015 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666015
definition	number : 1 pseudo : _no_value

name	LOC626700 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626700
definition	number : 1 pseudo : _no_value

name	LOC626700 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626700
definition	number : 2 pseudo : _no_value

name	LOC626700 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626700
definition	number : 3 pseudo : _no_value

name	LOC194224 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194224
definition	number : 1 pseudo : _no_value

name	LOC194224 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194224
definition	number : 2 pseudo : _no_value

name	LOC194224 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194224
definition	number : 3 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 7 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 6 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 5 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 4 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 3 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 2 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 1 pseudo : _no_value

name	LOC436146 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436146
definition	number : 1 pseudo : _no_value

name	LOC666150 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666150
definition	number : 1 pseudo : _no_value

name	LOC666242 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666242
definition	number : 1 pseudo : _no_value

name	LOC666242 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666242
definition	number : 2 pseudo : _no_value

name	LOC676844 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676844
definition	number : 2 pseudo : _no_value

name	LOC676844 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676844
definition	number : 1 pseudo : _no_value

name	6330411D24Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94372712 GeneID:70725 MGI:1917975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 6330411D24 gene, transcript variant 2 transcript_id : XR_002341.1

name	LOC621961 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253250 GeneID:621961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 129 ESTs, 7 Proteins product : similar to Anp32b protein pseudo : _no_value transcript_id : XR_032654.1

name	LOC666049 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253260 GeneID:666049
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : hypothetical LOC666049 pseudo : _no_value transcript_id : XR_032359.1

name	OTTMUSG00000010333 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149253263 GeneID:277667 MGI:3649972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 36 Proteins product : predicted gene, OTTMUSG00000010333 transcript_id : XR_032378.1

name	LOC100041232 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253284 GeneID:100041232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 ESTs, 11 Proteins product : similar to high-mobility group box 1 pseudo : _no_value transcript_id : XR_032919.1

name	LOC666194 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253285 GeneID:666194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 94 ESTs, 2 Proteins product : similar to Integrator complex subunit 5 pseudo : _no_value transcript_id : XR_032523.1

