MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-281B17
Chromosome	4 (Build37)
Map Location	153,545,693 - 153,690,650
singlet/doublet	doublet
Overlap gene	Megf6, Arhgef16, Prdm16
Upstream gene	LOC100042089, Ajap1, BC039966, A430005L14Rik, Dffb, BC046331, Lrrc47, 1190007F08Rik, Ccdc27, Trp73, Wdr8, 1200015A19Rik
Downstream gene	LOC100043342, LOC100042178, Actrt2, B230396O12Rik, Mmel1, 2810405K02Rik, Tnfrsf14, Hes5, Pank4, LOC100043358, Plch2, Pex10, Rer1, Morn1, Ski, 2610002J02Rik, Prkcz
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042089 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Ajap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230959 MGI:2685419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein

name	BC039966 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407793 MGI:3039570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	A430005L14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97159 MGI:2140680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dffb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13368 MGI:1196287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC046331 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230967 MGI:2687282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc47 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72946 MGI:1920196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1190007F08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68859 MGI:1916109
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381580 MGI:2685881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trp73 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22062 MGI:1336991
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59002 MGI:1891749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1200015A19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67808 MGI:1915058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Megf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230971 MGI:1919351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 114 ESTs, 4 Proteins

name	Arhgef16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230972 MGI:2446219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 47 ESTs, 7 Proteins

name	Prdm16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70673 MGI:1917923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043342 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043342
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042178 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs

name	Actrt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73353 MGI:1920603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B230396O12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242800 MGI:2445205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mmel1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27390 MGI:1351603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810405K02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66469 MGI:1913719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230979 MGI:2675303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hes5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15208 MGI:104876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pank4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269614 MGI:2387466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043358 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Plch2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269615 MGI:2443078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pex10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668173 MGI:2684988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rer1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67830 MGI:1915080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Morn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76866 MGI:1924116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ski (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20481 MGI:98310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610002J02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67513 MGI:1914763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkcz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18762 MGI:97602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ajap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372801 GeneID:230959 MGI:2685419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein product : adherens junction associated protein 1, transcript variant 1 transcript_id : XM_485506.4

name	BC039966 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253335 GeneID:407793 MGI:3039570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : cDNA sequence BC039966 transcript_id : XM_001477621.1

name	A430005L14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802941 GeneID:97159 MGI:2140680
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A430005L14 gene transcript_id : NM_175287.3

name	Dffb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802948 GeneID:13368 MGI:1196287
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA fragmentation factor, beta subunit transcript_id : NM_007859.3

name	BC046331 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343602 GeneID:230967 MGI:2687282
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC046331 transcript_id : NM_177673.2

name	Lrrc47 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41152115 GeneID:72946 MGI:1920196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 47 transcript_id : NM_201226.1

name	Ccdc27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802895 GeneID:381580 MGI:2685881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 27 transcript_id : NM_001033455.2

name	Trp73 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375138 GeneID:22062 MGI:1336991
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformation related protein 73 transcript_id : NM_011642.2

name	Wdr8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778725 GeneID:59002 MGI:1891749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 8 transcript_id : NM_021499.2

name	1200015A19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71795665 GeneID:67808 MGI:1915058
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200015A19 gene transcript_id : NM_026388.2

name	Megf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372857 GeneID:230971 MGI:1919351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 114 ESTs, 4 Proteins product : multiple EGF-like-domains 6, transcript variant 1 transcript_id : XM_620148.3

name	Arhgef16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372806 GeneID:230972 MGI:2446219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 47 ESTs, 7 Proteins product : Rho guanine nucleotide exchange factor (GEF) 16, transcript variant 5 transcript_id : XM_902459.2

name	Prdm16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124107622 GeneID:70673 MGI:1917923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PR domain containing 16 transcript_id : NM_027504.3

name	LOC100043342 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253362 GeneID:100043342
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043342 transcript_id : XM_001480354.1

name	LOC100042178 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253337 GeneID:100042178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs product : hypothetical protein LOC100042178 transcript_id : XM_001477690.1

name	Actrt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982618 GeneID:73353 MGI:1920603
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin-related protein T2 transcript_id : NM_028513.2

name	B230396O12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098156 GeneID:242800 MGI:2445205
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B230396O12 gene transcript_id : NM_172878.2

name	Mmel1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305476 GeneID:27390 MGI:1351603
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane metallo-endopeptidase-like 1 transcript_id : NM_013783.1

name	2810405K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801670 GeneID:66469 MGI:1913719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810405K02 gene transcript_id : NM_025582.3

name	Tnfrsf14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341490 GeneID:230979 MGI:2675303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) transcript_id : NM_178931.2

name	Hes5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801760 GeneID:15208 MGI:104876
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hairy and enhancer of split 5 (Drosophila) transcript_id : NM_010419.3

name	Pank4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366380 GeneID:269614 MGI:2387466
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pantothenate kinase 4 transcript_id : NM_172990.2

