MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-281E07
Chromosome	4 (Build37)
Map Location	144,329,072 - 144,465,621
singlet/doublet	doublet
Overlap gene	Gm438, LOC666242, LOC676844
Upstream gene	OTTMUSG00000010009, OTTMUSG00000010328, OTTMUSG00000010433, LOC195555, LOC194224, LOC626889, LOC329984, LOC626922, LOC626943, LOC100041127, LOC436146, Pramel4, LOC100041077, LOC100041144, Oog3, Oog2, C87977, Pramel5, LOC666150, LOC626995, OTTMUSG00000010537, EG627009, Pramef12, D530049N12Rik, 1700012P22Rik, Aadacl3, 9430007A20Rik, LOC100041232, LOC666194, LOC627085, LOC666215, LOC435815, Gm436, LOC546849
Downstream gene	Dhrs3, Vps13d, Tnfrsf1b, Tnfrsf8, LOC666282, 9230115A19Rik, LOC195576, LOC622846, LOC666314, LOC545701, OTTMUSG00000010965, LOC666334, LOC545703, LOC384081, LOC100041379, LOC666349, LOC666351, LOC545704, 1700029I01Rik, LOC236069, LOC384084
Link	Open Mouse BAC browser

Click to get alignment info.

name	OTTMUSG00000010009 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194227 MGI:3650478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000010328 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381569 MGI:3650237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000010433 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194225 MGI:3650203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC195555 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:195555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 41 Proteins

name	LOC194224 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:194224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC626889 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC329984 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:329984
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 12 ESTs, 50 Proteins

name	LOC626922 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 9 ESTs, 55 Proteins

name	LOC626943 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 Proteins

name	LOC100041127 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	LOC436146 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436146
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Pramel4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:347710 MGI:2156377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041077 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 138 ESTs, 43 Proteins

name	LOC100041144 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Oog3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100012 MGI:2684047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oog2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381570 MGI:2684035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C87977 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97187 MGI:2140708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 199 ESTs, 48 Proteins

name	Pramel5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384077 MGI:2156389
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 116 ESTs, 39 Proteins

name	LOC666150 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC626995 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 50 Proteins

name	OTTMUSG00000010537 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433779 MGI:3651680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627009 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627009 MGI:3643657
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 Proteins

name	Pramef12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77632 MGI:1924882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D530049N12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78723 MGI:1925973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	1700012P22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69364 MGI:1916614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 7 ESTs, 2 Proteins

name	Aadacl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230883 MGI:2685281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	9430007A20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381572 MGI:2685880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041232 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 ESTs, 11 Proteins pseudo : _no_value

name	LOC666194 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 94 ESTs, 2 Proteins pseudo : _no_value

name	LOC627085 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	LOC666215 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 176 ESTs, 6 Proteins

name	LOC435815 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm436 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230890 MGI:2685282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC546849 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546849
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins

name	Gm438 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329993 MGI:2685284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 9 Proteins

name	LOC666242 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC676844 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676844
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Dhrs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20148 MGI:1315215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps13d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230895 MGI:2448530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 88 ESTs, 2 Proteins

name	Tnfrsf1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21938 MGI:1314883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21941 MGI:99908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666282 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	9230115A19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545700 MGI:2443330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	LOC195576 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:195576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC622846 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622846
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs

name	LOC666314 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC545701 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 426 ESTs, 5 Proteins pseudo : _no_value

name	OTTMUSG00000010965 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433801 MGI:3651014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666334 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 ESTs, 6 Proteins pseudo : _no_value

name	LOC545703 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 5 Proteins pseudo : _no_value

name	LOC384081 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC100041379 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041379
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 74 ESTs pseudo : _no_value

name	LOC666349 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC666351 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 476 ESTs, 23 Proteins pseudo : _no_value

name	LOC545704 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545704
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 24 Proteins pseudo : _no_value

name	1700029I01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70005 MGI:1917255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC236069 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:236069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 47 ESTs, 7 Proteins

name	LOC384084 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384084
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	OTTMUSG00000010009 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55741546 GeneID:194227 MGI:3650478
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000010009 transcript_id : NM_001007077.1

name	OTTMUSG00000010328 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802069 GeneID:381569 MGI:3650237
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000010328 transcript_id : NM_001005371.2

name	OTTMUSG00000010433 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248521 GeneID:194225 MGI:3650203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000010433 transcript_id : NM_177571.3

name	LOC195555 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253267 GeneID:195555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 41 Proteins product : novel protein similar to preferentially expressed antigen in melanoma-like family (Pramel) transcript_id : XM_112266.7

name	LOC329984 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253259 GeneID:329984
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 50 Proteins product : hypothetical LOC329984 transcript_id : XM_285846.7

name	LOC626922 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253269 GeneID:626922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 9 ESTs, 55 Proteins product : novel protein similar to the preferentially expressed antigen in melanoma like (Pramel) family transcript_id : XM_891538.3

name	LOC626943 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82895671 GeneID:626943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 Proteins product : novel protein similar to the preferentially expressed antigen in melanoma like (Pramel) family transcript_id : XM_891565.1

name	LOC100041127 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253275 GeneID:100041127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : similar to pol protein transcript_id : XM_001475845.1