clone name	MSMg01-155D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367O20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-347J12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-482E15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-078J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379J04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-356E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-372M17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-326G21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-532E23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-413I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-419E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060I21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-068M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-104M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-178P21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-102M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-104M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-111D21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-142I23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-384D18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-436L12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-375N17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-305C12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-508O13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-158J12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-198N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471N10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-089O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346G09
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-279H21.b	B6Ng01-279H21.g
ACC	GA079459	GA079460
length	1,176	1,140
definition	B6Ng01-279H21.b	B6Ng01-279H21.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcaatgcaaaaatactcaataaaattctcactaaacaaatctaaga acacattaaaacaatcatccatcctgaccaagtaggttttattccaggga tgtggggatggtttatatacggaaatcaatcaccgtaatccattatataa acaaactcaaagacaaaaaccacatgatcacctcgttagacgcagggaaa gcatttgacaaaatccaacacccaatcatgataaaagtcttggaaagatt aggaatgtaaggtccatacctaaacatgatcaaagcaatctacagccaac cagtaaccaacatcaaataaatggagagaagctggaagcaattccactaa aatgagggactagataagactgcccactttctccctacctattcaataga gtacttgaagtcctagccagaggaattcgacaacaaaaggagatcaaggg gatccaaattggaaaagaagaagtcaaaatgtcactttttgcggataata tgcgagtatatataagtgaccctaaaaattcaaccagagaactcctaaac cagataaacagcttcagcacagtagctggataaaaaattaactcaaacat atcaatggcctttctctacacaaaggataaacaggatgagaaataaatta ggaaaacaaaacccttcgcaatagtcacaaataatataaaatacgtcgat gtgactctaacaaaggaagtgaaagatctgtatgataagaatttcaagtc tctgaagaaagaaatcaaagatctcagaagatgggaagatctcccatgct catggaatggcaggatcaatatagtaaaaacgtctatctttccaaaagca atctacagattcaatgcagtacccatcaaaattccaactcaattcttcaa caaattagaaagggaaatttgcaaattcatctgggaataacaaaaaacct agatagcaaaaactcttctcaatgataaaagaacttctggtggatcacca tgcctgacataaagctgtactacagagtcattgggaaaaactgcatgcta cagtatagcgacggacagtagaccattgatagatggagaccagaaatgaa cacacacatctatgttcacttgacctttgactgtaagctaatctccgaag tactaagacagcattttccaaaaatg	gaattcactttgtagaccaggctggactcaaactcagaaatccgcctgcc tctgcctctgaagccatgattttttttaaatctatttacttatttactta tttgggaggacagtcatgggagacagacattgaggcgggagaagatccag gggagctttttccaagcatgtgggttcctgtaaatgaacttagatagtta ggcttaatgtcaacaccatttccaattgtgccttttcacaagatacatgg ctccctggttaaatgaaaaaattagttattttgttttgtttttaagtttg agacagaataccattgtgatgcacagtggctgggtgacacttgcctgtgt agattcagagattcttttgctcctgcctcccaagtgttaaaatttaaggc atgaaccactataccctgctcactactcagtcacaatttcctcttttttg gccagtacccaggctgattctttctccgacactgacactaccctttaggg caccaaggacagcttctccctcagtgcccactttctttgttttggtttgg atttacatgagattagaaaaaatgatggcgtgactggagaagtggctcag cggttaagagcacagactgctcttccaaaggttctgagttcaaatcccag caaccacatggtgactcacaaccacctgtaatgagatctgatgccctctt ctggtgcatctgaagacagctacagtgtacttaaataaaataataaatga atcgaaagaaagaagaaagaagaaagaagaagaagaaagaaagaagaaag aagaagaaagaagaagaagaagaaagaaagaaagaagatggattggtgtt attagctcaagctgtcctcaatcttgctgtgtagctcaagactttgaatg gacctgtctggcatcctccagctctgccttctcaaactatcacagctgat gactgacagagcatcagctcagcttgatgagactcaaaacacatcacaag tgtggaaatattaacctcagttatttttctaaggtttcctaattgttttt ctttgagaacaggcttctctgtatagcctggctgtcctggaactcacttg agaacaggctgactcgaactcgagaatccgcctgtcctct