name	LOC100043358 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253364 GeneID:100043358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100043358 transcript_id : XM_001480381.1

name	Plch2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583636 GeneID:269615 MGI:2443078
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase C, eta 2 transcript_id : NM_175556.3

name	Pex10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109150413 GeneID:668173 MGI:2684988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome biogenesis factor 10 transcript_id : NM_001042407.1

name	Rer1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385881 GeneID:67830 MGI:1915080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae) transcript_id : NM_026395.1

name	Morn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487377 GeneID:76866 MGI:1924116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MORN repeat containing 1 transcript_id : NM_001081100.1

name	Ski (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113205054 GeneID:20481 MGI:98310
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sloan-Kettering viral oncogene homolog transcript_id : NM_011385.2

name	2610002J02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381159 GeneID:67513 MGI:1914763
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610002J02 gene transcript_id : NM_001033134.2

name	Prkcz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872199 GeneID:18762 MGI:97602
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase C, zeta transcript_id : NM_008860.2

name	Prkcz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872204 GeneID:18762 MGI:97602
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase C, zeta transcript_id : NM_001039079.1

name	Ajap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82895973 GeneID:230959 MGI:2685419
definition	codon_start : 1 product : adherens junction associated protein 1 isoform 1 protein_id : XP_485506.3

name	BC039966 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253336 GeneID:407793 MGI:3039570
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477671.1

name	A430005L14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424952 CCDS:CCDS19003.1 GeneID:97159 MGI:2140680
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC97159 protein_id : NP_780496.1

name	Dffb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542553 CCDS:CCDS19004.1 GeneID:13368 MGI:1196287
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004516 - nicotinate phosphoribosyltransferase activity [Evidence IDA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006309 - DNA fragmentation during apoptosis [Evidence ISS] codon_start : 1 exception : mismatches in translation note : DNase inhibited by DNA fragmentation factor; DNA fragmentation factor, 40 kD, beta subunit; caspase-activated DNase product : DNA fragmentation factor, beta subunit protein_id : NP_031885.2

name	BC046331 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244100 CCDS:CCDS19005.1 GeneID:230967 MGI:2687282
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016595 - glutamate binding [Evidence ISS]; GO:0016594 - glycine binding [Evidence ISS]; GO:0016596 - thienylcyclohexylpiperidine binding [Evidence ISS] codon_start : 1 note : likely ortholog of H. sapiens glycine-, glutamate-, thienylcyclohexylpiperidine-binding protein product : glycine-, glutamate-, thienylcyclohexylpiperidine-binding protein protein_id : NP_808341.1

name	Lrrc47 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41152116 CCDS:CCDS19006.1 GeneID:72946 MGI:1920196
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : novel protein containing Leucine Rich Repeat domains product : leucine rich repeat containing 47 protein_id : NP_957678.1

name	Ccdc27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701967 CCDS:CCDS19008.1 GeneID:381580 MGI:2685881
definition	codon_start : 1 product : coiled-coil domain containing 27 protein_id : NP_001028627.1

name	Trp73 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794514 CCDS:CCDS19009.1 GeneID:22062 MGI:1336991
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence TAS]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence TAS]; GO:0030900 - forebrain development [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence IDA]; GO:0042981 - regulation of apoptosis [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : transformation related protein 73 protein_id : NP_035772.1

name	Wdr8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778726 CCDS:CCDS19010.1 GeneID:59002 MGI:1891749
definition	codon_start : 1 product : WD repeat domain 8 protein_id : NP_067474.2

name	1200015A19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312776 CCDS:CCDS19011.1 GeneID:67808 MGI:1915058
definition	GO_function : GO:0042802 - identical protein binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : hypothetical protein LOC67808 protein_id : NP_080664.1

name	Megf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82895993 GeneID:230971 MGI:1919351
definition	codon_start : 1 product : EGF-like-domain, multiple 3 isoform 1 protein_id : XP_620148.2

name	Arhgef16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94372807 GeneID:230972 MGI:2446219
definition	codon_start : 1 product : hypothetical protein isoform 5 protein_id : XP_907552.2

name	Prdm16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124107623 GeneID:70673 MGI:1917923
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : transcription factor MEL1 protein_id : NP_081780.3

name	LOC100043342 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253363 GeneID:100043342
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480404.1

name	LOC100042178 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253338 GeneID:100042178
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477740.1

name	Actrt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386316 CCDS:CCDS19014.1 GeneID:73353 MGI:1920603
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : actin related protein M2 (Arpm2) product : actin related protein M2 protein_id : NP_082789.1

name	B230396O12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098157 CCDS:CCDS19015.1 GeneID:242800 MGI:2445205
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC242800 protein_id : NP_766466.2

name	Mmel1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305477 GeneID:27390 MGI:1351603
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005615 - extracellular space [Evidence TAS]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence ISS]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0004245 - neprilysin activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : neprilysin 2; NEPLP beta; NEPLP alpha; NEPLP gamma; soluble secreted endopeptidase product : mel transforming oncogene-like 1 protein_id : NP_038811.1