name	Pramel4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373617 GeneID:347710 MGI:2156377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : preferentially expressed antigen in melanoma like 4 transcript_id : NM_001001319.3

name	LOC100041077 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253265 GeneID:100041077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 138 ESTs, 43 Proteins product : similar to preferentially expressed antigen in melanoma like 4 transcript_id : XM_001476560.1

name	LOC100041144 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253277 GeneID:100041144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : similar to pol protein transcript_id : XM_001475876.1

name	Oog3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41054937 GeneID:100012 MGI:2684047
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oogenesin 3 transcript_id : NM_201258.1

name	Oog2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802198 GeneID:381570 MGI:2684035
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oogenesin 2 transcript_id : NM_198661.2

name	C87977 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253273 GeneID:97187 MGI:2140708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 95 ESTs product : expressed sequence C87977, transcript variant 2 transcript_id : XM_001476630.1

name	C87977 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253271 GeneID:97187 MGI:2140708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 192 ESTs, 48 Proteins product : expressed sequence C87977, transcript variant 1 transcript_id : XM_001476610.1

name	Pramel5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253279 GeneID:384077 MGI:2156389
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 116 ESTs, 39 Proteins product : preferentially expressed antigen in melanoma like 5, transcript variant 3 transcript_id : XM_987884.2

name	LOC626995 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82895679 GeneID:626995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 50 Proteins product : novel protein similar to the preferentially expressed antigen in melanoma like (Pramel) family transcript_id : XM_891619.1

name	OTTMUSG00000010537 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113461987 GeneID:433779 MGI:3651680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000010537 transcript_id : NM_001034101.2

name	EG627009 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82895681 GeneID:627009 MGI:3643657
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 Proteins product : predicted gene, EG627009 transcript_id : XM_891640.1

name	Pramef12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377452 GeneID:77632 MGI:1924882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PRAME family member 12 transcript_id : NM_029948.2

name	D530049N12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253281 GeneID:78723 MGI:1925973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA D530049N12 gene transcript_id : XM_001476737.1

name	1700012P22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372727 GeneID:69364 MGI:1916614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 7 ESTs, 2 Proteins product : RIKEN cDNA 1700012P22 gene transcript_id : XM_131817.3

name	Aadacl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20849382 GeneID:230883 MGI:2685281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : arylacetamide deacetylase-like 3 transcript_id : XM_144109.1

name	9430007A20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376265 GeneID:381572 MGI:2685880
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9430007A20 gene transcript_id : NM_198662.2

name	LOC627085 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82895690 GeneID:627085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : similar to arylacetamide deacetylase transcript_id : XM_891737.1

name	LOC666215 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253286 GeneID:666215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 176 ESTs, 6 Proteins product : similar to Microspherule protein 1 transcript_id : XM_982352.2

name	LOC435815 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:124486966 GeneID:435815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : similar to arylacetamide deacetylase transcript_id : NM_001081248.1

name	Gm436 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63517497 GeneID:230890 MGI:2685282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : gene model 436, (NCBI) transcript_id : XM_144113.4

name	LOC546849 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:63517501 GeneID:546849
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins product : similar to arylacetamide deacetylase transcript_id : XM_621645.1

name	Gm438 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372737 GeneID:329993 MGI:2685284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 9 Proteins product : gene model 438, (NCBI) transcript_id : XM_144115.6

name	Dhrs3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370009 GeneID:20148 MGI:1315215
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dehydrogenase/reductase (SDR family) member 3 transcript_id : NM_011303.3

name	Vps13d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253287 GeneID:230895 MGI:2448530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 88 ESTs, 2 Proteins product : vacuolar protein sorting 13 D (yeast) transcript_id : XM_001476900.1

name	Tnfrsf1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253923 GeneID:21938 MGI:1314883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 1b transcript_id : NM_011610.3

name	Tnfrsf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130411 GeneID:21941 MGI:99908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 8 transcript_id : NM_009401.2

name	LOC195576 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:20343465 GeneID:195576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to acidic ribosomal phosphoprotein P1 transcript_id : XM_112297.1

name	LOC622846 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253289 GeneID:622846
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs product : similar to crooked legs CG14938-PB, transcript variant 10 transcript_id : XM_899253.3

name	OTTMUSG00000010965 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802922 GeneID:433801 MGI:3651014
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000010965 transcript_id : NM_001013808.2

name	LOC384081 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:38079015 GeneID:384081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to acidic ribosomal phosphoprotein P1 transcript_id : XM_357407.1

name	1700029I01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140970648 GeneID:70005 MGI:1917255
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700029I01 gene transcript_id : NM_027285.3

name	LOC236069 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372743 GeneID:236069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 47 ESTs, 7 Proteins product : similar to Cdv3 protein transcript_id : XM_135479.4

name	OTTMUSG00000010009 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55741547 CCDS:CCDS18894.1 GeneID:194227 MGI:3650478
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC194227 protein_id : NP_001007078.1

name	OTTMUSG00000010328 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52851398 GeneID:381569 MGI:3650237
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC381569 protein_id : NP_001005371.1