quality values	Open. Hide. 34 31 22 32 58 34 34 47 62 62 47 52 56 62 62 43 43 62 62 62 47 62 62 62 62 62 62 62 47 62 62 62 59 59 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 59 62 54 59 62 62 59 62 62 62 62 62 62 54 62 62 62 62 59 59 62 62 59 54 59 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 42 42 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 52 54 58 58 58 58 58 58 58 58 58 58 54 58 54 58 58 58 58 58 58 58 58 45 45 58 58 58 49 58 58 58 58 52 58 54 41 54 43 45 41 54 58 48 58 58 48 58 58 58 54 58 58 51 51 49 51 58 58 53 50 58 58 58 51 58 58 58 58 58 53 51 58 54 51 58 54 58 58 49 58 58 58 58 44 50 54 58 58 58 58 53 49 58 41 58 58 58 54 53 54 58 58 52 51 52 58 58 50 58 58 58 58 34 39 50 54 58 50 51 52 58 52 51 52 53 39 58 49 41 58 39 32 58 58 49 58 50 51 58 39 41 58 58 39 58 58 50 40 40 58 50 47 50 58 33 54 58 58 58 58 44 41 39 58 50 51 41 38 44 44 44 42 38 35 42 52 47 49 53 53 40 50 37 54 44 44 41 51 53 52 51 40 54 54 51 53 52 51 44 51 39 49 39 29 54 54 53 37 29 49 52 53 35 51 44 37 54 32 32 52 42 46 40 53 47 51 54 42 39 35 32 40 53 54 39 42 42 45 41 26 37 42 40 44 32 27 53 52 33 18 31 52 53 39 53 52 45 45 52 53 32 51 52 52 52 53 52 46 45 40 31 46 40 33 31 32 32 52 39 37 45 53 42 31 37 30 31 47 33 30 51 43 31 31 31 27 18 40 31 24 29 33 42 37 31 31 31 46 32 32 32 29 33 46 30 31 20 51 31 31 31 26 31 41 32 43 38 34 31 31 48 47 41 21 25 25 31 36 31 30 31 31 42 47 30 24 37 20 40 40 33 29 43 22 25 31 42 30 30 31 27 29 37 36 30 27 22 20 25 39 28 33 33 24 31 30 41 25 23 38 34 34 48 46 27 37 37 27 29 13 32 30 39 31 24 18 27 32 38 31 33 31 20 19 16 29 48 31 26 31 29 14 31 44 10 12 41 23 9 41 24 21 47 31 21 18 18 41 27 29 31 35 31 31 31 21 17 43 9 26 18 24 12 18 32 19 37 48 48 36 22 7 11 25 32 8 32 4 19 27 29 28 34 43 43 27 19 12 11 13 29 20 23 32 15 21 19 22 20 14 23 47 48 32 27 16 21 15 21 14 28 16 20 18 11 9 9 4 3 9 16 15 27 13 13 14 14 8 13 22 21 14 15 23 9 38 27 20 18 28 26 26 17 21 20 20 19 7 12 14 12 20 28 15 19 11 18 47 17 8 32 47 47 18 22 24 24 21 13 13 3 3 3 10 21 6 18 14 13 20 20 20 23 18 11 7 5 5 23 9 13 8 7 7 8 12 7 9 3 3 5 2 3 2 5 10 3 3 3 6 22 7 11 14 15 6 6 14 29 16 4 4 7 4 11 3 8 7 9 4 14 4 6 10 5 7 13 15 3 5 18 7 6 8 6 6 8 8 5 4 7 13 7 7 2 1 3 2 2 8 10 16 5 3 9 4 14 3 2 7 4 6 6 2 1 2 1 3 5 2 5 5 4 4 7 12 7 24 28 28 25 7 7 22 28 26 13 3 2 2	Open. Hide. 62 47 42 42 62 45 44 47 62 62 62 62 47 62 62 59 47 59 59 62 62 62 62 62 62 59 59 62 59 46 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 59 54 42 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 39 62 62 28 34 46 56 43 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 45 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 49 49 54 54 58 58 54 58 46 46 58 58 45 54 54 58 58 58 54 45 58 49 54 48 58 37 54 58 54 58 58 58 49 58 58 58 58 58 54 54 58 54 58 58 58 49 52 58 58 58 58 58 58 58 58 58 52 58 58 54 58 58 54 58 52 58 58 54 42 58 54 52 51 52 58 58 58 41 46 38 49 54 52 58 58 58 58 58 54 47 58 58 40 58 58 58 53 53 58 41 42 54 58 58 45 38 58 58 50 52 58 49 49 58 53 40 33 58 47 58 50 40 49 58 33 58 50 53 53 46 50 52 41 40 50 58 51 51 52 50 50 40 49 31 54 40 31 58 40 50 50 49 51 54 28 58 50 52 42 58 50 53 42 49 44 40 52 43 37 53 53 47 39 51 39 40 50 51 42 58 32 34 52 53 37 52 53 39 49 49 37 54 50 35 46 47 52 44 42 54 52 45 37 38 42 42 49 47 35 49 32 54 50 47 53 45 45 40 42 54 46 37 47 32 37 52 45 42 51 54 40 37 39 32 37 39 44 40 35 52 32 53 32 54 30 37 37 53 41 31 54 51 45 52 52 51 40 32 40 45 34 24 53 41 32 52 40 27 32 35 32 29 47 27 40 9 15 18 47 14 14 28 10 15 10 47 25 10 33 18 33 24 41 12 10 23 10 7 32 23 22 25 18 27 18 46 18 17 17 40 10 14 22 18 40 28 46 46 19 23 15 15 33 31 27 25 21 11 9 37 29 46 19 18 23 46 46 38 38 29 42 24 46 32 46 25 46 32 46 21 28 20 40 28 31 31 23 34 24 21 19 22 33 27 37 24 32 14 18 22 31 25 31 31 27 26 32 34 34 34 36 30 31 32 30 29 24 19 29 31 24 18 32 24 32 32 22 31 14 22 18 32 31 15 9 25 15 29 18 24 44 32 21 21 31 32 28 25 26 11 21 29 38 24 31 21 32 35 14 18 31 21 15 18 11 16 23 8 13 4 17 27 30 14 19 25 28 27 23 21 25 37 27 22 27 31 32 25 18 15 12 23 32 32 26 29 27 32 32 21 27 32 33 28 27 21 31 12 34 32 31 19 6 3 6 28 24 24 6 6 3 6 27 21 24 24 27 5 11 5 9 20 4 34 32 8 15 17 18 6 17 6 7 7 6 5 5 8 11 9 16 23 21 40 13 8 7 7 20 11 23 9 6 14 5 3 6 22 21 10 6 40 21 26 12 9 10 8 17 9 14 5 25 7 11 3 4 8 10 3 3 2 5 12 5 3 3 2 3 13 9 5 11 4 6 10 6 8 13 12 1 4 3 10 6 17 12 12 5 4 5 9 4 3 5 6 6 6 4 4 6 4 14 9 7 4 2 2 3 7 6 6 6 5 2 2 2 2 4 19 6 6 8 6 7 3 5 7 1 5 1 2 2 6 12 3 5 6 4 7 5 24 5 2 3 5 4 2 9 4 11 4 5 6 10 15 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_143588021_143589192
seq2: B6Ng01-279H21.g_68_1207 (reverse)