name	2810405K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754130 CCDS:CCDS19016.1 GeneID:66469 MGI:1913719
definition	codon_start : 1 product : hypothetical protein LOC66469 protein_id : NP_079858.2

name	Tnfrsf14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725810 CCDS:CCDS19017.1 GeneID:230979 MGI:2675303
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0050798 - activated T cell proliferation [Evidence IDA]; GO:0006915 - apoptosis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : herpes virus entry mediator product : tumor necrosis factor receptor superfamily member 14 protein_id : NP_849262.1

name	Hes5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754182 CCDS:CCDS19018.1 GeneID:15208 MGI:104876
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0042491 - auditory receptor cell differentiation [Evidence IMP]; GO:0042668 - auditory receptor cell fate determination [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IGI]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0048469 - cell maturation [Evidence IGI]; GO:0007275 - development [Evidence IEA]; GO:0045665 - negative regulation of neuron differentiation [Evidence IGI]; GO:0007399 - nervous system development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : hairy and enhancer of split 5 protein_id : NP_034549.1

name	Pank4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370494 CCDS:CCDS19019.1 GeneID:269614 MGI:2387466
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004594 - pantothenate kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0015937 - coenzyme A biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : pantothenate kinase 4 protein_id : NP_766578.1

name	LOC100043358 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253365 GeneID:100043358
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480431.1

name	Plch2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583637 GeneID:269615 MGI:2443078
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0004435 - phosphoinositide phospholipase C activity [Evidence IEA]; GO:0004629 - phospholipase C activity [Evidence IDA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0030384 - phosphoinositide metabolism [Evidence IDA] codon_start : 1 note : phospholipase C eta2; phospholipase C-eta2 product : phospholipase C-like 4 protein_id : NP_780765.2

name	Pex10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109150414 CCDS:CCDS19021.1 GeneID:668173 MGI:2684988
definition	codon_start : 1 product : peroxisome biogenesis factor 10 protein_id : NP_001035866.1

name	Rer1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385882 CCDS:CCDS19022.1 GeneID:67830 MGI:1915080
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : RER1 homolog protein_id : NP_080671.1

name	Morn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487378 GeneID:76866 MGI:1924116
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA] codon_start : 1 product : MORN repeat containing 1 protein_id : NP_001074569.1

name	Ski (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113205055 CCDS:CCDS19024.1 GeneID:20481 MGI:98310
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0017053 - transcriptional repressor complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030326 - embryonic limb morphogenesis [Evidence IMP] codon_start : 1 product : Sloan-Kettering viral oncogene homolog protein_id : NP_035515.2

name	2610002J02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701642 GeneID:67513 MGI:1914763
definition	codon_start : 1 product : hypothetical protein LOC67513 protein_id : NP_001028306.1

name	Prkcz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872200 CCDS:CCDS19026.1 GeneID:18762 MGI:97602
definition	GO_component : GO:0045179 - apical cortex [Evidence IDA]; GO:0005938 - cell cortex [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005923 - tight junction [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004700 - atypical protein kinase C activity [Evidence IEA]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant 1; protein kinase C zeta subspecies product : protein kinase C, zeta isoform a protein_id : NP_032886.2

name	Prkcz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872205 CCDS:CCDS19027.1 GeneID:18762 MGI:97602
definition	GO_component : GO:0045179 - apical cortex [Evidence IDA]; GO:0005938 - cell cortex [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005923 - tight junction [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004700 - atypical protein kinase C activity [Evidence IEA]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : isoform b is encoded by transcript variant 2; protein kinase C zeta subspecies product : protein kinase C, zeta isoform b protein_id : NP_001034168.1

name	LOC100042089 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042089
definition	number : 1 pseudo : _no_value

name	LOC100042089 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042089
definition	number : 2 pseudo : _no_value

name	1190007F08Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149253303 GeneID:68859 MGI:1916109
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1190007F08 gene transcript_id : XR_035126.1