name	OTTMUSG00000010433 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248522 GeneID:194225 MGI:3650203
definition	codon_start : 1 note : novel protein similar to oogenesin 3 (Oog3) product : hypothetical protein LOC194225 protein_id : NP_808239.2

name	LOC195555 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253268 GeneID:195555
definition	codon_start : 1 product : hypothetical protein LOC195555 protein_id : XP_112266.5

name	LOC329984 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895664 GeneID:329984
definition	codon_start : 1 product : hypothetical protein protein_id : XP_285846.5

name	LOC626922 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253270 GeneID:626922
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896631.3

name	LOC626943 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895672 GeneID:626943
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896658.1

name	LOC100041127 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253276 GeneID:100041127
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001475895.1

name	Pramel4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75812918 CCDS:CCDS18900.1 GeneID:347710 MGI:2156377
definition	codon_start : 1 product : preferentially expressed antigen in melanoma like 4 protein_id : NP_001001319.2

name	LOC100041077 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253266 GeneID:100041077
definition	codon_start : 1 product : similar to preferentially expressed antigen in melanoma like 4 protein_id : XP_001476610.1

name	LOC100041144 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253278 GeneID:100041144
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001475926.1

name	Oog3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41054938 GeneID:100012 MGI:2684047
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : oogenesin 3 protein_id : NP_957710.1

name	Oog2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348556 CCDS:CCDS18901.1 GeneID:381570 MGI:2684035
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : oogenesin 2 protein_id : NP_941063.1

name	C87977 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253272 GeneID:97187 MGI:2140708
definition	codon_start : 1 product : hypothetical protein LOC97187 isoform 1 protein_id : XP_001476660.1

name	C87977 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253274 GeneID:97187 MGI:2140708
definition	codon_start : 1 product : hypothetical protein LOC97187 isoform 2 protein_id : XP_001476680.1

name	Pramel5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253280 GeneID:384077 MGI:2156389
definition	codon_start : 1 product : preferentially expressed antigen in melanoma like 5 isoform 3 protein_id : XP_992978.2

name	LOC626995 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895680 GeneID:626995
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896712.1

name	OTTMUSG00000010537 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113461988 CCDS:CCDS18904.1 GeneID:433779 MGI:3651680
definition	codon_start : 1 product : hypothetical protein LOC433779 protein_id : NP_001029273.2

name	EG627009 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82895682 GeneID:627009 MGI:3643657
definition	codon_start : 1 product : similar to hCG2042963 protein_id : XP_896733.1

name	Pramef12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313388 CCDS:CCDS18905.1 GeneID:77632 MGI:1924882
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : novel protein similar to the preferentially expressed antigen in melanoma like (Pramel) family product : PRAME family member 12 protein_id : NP_084224.1

name	D530049N12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253282 GeneID:78723 MGI:1925973
definition	codon_start : 1 product : hypothetical protein LOC78723 protein_id : XP_001476787.1

name	1700012P22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253283 GeneID:69364 MGI:1916614
definition	codon_start : 1 product : hypothetical protein LOC69364 protein_id : XP_131817.2

name	Aadacl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20849383 GeneID:230883 MGI:2685281
definition	codon_start : 1 product : similar to gene model 435 protein_id : XP_144109.1

name	9430007A20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348558 GeneID:381572 MGI:2685880
definition	codon_start : 1 exception : unclassified translation discrepancy product : similar to arylacetamide deacetylase (esterase) protein_id : NP_941064.1

name	LOC627085 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895691 GeneID:627085
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896830.1

name	LOC666215 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94372736 GeneID:666215
definition	codon_start : 1 product : similar to Microspherule protein 1 protein_id : XP_987446.1

name	LOC435815 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:124486967 GeneID:435815
definition	codon_start : 1 product : similar to arylacetamide deacetylase protein_id : NP_001074717.1

name	Gm436 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63517498 GeneID:230890 MGI:2685282
definition	codon_start : 1 product : hypothetical protein protein_id : XP_144113.4

name	LOC546849 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:63517502 GeneID:546849
definition	codon_start : 1 product : hypothetical protein protein_id : XP_621645.1

name	Gm438 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82895698 GeneID:329993 MGI:2685284
definition	codon_start : 1 product : hypothetical protein protein_id : XP_144115.5

name	Dhrs3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755380 CCDS:CCDS18912.1 GeneID:20148 MGI:1315215
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : retinal short-chain dehydrogenase/reductase 1 product : dehydrogenase/reductase (SDR family) member 3 protein_id : NP_035433.1

name	Vps13d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253288 GeneID:230895 MGI:2448530
definition	codon_start : 1 product : vacuolar protein sorting 13D protein_id : XP_001476950.1

name	Tnfrsf1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778792 CCDS:CCDS18914.1 GeneID:21938 MGI:1314883
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005031 - tumor necrosis factor receptor activity [Evidence IEA] GO_process : GO:0008219 - cell death [Evidence IMP]; GO:0008283 - cell proliferation [Evidence TAS]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IMP]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IMP]; GO:0050728 - negative regulation of inflammatory response [Evidence IMP]; GO:0050779 - RNA destabilization [Evidence IMP] codon_start : 1 note : p75 TNFR; TNF receptor beta chain product : tumor necrosis factor receptor superfamily, member 1b protein_id : NP_035740.2