seq1  AGAGG-CAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGA  49
      ||||| ||||||||||   |||||||| | ||||||| |||   ||||||
seq2  AGAGGACAGGCGGATTCTCGAGTTCGA-GTCAGCCTGTTCT--CAAGTGA  47

seq1  GTTCCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCAAAAAAAAAA  99
      ||||||||||||||| |||||||||||||| ||   ||||    ||| ||
seq2  GTTCCAGGACAGCCA-GGCTATACAGAGAAGCCTGTTCTC----AAAGAA  92

seq1  AAAAAAATAGAGAAACCTTTAGAAAAAATAAACTGGAAGTTAATATTTCC  149
      ||| || ||| |||||| |||||||||   |||| || ||||||||||||
seq2  AAACAATTAG-GAAACC-TTAGAAAAA--TAACT-GAGGTTAATATTTCC  137

seq1  ACAACTGTGAATGTGTTTTGGAGTTCTCATCAAGGCTGAGCCTGATGCTC  199
      |||  |||| ||||||||| ||| ||||||||| |||||| |||||||||
seq2  ACACTTGTG-ATGTGTTTT-GAG-TCTCATCAA-GCTGAG-CTGATGCTC  182

seq1  TGTCAGTCATCAGCTGTGATAGTTTGAGAAGGCAGAGGCTGGAGGATGCC  249
      |||||||||||||||||||||||||||||||||||| |||||||||||||
seq2  TGTCAGTCATCAGCTGTGATAGTTTGAGAAGGCAGA-GCTGGAGGATGCC  231

seq1  AGACAGGTCCATTCAAAGTCTTGAGCTACACAGCAAGATTGAGGACAGCT  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACAGGTCCATTCAAAGTCTTGAGCTACACAGCAAGATTGAGGACAGCT  281

seq1  TGAGCTAATAAACACCAATCCATCTTTCTTTCTTTCTTTCTTTCTTTCTT  349
      ||||||||| |||||||||||||| |||||||||||||||||   |||||
seq2  TGAGCTAAT-AACACCAATCCATC-TTCTTTCTTTCTTTCTT--CTTCTT  327