clone name	MSMg01-349J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486J15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-086D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188E02
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-281B17.b	B6Ng01-281B17.g
ACC	GA080666	GA080667
length	1,168	1,159
definition	B6Ng01-281B17.b	B6Ng01-281B17.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(153,545,693 - 153,546,851)	(153,689,512 - 153,690,650)
sequence	gaattcagtactagaatgggcaggaagagagggtcagggagccagcggcg acggatttaattttgaaagatgattccccaacaggccggttagcggtctc tcttaaactgcaaagcgatccccctctgttggcctcaaaggaaaactggt gcgaagtgagactgagagtggatgtacagatgagaggcctgccccccctc accagcccttccccgcagggtgcaaggtggagccttgtaaacttggcaag gctgctggggcggcacggggagtggaccagggacccttcaggccctggtt ggggcttccattctgccagttcgggcatcttctcacccacagaggagact tgctgcttctgtccagggctggcactgaccggtccactatgtacctggcc gtgaggacagtgtcatgattccctggggaatgagaggacaagcttcctac tgggacaggtgccctcgggacctcctccctgggtcttgctttggtctttg tggccattacaaaaaagagctggatctgagttggggtcctctcgtctatg aacagaagcaacctatgtccccgacttccgctgctccttcctcttaactg agtttgttcctagggagcttcggtcctagaatgattattgcactaagcgt ggtgggctagggctgccagcctgcctgtctctttcatggttgagaggggc tgcagacacggtcttcccgaggttgggtggatgcaatctggcacgagtgg aaactgttgctggccctttatgggttccccaccctgctctgtccgttcct gctgatctccctgggagtggagccaagggcttgctgcctgtgtcctgctc acctgggcccaggaaagcctttagctgttaaaaaagctgttggtatttag ctgtgaatgggtagcgggaggagccctgactcttcttcctcttgatgcaa tttccagagactgcccttcccttcttcctgcagaaggtggctgcatctct gcaggcctgtgcatccacttgctggctcttctgtgtcccaataaccctgg tgtctcgaattgtcacttggggtgggttctgagttcccaggttgggctaa aacctggcttctcttcccagacctacatctcttggggcattctgccaatg ggctcctaagcgctgggc	gaattcttatgatgaggaaaatcccgtagatgcacttattgaatatgtga ttaggtctaagtcagggccaggagtcccaaaacgcccacaagaaaaagat aaaaagaaaaaaaaatggaccacagttcctggtgactatggaaatcgccg tgagagaatcgtgaatcgagaagacgcggcttgagaatagtcaaatgtga ttttttttttttttttttttttttgcagatctcattctgaggcttatggc aaagacaaatgtacttgtgtagaggtttctgtgaggtaaaagccaggagg gcctggctttgaggtcaatgctgtagaataggactgactggataccaaat gtaatctttccgatgctacaatgaatttatacacgagattgatatgcaat aaatctgtgtgtttttctaagcctcggtgcctgcaagcttcattaaggga acccctgtcctctggaggataggagggctgtgaccccctcaagcttagac ttagtgggtctgaacactatacaaagccatcctttccactcgggcacaca ccctgggtgcgctcactccgtttgtatttcacccagctaggcctggagct gccccagcagatgaatggggagagcaaaaaccctagggctactggggagc aggggggctctcctgactcacccagaatgcctctctttatggaggcccag ggatatccccctgcagtctgcctcctccaccgtctgatccccaacttgat ccctgccctggtggagaagccttgggatgaactaacctgaaaaggtaaat gccaaggtccaagtgcagctgccccaagtccgcgtggcacgctccgcgct cctgctcccactcctttcttgcaccttgttaaggctggggctagcctcac atctctggtgaatagttcacacagccaccatccatctctgcccaggggct tctggtttttctcctggctccttggctcctccttgccccaggcgggttac ccattctctcctctttttttctccaagcaaggtcttggcttgtttttggg gcgatattggcccagcaggtaaatgctttttgatgtgccacccatgggtt ggcagggtcttgtccttcaggcagctatcccaggtgacctcttagaaccc ttgttcagg
quality values	Open. Hide. 58 27 52 32 58 31 18 39 62 47 54 62 47 56 49 56 41 62 62 49 62 62 62 62 49 62 62 62 62 62 59 62 44 43 59 43 45 37 35 59 59 62 59 59 62 62 62 62 62 62 59 49 59 62 59 59 62 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 59 59 62 62 62 62 62 56 56 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 54 62 62 54 51 62 62 56 62 62 56 56 56 56 62 62 62 62 62 62 49 62 62 54 62 56 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 56 62 62 62 62 62 62 54 62 54 62 62 62 62 54 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 54 58 54 58 52 50 52 52 34 52 14 17 21 12 17 21 54 43 45 54 52 47 54 41 49 54 58 58 54 58 40 54 54 58 54 54 52 54 54 54 58 58 54 54 58 58 50 58 58 54 54 58 50 54 54 58 58 45 36 41 58 52 54 40 58 48 58 50 58 41 58 54 52 54 54 54 54 52 54 30 58 54 53 53 51 49 58 49 37 50 49 48 50 46 42 28 58 40 58 51 42 58 41 46 51 58 45 42 49 49 35 58 37 43 58 49 50 38 32 53 58 58 50 54 48 44 49 58 52 50 50 50 51 58 42 46 22 41 50 51 52 51 32 51 36 47 30 58 58 58 50 58 51 50 24 18 50 24 37 51 49 48 39 41 34 39 33 32 15 4 20 21 51 52 39 50 54 50 50 54 51 29 28 50 41 26 29 50 50 43 58 50 31 35 31 17 53 15 50 50 40 51 52 41 37 42 54 54 28 53 52 38 50 38 18 54 49 37 54 33 35 33 35 49 33 32 24 32 54 29 28 39 34 54 41 39 42 42 35 41 39 51 19 27 