name	Tnfrsf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678385 CCDS:CCDS18915.1 GeneID:21941 MGI:99908
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005031 - tumor necrosis factor receptor activity [Evidence IEA] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IEA] codon_start : 1 product : tumor necrosis factor receptor superfamily, member 8 protein_id : NP_033427.1

name	LOC195576 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:20343466 GeneID:195576
definition	codon_start : 1 product : similar to acidic ribosomal phosphoprotein P1 protein_id : XP_112297.1

name	LOC622846 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253290 GeneID:622846
definition	codon_start : 1 product : hypothetical protein isoform 10 protein_id : XP_904346.3

name	OTTMUSG00000010965 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701494 GeneID:433801 MGI:3651014
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC433801 protein_id : NP_001013830.1

name	LOC384081 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:38079016 GeneID:384081
definition	codon_start : 1 product : similar to acidic ribosomal phosphoprotein P1 protein_id : XP_357407.1

name	1700029I01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:140970649 GeneID:70005 MGI:1917255
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC70005 protein_id : NP_081561.3

name	LOC236069 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:38079022 GeneID:236069
definition	codon_start : 1 product : similar to Cdv3 protein protein_id : XP_135479.2

name	LOC194224 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194224
definition	number : 1 pseudo : _no_value

name	LOC194224 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194224
definition	number : 2 pseudo : _no_value

name	LOC194224 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194224
definition	number : 3 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 7 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 6 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 5 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 4 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 3 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 2 pseudo : _no_value

name	LOC626889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626889
definition	number : 1 pseudo : _no_value

name	LOC436146 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436146
definition	number : 1 pseudo : _no_value

name	LOC666150 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666150
definition	number : 1 pseudo : _no_value

name	LOC666242 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666242
definition	number : 1 pseudo : _no_value

name	LOC666242 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666242
definition	number : 2 pseudo : _no_value

name	LOC676844 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676844
definition	number : 2 pseudo : _no_value

name	LOC676844 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676844
definition	number : 1 pseudo : _no_value

name	LOC666282 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666282
definition	number : 1 pseudo : _no_value

name	LOC666314 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666314
definition	number : 1 pseudo : _no_value

name	LOC666349 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666349
definition	number : 1 pseudo : _no_value

name	LOC666349 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666349
definition	number : 2 pseudo : _no_value

name	LOC384084 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384084
definition	number : 1 pseudo : _no_value

name	LOC100041232 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253284 GeneID:100041232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 ESTs, 11 Proteins product : similar to high-mobility group box 1 pseudo : _no_value transcript_id : XR_032919.1

name	LOC666194 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253285 GeneID:666194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 94 ESTs, 2 Proteins product : similar to Integrator complex subunit 5 pseudo : _no_value transcript_id : XR_032523.1

name	9230115A19Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:95007006 GeneID:545700 MGI:2443330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9230115A19 gene pseudo : _no_value transcript_id : NR_002888.2

name	LOC545701 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253296 GeneID:545701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 426 ESTs, 5 Proteins product : similar to ribosomal protein L28 pseudo : _no_value transcript_id : XR_033026.1

name	LOC666334 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253295 GeneID:666334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 ESTs, 6 Proteins product : similar to Cdv3 protein pseudo : _no_value transcript_id : XR_033021.1

name	LOC545703 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253293 GeneID:545703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 5 Proteins product : similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a5 pseudo : _no_value transcript_id : XR_033003.1

name	LOC100041379 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253292 GeneID:100041379
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 74 ESTs product : similar to novel KRAB box containing protein pseudo : _no_value transcript_id : XR_032991.1

name	LOC666351 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253294 GeneID:666351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 476 ESTs, 23 Proteins product : similar to High mobility group box 2 pseudo : _no_value transcript_id : XR_033012.1

name	LOC545704 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253291 GeneID:545704
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 24 Proteins product : similar to Protein phosphatase 2, regulatory subunit B (B56), alpha pseudo : _no_value transcript_id : XR_032648.1