seq1  TCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC  399
         |||||||||   ||||||| ||||||||||| |||||   |||||||
seq2  --CTTCTTTCTT--CTTCTTTC-TTCTTTCTTTC-TTCTT--CTTCTTTC  369

seq1  TTTCTTTCTTTCTTTCTTTCGATTCATTTATTATTTTATTTAAGTACACT  449
       ||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  -TTCTTTC-TTCTTTCTTTCGATTCATTTATTATTTTATTTAAGTACACT  417

seq1  GTAGCTGTCTTCAGATGCACCAGAAGAGGGCATCAGATCTCATTACAGGT  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGCTGTCTTCAGATGCACCAGAAGAGGGCATCAGATCTCATTACAGGT  467

seq1  GGTTGTGAGTCACCATGTGGTTGCTGGGATTTGAACTCAGAACCTTTGGA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTGTGAGTCACCATGTGGTTGCTGGGATTTGAACTCAGAACCTTTGGA  517

seq1  AGAGCAGTCTGTGCTCTTAACCGCTGAGCCACTTCTCCAGTCACGCCATC  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCAGTCTGTGCTCTTAACCGCTGAGCCACTTCTCCAGTCACGCCATC  567

seq1  ATTTTTTCTAATCTCATGTAAATCCAAACCAAAACAAAGAAAGTGGGCAC  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTTTCTAATCTCATGTAAATCCAAACCAAAACAAAGAAAGTGGGCAC  617

seq1  TGAGGGAGAAGCTGTCCTTGGTGCCCTAAAGGGTAGTGTCAGTGTCGGAG  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGGAGAAGCTGTCCTTGGTGCCCTAAAGGGTAGTGTCAGTGTCGGAG  667

seq1  AAAGAATCAGCCTGGGTACTGGCCAAAAAAGAGGAAATTGTGACTGAGTA  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGAATCAGCCTGGGTACTGGCCAAAAAAGAGGAAATTGTGACTGAGTA  717

seq1  GTGAGCAGGGTATAGTGGTTCATGCCTTAAATTTTAACACTTGGGAGGCA  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAGCAGGGTATAGTGGTTCATGCCTTAAATTTTAACACTTGGGAGGCA  767

seq1  GGAGCAAAAGAATCTCTGAATCTACACAGGCAAGTGTCACCCAGCCACTG  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGCAAAAGAATCTCTGAATCTACACAGGCAAGTGTCACCCAGCCACTG  817

seq1  TGCATCACAATGGTATTCTGTCTCAAACTTAAAAACAAAACAAAATAACT  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCATCACAATGGTATTCTGTCTCAAACTTAAAAACAAAACAAAATAACT  867

seq1  AATTTTTTCATTTAACCAGGGAGCCATGTATCTTGTGAAAAGGCACAATT  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTTTTCATTTAACCAGGGAGCCATGTATCTTGTGAAAAGGCACAATT  917

seq1  GGAAATGGTGTTGACATTAAGCCTAACTATCTAAGTTCATTTACAGGAAC  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAATGGTGTTGACATTAAGCCTAACTATCTAAGTTCATTTACAGGAAC  967

seq1  CCACATGCTTGGAAAAAGCTCCCCTGGATCTTCTCCCGCCTCAATGTCTG  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACATGCTTGGAAAAAGCTCCCCTGGATCTTCTCCCGCCTCAATGTCTG  1017

seq1  TCTCCCATGACTGTCCTCCCAAATAAGTAAATAAGTAAATAGATTTAAAA  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCCATGACTGTCCTCCCAAATAAGTAAATAAGTAAATAGATTTAAAA  1067

seq1  AAAATCATGGCTTCAGAGGCAGAGGCAGGCGGATTTCTGAGTTTGAGTCC  1149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATCATGGCTTCAGAGGCAGAGGCAGGCGGATTTCTGAGTTTGAGTCC  1117

seq1  AGCCTGGTCTACAAAGTGAATTC  1172
      |||||||||||||||||||||||
seq2  AGCCTGGTCTACAAAGTGAATTC  1140

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information