33 21 42 53 31 45 37 42 42 52 32 45 39 34 37 22 46 36 40 41 44 31 34 15 19 41 15 40 15 41 34 26 51 17 54 26 31 32 24 32 12 16 31 25 32 28 36 31 35 32 20 24 27 32 24 52 24 32 24 27 25 34 52 39 28 40 32 31 21 31 19 51 16 24 31 14 9 51 51 30 24 31 32 31 33 35 24 45 45 45 40 31 25 30 31 42 31 31 51 9 6 46 9 46 12 9 18 31 31 28 31 35 21 18 27 38 46 41 21 34 26 36 21 40 26 32 9 8 31 9 16 46 11 29 37 18 15 32 31 20 21 31 37 13 23 25 21 30 32 23 27 15 21 38 36 16 8 11 31 27 23 27 24 21 39 17 28 26 23 31 9 46 14 31 30 31 44 31 32 31 32 32 31 26 11 11 28 25 30 25 34 35 12 14 8 38 17 11 12 15 38 18 26 12 13 23 30 32 34 11 9 6 18 18 11 8 10 24 13 12 17 19 13 27 21 16 20 32 23 14 11 4 6 7 10 9 22 28 15 9 12 18 15 14 12 18 8 25 25 31 29 5 33 10 17 23 9 9 6 7 5 15 9 4 5 20 11 15 25 7 25 5 9 20 20 3 25 29 24 11 27 28 27 9 6 7 5 6 4 5 19 9 11 27 17 11 6 4 3 6 7 32 6 9 8 24 38 27 17 9 8 4 9 9 3 7 7 6 4 12 5 11 7 18 14 15 7 9 6 11 10 12 14 13 22 12 16 12 6 14 10 23 30 22 5 6 5 22 8 16 9 3 3 3 3 10 21 6 8 3 1 5 4 7 4 10 4 7 8 8 13 18 25 14 3	Open. Hide. 62 47 62 47 62 62 62 62 62 59 41 41 22 24 27 21 27 24 28 36 51 59 62 62 62 62 59 62 62 59 59 62 62 62 59 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 59 59 59 54 49 59 59 59 56 38 32 54 59 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 59 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 56 51 35 40 23 13 38 41 27 28 30 24 35 36 34 30 34 43 30 49 30 39 36 34 34 34 43 30 30 34 34 13 36 28 23 34 34 34 45 34 24 39 34 41 34 30 34 34 34 23 46 34 46 41 43 40 34 34 40 34 30 43 24 49 23 34 49 49 46 23 34 38 27 27 34 40 34 51 50 34 43 34 51 43 39 50 48 46 34 49 30 51 30 34 27 36 39 49 39 34 35 30 27 18 38 49 34 34 18 35 43 30 34 34 34 39 41 51 51 44 45 43 43 45 34 43 45 41 50 39 27 28 39 41 34 38 50 41 43 19 51 30 34 31 31 30 45 34 39 39 38 45 44 43 51 43 34 38 31 43 30 38 18 32 21 35 29 38 38 29 29 25 37 27 39 32 44 38 38 51 38 38 30 31 31 27 35 38 36 31 38 51 42 39 27 27 24 31 22 28 26 26 28 18 31 22 38 28 38 27 33 31 20 22 18 39 51 56 39 34 47 43 56 56 30 56 43 46 43 33 43 38 38 30 32 24 33 39 39 42 31 32 38 32 22 31 39 21 15 13 28 25 24 47 43 27 31 35 17 27 25 24 35 38 46 35 25 25 25 27 27 38 41 40 40 10 25 29 29 29 24 21 42 52 46 41 35 30 24 24 34 9 17 19 33 34 39 46 35 37 30 34 40 33 33 29 18 28 22 29 27 34 34 26 30 26 27 33 26 12 28 42 27 35 33 33 50 42 42 52 39 47 52 34 52 31 52 46 33 36 23 34 26 34 33 37 50 39 37 47 47 40 31 47 40 46 47 29 37 28 35 34 29 13 19 30 33 30 34 25 40 40 46 46 49 32 31 34 28 27 24 29 40 20 18 31 31 15 38 25 32 44 40 36 51 52 42 39 49 39 52 28 28 32 37 54 50 40 41 53 53 49 36 20 42 49 31 39 28 28 30 37 37 40 46 50 22 39 29 15 58 58 58 58 49 32 51 37 39 29 33 33 32 39 22 42 38 24 34 40 50 25 13 40 40 19 37 30 40 37 29 32 29 14 54 11 16 14 25 36 39 21 40 13 42 40 21 14 30 31 35 29 34 40 22 42 39 44 40 37 37 15 26 21 29 33 16 21 25 36 17 17 53 33 19 47 27 31 51 23 32 34 26 22 32 27 18 30 31 32 16 31 31 32 44 23 33 18 7 40 21 31 34 25 49 32 31 34 52 26 32 31 37 13 42 38 14 20 30 31 12 18 47 32 11 14 18 32 31 25 31 17 33 24 33 29 30 25 51 51 31 14 23 13 24 51 37 33 42 29 16 25 17 11 26 25 12 27 20 32 26 29 31 29 23 21 31 35 19 14 36 40 31 13 28 25 32 30 32 21 31 18 13 31 30 18 34 29 25 37 42 26 36 24 32 18 31 21 19 21 22 31 24 31 7 46 31 30 38 31 13 13 7 31 30 23 15 9 25 19 14 30 31 39 7 30 8 7 17 25 25 32 17 30 33 41 39 30 30 32 32 11 11 10 16 12 10 14 19 32 34 35 32 32 29 29 17 25 31 7 12 26 10 9 14 6 6 18 31 7 8 13 36 11 29 17 19 14 26 14 25 28 19 18 31 21 15 19 14 39 17 23 32 33 39 30 6 15 6 9 19 18 30 14 37 48 48 22 7 8 15 28 13 16 22 5 15 13 10 25 23 13 19 12 12 10 24 7 7 15 12 14 32 17 31 36 16 15 19 24 7 7 6 4 4 23 7 14 29 22 19 23 18 20 7 3 3 3 9 10 12 6 5 5 26 40 30 8 4 3 3 7 20 19 9 15 18 21 9 12 24 11 9 6 14 15 7 26 9 9 7 30 38 29 13 28 47 47 23 6 7 3 3 3 3 3 3 14 12 27 7 25 7 11 7 6 4 7 21 25 18 7 6 4 8 28 30 23 5 6 9 6 5 9 7 5 4 2 5 18 8 5 5 23 21 9 20 17 7 6 6 21 10 23 24 5 16 10 10 7 5 15 16 14 11 7 6 5 6 13 7 4 6 3 5 6 8 16 8 6 22 6 8 6 3 2 5 5 5 6 7 8 3 9 6 7 13 10 9 10 6 6 7 4 5 3 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_153545693_153546851
seq2: B6Ng01-281B17.b_44_1211