clone name	MSMg01-078J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379J04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-356E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-372M17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-326G21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-532E23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-413I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-419E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060I21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-068M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-104M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-178P21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-102M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-104M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-111D21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-142I23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-384D18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-436L12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-375N17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-305C12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-508O13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-158J12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-198N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471N10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-089O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108D10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-090P24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-207P23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-145A21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-205G04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-546A15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-502B17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-511J09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-524L02
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-249H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040H13
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-281E07.b	B6Ng01-281E07.g
ACC	GA080790	GA080791
length	1,120	1,071
definition	B6Ng01-281E07.b	B6Ng01-281E07.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(144,329,072 - 144,330,193)	(144,464,554 - 144,465,621)
sequence	gaattctcagatgaaaagcacaaatagacagggtagttttttaatactaa aaatctttatccaccataaaatgccatttcatttttaaatgtatttatgt ctatgagtctgcatgtatgtttgtgcagcatacacatgactgattgtgaa aagagcactgtatcctctagaaatggagttagtaaaaattgtgagccttc atttaggttctatgactgtgggtcctctgaaagagcatccaatgcttgta agtactgacccaattctccagtcacatgaaatgcaattctatatcatctc agtgagaatggatgcaatcaagaaaacaacaaatgcttgtgaagaagtag aaacatgggattcttatcgtctgttgttgtgagagtgtgctggctgttct tgagtctacttaacccacaaatgtgttatctgaggggaggaaacctcagt aaagatgatgccaccataatatccagctgtaaattctcttcttaattagt gattgatgtgagagggcccagttctttgtgggtggactatccctggagtg gttctgggttctgtaagaaagtaggatgaaaaggccagggaaacaatcta gaaagtagcatccctccatgacctctgcatgagatcctgcttccaggttt ctgccacgtttgaattactatccaggcttctcttaataatagactacaat gtggaagtataagtctaataaactctctccttcccaacttgcttttttat catgatgtttcatcacggcaatagaaaccctaagacagggaataaagtgg tgcagatttctccaaaaacagaagaaagaactatttcattcaaccaaagg actttacattctaccacagaggtatgtgaactcccacattcattgctgct ccattctcaatttctaaggaatggaatcagcttagatggtcatcaattaa taaatgtatgatggtggcaaaatacatacataagcacacacaattttgtt cagaccagcaacgtgaccaataccagggcaggttagcatacagaagccac ctcttgagctcttacaagactttctgctagaacatctgcccaactcctga gcatcctgaacctctgagac	gaattcttggctcttgatagtgaccccaagggatctgctcccaaggctgg ggtagttgggaggatttacactgcagcatacagggcctggcctagcccac agaatgggttggaatggggcagggggttccggcagatgcatcaccatagc ctggtgataccagggcattcttatagggcatgagcctcaccatatcttcc ccagatactttgggccaagcacaacaagttattgggaaatgctgtcttcc tcctcctctctcctgcctctcccaagatattgcaagatggagatttactg catggctggggtgtaattacatggtgattgaggctgagagctgactgttg attgagaatggactctctggtacaactgttcctgcaagggtgtgtgtgtg tgtctgagtgaatgtttccaggttctttgcctatcacttaaagaactgaa aatgagggctacataaatttgcaaagggatagaaatttattagaaatgaa gggttaatatggattagagagaatatatcatcaagatttacagctggtca caagcgagagaatattctagagttttagtctatggcctaggatgtctttc ttatagggtctaaaggaaggaggggctggctacagtggagagtggcttga ggggttctgtattttgattgatagattatgccatgtgcccattcttccta cagaactcatcctttcccataatgcatctgattttaattatatgcatgcc caagtatgcataggcctaagattaaataaataggggattctctctgaaag ttcacttgaaggactcagtttgccttttcgtacatgtgcctggcattggg tcatgctggctgccccttttattcttcatataggacatattgggaatatt ctcgactagaaactgtctaaatgagactgtttcttagagtggagaaattt atagtactgttaagagattcaagtatgcctgatatacataggaagttcag ggttctcagtttgctaagcacaatttgtttggaagaggatatgagcatcg attgggttaggtggaaggagc