seq1  GAATTCAGTACTAGAATGGGCAGGAAGAGAGGGTCAGGGAGCCAGCGGCG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGTACTAGAATGGGCAGGAAGAGAGGGTCAGGGAGCCAGCGGCG  50

seq1  ACGGATTTAATTTTGAAAGATGATTCCCCAACAGGCCGGTTAGCGGTCTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGGATTTAATTTTGAAAGATGATTCCCCAACAGGCCGGTTAGCGGTCTC  100

seq1  TCTTAAACTGCAAAGCGATCCCCCTCTGTTGGCCTCAAAGGAAAACTGGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTAAACTGCAAAGCGATCCCCCTCTGTTGGCCTCAAAGGAAAACTGGT  150

seq1  GCGAAGTGAGACTGAGAGTGGATGTACAGATGAGAGGCCTGCCCCCCCTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGAAGTGAGACTGAGAGTGGATGTACAGATGAGAGGCCTGCCCCCCCTC  200

seq1  ACCAGCCCTTCCCCGCAGGGTGCAAGGTGGAGCCTTGTAAACTTGGCAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAGCCCTTCCCCGCAGGGTGCAAGGTGGAGCCTTGTAAACTTGGCAAG  250

seq1  GCTGCTGGGGCGGCACGGGGAGTGGACCAGGGACCCTTCAGGCCCTGGTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGCTGGGGCGGCACGGGGAGTGGACCAGGGACCCTTCAGGCCCTGGTT  300

seq1  GGGGCTTCCATTCTGCCAGTTCGGGCATCTTCTCACCCACAGAGGAGACT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGCTTCCATTCTGCCAGTTCGGGCATCTTCTCACCCACAGAGGAGACT  350

seq1  TGCTGCTTCTGTCCAGGGCTGGCACTGACCGGTCCACTATGTACCTGGCC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGCTTCTGTCCAGGGCTGGCACTGACCGGTCCACTATGTACCTGGCC  400

seq1  GTGAGGACAGTGTCATGATTCCCTGGGGAATGAGAGGACAAGCTTCCTAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAGGACAGTGTCATGATTCCCTGGGGAATGAGAGGACAAGCTTCCTAC  450

seq1  TGGGACAGGTGCCCTCGGGACCTCCTCCCTGGGTCTTGCTTTGGTCTTTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGACAGGTGCCCTCGGGACCTCCTCCCTGGGTCTTGCTTTGGTCTTTG  500

seq1  TGGCCATTACAAAAAAGAGCTGGATCTGAGTTGGGGTCCTCTCGTCTATG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCCATTACAAAAAAGAGCTGGATCTGAGTTGGGGTCCTCTCGTCTATG  550

seq1  AACAGAAGCAACCTATGTCCCCGACTTCCGCTGCTCCTTCCTCTTAACTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAGAAGCAACCTATGTCCCCGACTTCCGCTGCTCCTTCCTCTTAACTG  600

seq1  AGTTTGTTCCTAGGGAGCTTCGGTCCTAGAATGATTATTGCACTAAGCGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTGTTCCTAGGGAGCTTCGGTCCTAGAATGATTATTGCACTAAGCGT  650

seq1  GGTGGGCTAGGGCTGCCAGCCTGCCTGTCTCTTTCATGGTTGAGAGGGGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGGCTAGGGCTGCCAGCCTGCCTGTCTCTTTCATGGTTGAGAGGGGC  700

seq1  TGCAGACACGGTCTTCCCGAGGTTGGGTGGATGCAATCTGGCACGAGTGG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAGACACGGTCTTCCCGAGGTTGGGTGGATGCAATCTGGCACGAGTGG  750

seq1  AAACTGTTGCTGGCCCTTTATGGGTTCCCCACCCTGCTCTGTCCGTTCCT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTGTTGCTGGCCCTTTATGGGTTCCCCACCCTGCTCTGTCCGTTCCT  800

seq1  GCTGATCTCCCTGGGAGTGGAGCCAAGGGCTTGCTGCCTGTGTCCTGCTC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGATCTCCCTGGGAGTGGAGCCAAGGGCTTGCTGCCTGTGTCCTGCTC  850

seq1  ACCTGGGCCCAGG-AAGCCTTTAGCTGTTAAAAAAGCTGTTGG-AATTAG  898
      ||||||||||||| ||||||||||||||||||||||||||||| | ||||
seq2  ACCTGGGCCCAGGAAAGCCTTTAGCTGTTAAAAAAGCTGTTGGTATTTAG  900

seq1  CTGTGAATGGGTAGCGGGA-GAG-CCTGACTCTTCTTCCTCTTGATGCAA  946
      ||||||||||||||||||| ||| ||||||||||||||||||||||||||
seq2  CTGTGAATGGGTAGCGGGAGGAGCCCTGACTCTTCTTCCTCTTGATGCAA  950

seq1  TTTCCAGAGACTG-CCTTCCCTTCTTCCTGCAGAA-GTGGCTGCATCTCT  994
      ||||||||||||| ||||||||||||||||||||| ||||||||||||||
seq2  TTTCCAGAGACTGCCCTTCCCTTCTTCCTGCAGAAGGTGGCTGCATCTCT  1000

seq1  GCA-GCCTGTGCATCCACTTGCTGGCTCTTCTGTGTCCCAATAAACCTGT  1043
      ||| |||||||||||||||||||||||||||||||||||||||| |||| 
seq2  GCAGGCCTGTGCATCCACTTGCTGGCTCTTCTGTGTCCCAATAACCCTGG  1050

seq1  GTTCTCAGATTGTCCACTTTGGGTGGG-TCTGAGTT-CCAGGTTGGGCTA  1091
        ||||  ||||| ||||| ||||||| |||||||| |||||||||||||
seq2  TGTCTCGAATTGT-CACTTGGGGTGGGTTCTGAGTTCCCAGGTTGGGCTA  1099

seq1  AAACCCTGGC-TCTCTTCCCCAGACCTACATCTCTT-GGGCA-TCTGCAC  1138
      ||| |||||| |||||| |||||||||||||||||| ||||| |||||  
seq2  AAA-CCTGGCTTCTCTT-CCCAGACCTACATCTCTTGGGGCATTCTGCCA  1147

seq1  ATGGGCTC--TAGCTGGCTGGGC  1159
      ||||||||   |||  |||||||
seq2  ATGGGCTCCTAAGC--GCTGGGC  1168

seq1: chr4_153689512_153690650
seq2: B6Ng01-281B17.g_67_1225 (reverse)

seq1  CCTGAACAAGTGCTCTTAAGAGGTCACCCTGGATAGCTGCTGGAAGG--C  48
      |||||||||| | || ||||||||||||  ||||||||||  |||||   
seq2  CCTGAACAAGGGTTC-TAAGAGGTCACCTGGGATAGCTGCCTGAAGGACA  49

seq1  AGA-CCTG-CAACC--TTGGTGTTGCATC-AAAAGCATTTA-CTGCTTGG  92
      ||| |||| |||||  | ||||   |||| ||||||||||| ||||| ||
seq2  AGACCCTGCCAACCCATGGGTGGCACATCAAAAAGCATTTACCTGCTGGG  99

seq1  -CACTACTGCCCCAAAA--CAGCC-AGA-CTTGCTTTG-GAAGAAAAGAG  136
       || ||  |||||||||   |||| ||| ||||||| | ||| |||||||
seq2  CCAATATCGCCCCAAAAACAAGCCAAGACCTTGCTTGGAGAAAAAAAGAG  149

seq1  AGAGAGAATGGGTAACTCGCCTGGGGCAAGGAGGAGCCAA-GAGCCAGGG  185
       ||||||||||||||| ||||||||||||||||||||||| |||||||| 
seq2  -GAGAGAATGGGTAACCCGCCTGGGGCAAGGAGGAGCCAAGGAGCCAGGA  198