quality values	Open. Hide. 58 34 27 26 58 54 45 31 31 62 47 33 62 49 62 62 62 54 62 56 62 62 62 62 62 54 62 54 62 47 62 47 47 44 46 45 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 49 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 49 47 62 62 62 62 62 54 62 62 62 62 62 54 62 62 54 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 41 58 58 58 54 58 58 58 58 58 58 51 58 58 47 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 45 41 58 54 58 58 58 58 58 58 58 58 58 54 58 54 54 58 54 58 58 58 54 58 58 58 58 58 52 58 58 52 58 58 58 51 46 53 45 58 45 26 58 58 54 54 44 45 51 35 58 51 51 58 58 38 49 45 49 30 54 51 58 53 54 51 58 58 54 53 50 58 40 58 50 58 53 58 58 58 53 51 34 54 51 51 49 58 54 58 54 51 48 32 52 58 58 31 39 37 46 58 50 51 52 50 50 51 50 32 41 50 54 58 50 53 53 53 37 51 25 52 51 50 54 58 58 41 40 40 53 42 52 53 52 51 58 49 39 47 46 50 52 51 50 52 53 47 51 49 50 52 42 42 53 50 47 39 31 47 45 53 52 27 37 58 42 58 52 52 53 40 40 37 39 26 49 41 53 53 42 32 54 41 37 54 54 40 53 53 53 53 37 49 44 31 42 51 54 40 25 47 40 51 41 45 39 37 54 54 54 54 40 37 32 40 34 45 53 53 34 53 45 54 39 45 26 40 52 38 37 14 54 34 42 33 32 34 17 46 47 26 24 46 47 44 29 44 32 53 24 31 32 52 36 30 35 40 34 52 47 34 35 53 53 29 52 31 31 31 21 15 53 40 41 33 23 35 29 46 46 46 31 32 29 31 53 31 24 51 51 40 28 42 43 31 36 31 24 51 51 34 19 9 20 31 30 30 25 31 23 51 31 30 33 25 16 31 51 26 31 31 20 45 42 42 31 33 32 42 24 42 36 27 33 9 38 33 31 36 43 31 30 35 32 30 36 34 46 37 22 34 31 42 32 31 24 28 27 25 26 26 37 31 37 27 28 22 25 46 31 31 35 26 27 31 46 33 24 21 23 11 20 21 26 25 24 32 26 32 28 31 32 31 21 38 30 33 36 28 33 17 24 31 24 42 21 33 30 21 26 22 30 12 30 27 26 36 29 21 24 15 33 31 23 35 33 36 34 31 30 25 21 32 44 38 32 19 11 26 20 33 31 34 27 37 23 28 21 32 13 14 29 6 12 18 14 12 31 48 48 37 32 16 18 17 11 9 31 21 19 27 22 28 16 17 22 10 8 8 11 16 16 6 5 10 13 12 7 5 3 17 18 19 14 17 22 6 10 9 10 25 20 28 16 13 5 5 22 7 6 19 13 19 16 24 12 14 20 27 6 7 6 18 12 7 15 28 14 13 19 16 5 18 13 6 27 10 7 15 16 27 7 6 5 12 17 5 8 4 9 3 7 6 26 16 7 14 11 6 5 3 2 3 8 12 17 6 7 12 18 13 22 6 13 6 5 12 10 7 7 7 4 21 7	Open. Hide. 62 47 42 39 62 62 62 62 62 43 38 51 45 32 32 31 20 50 39 30 49 62 59 59 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 54 62 59 59 62 62 62 62 62 59 59 59 59 62 59 62 62 62 62 62 62 62 62 59 54 62 62 59 62 62 62 59 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 54 42 56 56 56 62 62 62 46 46 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 54 47 62 62 62 62 54 47 62 62 62 62 62 62 54 62 62 54 58 58 58 58 54 58 58 54 58 58 58 48 51 58 58 58 54 54 58 58 54 58 58 58 49 58 41 41 54 54 58 58 58 58 58 58 54 58 58 49 38 58 58 52 58 35 54 58 58 58 58 54 54 52 52 52 58 58 58 58 58 34 54 52 58 41 47 54 42 58 58 46 54 52 58 49 47 58 58 58 54 49 54 58 38 47 51 46 49 40 58 51 51 16 58 42 36 58 53 58 53 58 58 58 49 45 49 52 53 49 58 51 50 51 50 49 58 48 50 50 51 50 31 58 39 26 58 46 48 50 51 54 49 52 53 33 52 30 50 31 36 51 58 37 58 37 35 58 50 46 58 50 51 41 29 58 58 58 28 54 58 50 50 50 50 58 58 58 58 43 50 42 51 43 40 22 58 30 31 17 41 53 52 50 51 51 40 30 52 37 39 50 32 36 24 43 58 49 32 53 52 53 37 39 34 28 29 54 54 32 52 42 37 40 39 53 52 54 54 45 54 53 32 53 50 21 41 53 42 31 45 53 50 40 39 20 54 54 40 45 46 42 37 34 37 24 38 41 42 34 53 34 21 54 51 28 32 33 35 35 47 42 42 31 42 40 34 47 33 53 45 34 52 23 22 12 33 31 54 54 33 32 47 24 32 32 42 51 52 44 12 6 33 53 32 45 40 37 21 26 33 36 26 24 34 32 35 35 32 46 45 39 41 33 17 52 32 22 40 38 34 28 45 51 51 31 24 32 15 51 46 38 31 18 36 30 31 29 31 42 30 31 33 35 31 45 34 28 33 24 43 24 51 9 33 15 23 29 31 19 31 37 42 33 25 25 31 46 46 44 37 48 48 46 31 31 27 33 19 31 31 25 29 31 36 20 6 26 32 22 33 31 27 20 31 25 23 15 29 18 11 9 6 33 41 32 32 17 34 31 32 32 20 25 46 23 31 27 26 30 34 25 24 41 27 32 21 30 23 31 29 31 31 27 46 31 30 14 10 32 22 13 9 27 28 29 22 14 31 44 33 21 48 32 25 29 22 15 25 20 23 25 31 11 18 21 22 16 30 10 32 27 6 5 10 24 28 30 16 12 14 14 25 23 31 33 10 8 7 13 31 14 22 11 22 16 23 7 12 8 19 32 6 4 4 6 6 24 29 28 13 12 15 26 39 14 11 21 19 11 9 23 13 7 7 5 6 23 32 10 7 18 31 8 4 9 9 5 6 11 6 15 4 12 15 7 5 8 5 27 7 8 24 11 16 6 9 22 8 18 9 7 20 24 27 19 20 10 25 15 8 21 9 10 14

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_144329072_144330193
seq2: B6Ng01-281E07.b_48_1167

seq1  GAATTCTCAGATGAAAAGCACAAATAGACAGGGTAGTTTTTTAATACTAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCAGATGAAAAGCACAAATAGACAGGGTAGTTTTTTAATACTAA  50

seq1  AAATCTTTATCCACCATAAAATGCCATTTCATTTTTAAATGTATTTATGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATCTTTATCCACCATAAAATGCCATTTCATTTTTAAATGTATTTATGT  100

seq1  CTATGAGTCTGCATGTATGTTTGTGCAGCATACACATGACTGATTGTGAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATGAGTCTGCATGTATGTTTGTGCAGCATACACATGACTGATTGTGAA  150

seq1  AAGAGCACTGTATCCTCTAGAAATGGAGTTAGTAAAAATTGTGAGCCTTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGCACTGTATCCTCTAGAAATGGAGTTAGTAAAAATTGTGAGCCTTC  200

seq1  ATTTAGGTTCTATGACTGTGGGTCCTCTGAAAGAGCATCCAATGCTTGTA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTAGGTTCTATGACTGTGGGTCCTCTGAAAGAGCATCCAATGCTTGTA  250

seq1  AGTACTGACCCAATTCTCCAGTCACATGAAATGCAATTCTATATCATCTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTACTGACCCAATTCTCCAGTCACATGAAATGCAATTCTATATCATCTC  300

seq1  AGTGAGAATGGATGCAATCAAGAAAACAACAAATGCTTGTGAAGAAGTAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGAGAATGGATGCAATCAAGAAAACAACAAATGCTTGTGAAGAAGTAG  350

seq1  AAACATGGGATTCTTATCGTCTGTTGTTGTGAGAGTGTGCTGGCTGTTCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACATGGGATTCTTATCGTCTGTTGTTGTGAGAGTGTGCTGGCTGTTCT  400

seq1  TGAGTCTACTTAACCCACAAATGTGTTATCTGAGGGGAGGAAACCTCAGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGTCTACTTAACCCACAAATGTGTTATCTGAGGGGAGGAAACCTCAGT  450

seq1  AAAGATGATGCCACCATAATATCCAGCTGTAAATTCTCTTCTTAATTAGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGATGATGCCACCATAATATCCAGCTGTAAATTCTCTTCTTAATTAGT  500

seq1  GATTGATGTGAGAGGGCCCAGTTCTTTGTGGGTGGACTATCCCTGGAGTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTGATGTGAGAGGGCCCAGTTCTTTGTGGGTGGACTATCCCTGGAGTG  550

seq1  GTTCTGGGTTCTGTAAGAAAGTAGGATGAAAAGGCCAGGGAAACAATCTA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTGGGTTCTGTAAGAAAGTAGGATGAAAAGGCCAGGGAAACAATCTA  600

seq1  GAAAGTAGCATCCCTCCATGACCTCTGCATGAGATCCTGCTTCCAGGTTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGTAGCATCCCTCCATGACCTCTGCATGAGATCCTGCTTCCAGGTTT  650

seq1  CTGCCACGTTTGAATTACTATCCAGGCTTCTCTTAATAATAGACTACAAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCACGTTTGAATTACTATCCAGGCTTCTCTTAATAATAGACTACAAT  700

seq1  GTGGAAGTATAAGTCTAATAAACTCTCTCCTTCCCAACTTGCTTTTTTAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGAAGTATAAGTCTAATAAACTCTCTCCTTCCCAACTTGCTTTTTTAT  750

seq1  CATGATGTTTCATCACGGCAATAGAAACCCTAAGACAGGGAATAAAGTGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGATGTTTCATCACGGCAATAGAAACCCTAAGACAGGGAATAAAGTGG  800

seq1  TGCAGATTTCTCCAAAAACAGAAGAAAGAACTATTTCATTCAACCAAAGG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAGATTTCTCCAAAAACAGAAGAAAGAACTATTTCATTCAACCAAAGG  850

seq1  ACTTTACATTCTACCACAGAGGTATGTGAACTCCCACATTCATTGCTGCT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTACATTCTACCACAGAGGTATGTGAACTCCCACATTCATTGCTGCT  900

seq1  CCATTCTCAATTTCTAAGGAATGGAATCAGCTTAGATGGTCATCAATTAA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATTCTCAATTTCTAAGGAATGGAATCAGCTTAGATGGTCATCAATTAA  950

seq1  TAAATGTATGATGGTGGCAAAATACATACATAAGCACAACACAATTTTGT  1000
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  TAAATGTATGATGGTGGCAAAATACATACATAAGCAC-ACACAATTTTGT  999

seq1  TCAGACCAGCAACGTGACCAATACCAAGGGCAGGGTAGCATACAGAAGCC  1050
      ||||||||||||||||||||||||| |||||||| |||||||||||||||
seq2  TCAGACCAGCAACGTGACCAATACC-AGGGCAGGTTAGCATACAGAAGCC  1048

seq1  ACCTCTTGAAGCTCTTACAAGACCTTCTGCTAG-ACATCCTGCCCAACTC  1099
      |||||||| |||||||||||||| ||||||||| |||| |||||||||||
seq2  ACCTCTTG-AGCTCTTACAAGACTTTCTGCTAGAACAT-CTGCCCAACTC  1096

seq1  CTTGAGCATCCTGA--CTCTGAGAC  1122
      | ||||||||||||  |||||||||
seq2  C-TGAGCATCCTGAACCTCTGAGAC  1120

seq1: chr4_144464554_144465621
seq2: B6Ng01-281E07.g_66_1136 (reverse)