seq1  AGAAAACCAG-AGCCCCTGGGCAGAGATGGATGGTGGCTGTTGTG-ACTA  233
        |||||||| ||||||||||||||||||||||||||||| |||| ||||
seq2  GAAAAACCAGAAGCCCCTGGGCAGAGATGGATGGTGGCTG-TGTGAACTA  247

seq1  TTCACCAGAGATGTGA-GCTAGCCCCAGCCTT-ACAAGGTGCA--GAAGG  279
      |||||||||||||||| ||||||||||||||| ||||||||||   ||||
seq2  TTCACCAGAGATGTGAGGCTAGCCCCAGCCTTAACAAGGTGCAAGAAAGG  297

seq1  AGTGGGAGCAGGAGCGCGGAGCGTGCCACGCGGACTTGGGGCAGCTGCAC  329
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGGGAGCAGGAGCGCGGAGCGTGCCACGCGGACTTGGGGCAGCTGCAC  347

seq1  TTGGACCTTGGCATTTACCTTTTCAGGTTAGTTCATCCCAAGGCTTCTCC  379
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGACCTTGGCATTTACCTTTTCAGGTTAGTTCATCCCAAGGCTTCTCC  397

seq1  ACCAGGGCA-GGATCAAGTTGGGGATCAGACGGTGGAGGAGGCAGACTGC  428
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  ACCAGGGCAGGGATCAAGTTGGGGATCAGACGGTGGAGGAGGCAGACTGC  447

seq1  AGGGGGATATCCCTGGGCCTCCAT-AAGAGAGGCATTCTGGGTGAGTCAG  477
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  AGGGGGATATCCCTGGGCCTCCATAAAGAGAGGCATTCTGGGTGAGTCAG  497

seq1  GAGAGCCCCCCTGCTCCCCAGTAGCCCTAGGGTTTTTGCTCTCCCCATTC  527
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGCCCCCCTGCTCCCCAGTAGCCCTAGGGTTTTTGCTCTCCCCATTC  547

seq1  ATCTGCTGGGGCAGCTCCAGGCCTAGCTGGGTGAAATACAAACGGAGTGA  577
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGCTGGGGCAGCTCCAGGCCTAGCTGGGTGAAATACAAACGGAGTGA  597

seq1  GCGCACCCAGGGTGTGTGCCCGAGTGGAAAGGATGGCTTTGTATAGTGCT  627
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  GCGCACCCAGGGTGTGTGCCCGAGTGGAAAGGATGGCTTTGTATAGTGTT  647

seq1  CAGACCCACTAAGTCTAAGCTTGAGGGGGTCACAGCCCTCCTATCCTCCA  677
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACCCACTAAGTCTAAGCTTGAGGGGGTCACAGCCCTCCTATCCTCCA  697

seq1  GAGGACAGGGGTTCCCTTAATGAAGCTTGCAGGCACCGAGGCTTAGAAAA  727
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGACAGGGGTTCCCTTAATGAAGCTTGCAGGCACCGAGGCTTAGAAAA  747

seq1  ACACACAGATTTATTGCATATCAATCTCGTGTATAAATTCATTGTAGCAT  777
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACACAGATTTATTGCATATCAATCTCGTGTATAAATTCATTGTAGCAT  797

seq1  CGGAAAGATTACATTTGGTATCCAGTCAGTCCTATTCTACAGCATTGACC  827
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGAAAGATTACATTTGGTATCCAGTCAGTCCTATTCTACAGCATTGACC  847

seq1  TCAAAGCCAGGCCCTCCTGGCTTTTACCTCACAGAAACCTCTACACAAGT  877
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAAGCCAGGCCCTCCTGGCTTTTACCTCACAGAAACCTCTACACAAGT  897

seq1  ACATTTGTCTTTGCCATAAGCCTCAGAATGAGATCTGCAAAAAAAAAAAA  927
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTTGTCTTTGCCATAAGCCTCAGAATGAGATCTGCAAAAAAAAAAAA  947

seq1  AAAAAAAAAAAATCACATTTGACTATTCTCAAGCCGCGTCTTCTCGATTC  977
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAAAAAAAATCACATTTGACTATTCTCAAGCCGCGTCTTCTCGATTC  997

seq1  ACGATTCTCTCACGGCGATTTCCATAGTCACCAGGAACTGTGGTCCATTT  1027
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGATTCTCTCACGGCGATTTCCATAGTCACCAGGAACTGTGGTCCATTT  1047

seq1  TTTTTTCTTTTTATCTTTTTCTTGTGGGCGTTTTGGGACTCCTGGCCCTG  1077
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTCTTTTTATCTTTTTCTTGTGGGCGTTTTGGGACTCCTGGCCCTG  1097

seq1  ACTTAGACCTAATCACATATTCAATAAGTGCATCTACGGGATTTTCCTCA  1127
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTAGACCTAATCACATATTCAATAAGTGCATCTACGGGATTTTCCTCA  1147

seq1  TCATAAGAATTC  1139
      ||||||||||||
seq2  TCATAAGAATTC  1159

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information