seq1  GCTCCTT-CACCT-ACCCATTCGATGCTCATATCCCTCTCCAAACAA--T  46
      ||||||| ||||| ||||| |||||||||||||||   |||||||||  |
seq2  GCTCCTTCCACCTAACCCAATCGATGCTCATATCCTCTTCCAAACAAATT  50

seq1  GTGCCTAGCAAACTGAGAACCCCTGAACCTCCTATGTATATCAGGCATAC  96
      |||| |||||||||||||| |||||||| |||||||||||||||||||||
seq2  GTGCTTAGCAAACTGAGAA-CCCTGAACTTCCTATGTATATCAGGCATAC  99

seq1  TTGAATCTCTTAACAGTACTATAAATTTCTCCACTCTTAGAAACAGTCTC  146
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  TTGAATCTCTTAACAGTACTATAAATTTCTCCACTCTAAGAAACAGTCTC  149

seq1  ATTTAGACAGTTTCTAGTCGAGAATATTCCCAATATGTCCTATATGAAGA  196
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTAGACAGTTTCTAGTCGAGAATATTCCCAATATGTCCTATATGAAGA  199

seq1  ATAAAAGGGGCAGCCAGCATGAACCAATGCCAGGCACATGTACGAAAAGG  246
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  ATAAAAGGGGCAGCCAGCATGACCCAATGCCAGGCACATGTACGAAAAGG  249

seq1  CAAACTGAGTCCTTCAAGTGAACTTTCAGAGAGAATCCCCTATTTATTTA  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAACTGAGTCCTTCAAGTGAACTTTCAGAGAGAATCCCCTATTTATTTA  299

seq1  ATCTTAGGCCTATGCATACTTGGGCATGCATATAATTAAAATCAGATGCA  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTAGGCCTATGCATACTTGGGCATGCATATAATTAAAATCAGATGCA  349

seq1  TTATGGGAAAGGATGAGTTCTGTAGGAAGAATGGGCACATGGCATAATCT  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATGGGAAAGGATGAGTTCTGTAGGAAGAATGGGCACATGGCATAATCT  399

seq1  ATCAATCAAAATACAGAACCCCTCAAGCCACTCTCCACTGTAGCCAGCCC  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAATCAAAATACAGAACCCCTCAAGCCACTCTCCACTGTAGCCAGCCC  449

seq1  CTCCTTCCTTTAGACCCTATAAGAAAGACATCCTAGGCCATAGACTAAAA  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTTCCTTTAGACCCTATAAGAAAGACATCCTAGGCCATAGACTAAAA  499

seq1  CTCTAGAATATTCTCTCGCTTGTGACCAGCTGTAAATCTTGATGATATAT  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTAGAATATTCTCTCGCTTGTGACCAGCTGTAAATCTTGATGATATAT  549

seq1  TCTCTCTAATCCATATTAACCCTTCATTTCTAATAAATTTCTATCCCTTT  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTCTAATCCATATTAACCCTTCATTTCTAATAAATTTCTATCCCTTT  599

seq1  GCAAATTTATGTAGCCCTCATTTTCAGTTCTTTAAGTGATAGGCAAAGAA  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAATTTATGTAGCCCTCATTTTCAGTTCTTTAAGTGATAGGCAAAGAA  649

seq1  CCTGGAAACATTCACTCAGACACACACACACACCCTTGCAGGAACAGTTG  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGAAACATTCACTCAGACACACACACACACCCTTGCAGGAACAGTTG  699

seq1  TACCAGAGAGTCCATTCTCAATCAACAGTCAGCTCTCAGCCTCAATCACC  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCAGAGAGTCCATTCTCAATCAACAGTCAGCTCTCAGCCTCAATCACC  749

seq1  ATGTAATTACACCCCAGCCATGCAGTAAATCTCCATCTTGCAATATCTTG  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTAATTACACCCCAGCCATGCAGTAAATCTCCATCTTGCAATATCTTG  799

seq1  GGAGAGGCAGGAGAGAGGAGGAGGAAGACAGCATTTCCCAATAACTTGTT  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGAGGCAGGAGAGAGGAGGAGGAAGACAGCATTTCCCAATAACTTGTT  849

seq1  GTGCTTGGCCCAAAGTATCTGGGGAAGATATGGTGAGGCTCATGCCCTAT  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTTGGCCCAAAGTATCTGGGGAAGATATGGTGAGGCTCATGCCCTAT  899

seq1  AAGAATGCCCTGGTATCACCAGGCTATGGTGATGCATCTGCCGGAACCCC  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAATGCCCTGGTATCACCAGGCTATGGTGATGCATCTGCCGGAACCCC  949

seq1  CTGCCCCATTCCAACCCATTCTGTGGGCTAGGCCAGGCCCTGTATGCTGC  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCCCATTCCAACCCATTCTGTGGGCTAGGCCAGGCCCTGTATGCTGC  999

seq1  AGTGTAAATCCTCCCAACTACCCCAGCCTTGGGAGCAGATCCCTTGGGGT  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGTAAATCCTCCCAACTACCCCAGCCTTGGGAGCAGATCCCTTGGGGT  1049

seq1  CACTATCAAGAGCCAAGAATTC  1068
      ||||||||||||||||||||||
seq2  CACTATCAAGAGCCAAGAATTC  1071

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information