MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-288I21
Chromosome	4 (Build37)
Map Location	87,354,971 - 87,490,851
singlet/doublet	doublet
Overlap gene	Mllt3
Upstream gene	EG624685, Dennd4c, Rps6, Asah3l, Slc24a2
Downstream gene	BC057079, Ptplad2, Ifnb1, OTTMUSG00000007655, Ifna14, Ifna9, Mrpl48-ps, Ifna12, C87499, Ifna13, LOC546834, OTTMUSG00000011275, Ifna2, Ifnab, LOC546835, Klhl9, LOC100040477, Ifnz, LOC100041062, EG545645, LOC668147, OTTMUSG00000011291, OTTMUSG00000011290, OTTMUSG00000011265, Ifnz, OTTMUSG00000011269, OTTMUSG00000011270, OTTMUSG00000011272, OTTMUSG00000011268, OTTMUSG00000011273, OTTMUSG00000011282, OTTMUSG00000011285, OTTMUSG00000011289, Ifna7, Ifna11, Ifna6, Ifna5, Ifna4
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG624685 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624685 MGI:3645185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Dennd4c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329877 MGI:1914769
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20104 MGI:98159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asah3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230379 MGI:1920932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc24a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76376 MGI:1923626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mllt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70122 MGI:1917372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	BC057079 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230393 MGI:2676921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptplad2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66775 MGI:1914025
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifnb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15977 MGI:107657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000007655 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242517 MGI:3649418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifna14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404549 MGI:3641425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifna9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15972 MGI:107659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl48-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269553 MGI:3050089
definition	note : mitochondrial ribosomal protein L48 pseudogene pseudo : _no_value

name	Ifna12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242519 MGI:2676324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C87499 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381590 MGI:2140706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifna13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230396 MGI:2667155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546834 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546834
definition	note : interferon-alpha 3 pseudogene pseudo : _no_value

name	OTTMUSG00000011275 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230398 MGI:3649260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifna2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15965 MGI:107666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifnab (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15974 MGI:1097683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546835 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546835
definition	note : interferon-alpha 2 pseudogene pseudo : _no_value

name	Klhl9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242521 MGI:2180122
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040477 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040477
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ifnz (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC100041062 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041062
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG545645 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545645 MGI:3704097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins

name	LOC668147 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 4 Proteins

name	OTTMUSG00000011291 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545646 MGI:3701990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs

name	OTTMUSG00000011290 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545647 MGI:3701987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs

name	OTTMUSG00000011265 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545648 MGI:3701968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins

name	Ifnz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319146 MGI:2448469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000011269 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545649 MGI:3701972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 4 Proteins

name	OTTMUSG00000011270 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545650 MGI:3701974
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 4 Proteins

name	OTTMUSG00000011272 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545651 MGI:3701976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins

name	OTTMUSG00000011268 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545652 MGI:3701970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins

name	OTTMUSG00000011273 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545653 MGI:3701978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins

name	OTTMUSG00000011282 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545654 MGI:3701981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 4 Proteins

name	OTTMUSG00000011285 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545655 MGI:3701983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs

name	OTTMUSG00000011289 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668208 MGI:3701985
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs

name	Ifna7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15970 MGI:107661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifna11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15964 MGI:109210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifna6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15969 MGI:107662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifna5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15968 MGI:107663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifna4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15967 MGI:107664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dennd4c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486609 GeneID:329877 MGI:1914769
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DENN/MADD domain containing 4C transcript_id : NM_001081014.1

name	Rps6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358015 GeneID:20104 MGI:98159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S6 transcript_id : NM_009096.3

name	Asah3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21314857 GeneID:230379 MGI:1920932
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acylsphingosine amidohydrolase 3-like transcript_id : NM_139306.1

name	Slc24a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378012 GeneID:76376 MGI:1923626
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 transcript_id : NM_172426.2

name	Mllt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205415 GeneID:70122 MGI:1917372
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid/lymphoid or mixed lineage-leukemia translocation to 3 homolog (Drosophila) transcript_id : NM_027326.3

name	Mllt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205403 GeneID:70122 MGI:1917372
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid/lymphoid or mixed lineage-leukemia translocation to 3 homolog (Drosophila) transcript_id : NM_029931.2

name	BC057079 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487122 GeneID:230393 MGI:2676921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC057079 transcript_id : NM_001081184.1

name	Ptplad2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371211 GeneID:66775 MGI:1914025
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase-like A domain containing 2 transcript_id : NM_025760.3

name	Ifnb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754303 GeneID:15977 MGI:107657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon beta 1, fibroblast transcript_id : NM_010510.1

name	OTTMUSG00000007655 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46047407 GeneID:242517 MGI:3649418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000007655 transcript_id : NM_206870.1

name	Ifna14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46195447 GeneID:404549 MGI:3641425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon, alpha 14 transcript_id : NM_206975.1

name	Ifna9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754297 GeneID:15972 MGI:107659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 9 transcript_id : NM_010507.1

name	Ifna12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340762 GeneID:242519 MGI:2676324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 12 transcript_id : NM_177361.2

name	C87499 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350864 GeneID:381590 MGI:2140706
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C87499 transcript_id : NM_198663.2

name	Ifna13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340904 GeneID:230396 MGI:2667155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 13 transcript_id : NM_177347.2

name	OTTMUSG00000011275 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46047410 GeneID:230398 MGI:3649260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000011275 transcript_id : NM_206867.1

name	Ifna2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126722648 GeneID:15965 MGI:107666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 2 transcript_id : NM_010503.2

name	Ifnab (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865992 GeneID:15974 MGI:1097683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha B transcript_id : NM_008336.2

name	Klhl9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244067 GeneID:242521 MGI:2180122
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 9 (Drosophila) transcript_id : NM_172871.2

name	LOC100040477 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252602 GeneID:100040477
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040477 transcript_id : XM_001474761.1

name	Ifnz (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:51709340 GeneID:435791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : interferon zeta transcript_id : XM_487805.1

name	EG545645 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371950 GeneID:545645 MGI:3704097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins product : predicted gene, EG545645 transcript_id : XM_620066.3

name	LOC668147 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94371951 GeneID:668147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 4 Proteins product : similar to novel member of the interferon zeta family Ifnz transcript_id : XM_994561.1

name	OTTMUSG00000011291 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371953 GeneID:545646 MGI:3701990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs product : predicted gene, OTTMUSG00000011291 transcript_id : XM_620067.3

name	OTTMUSG00000011290 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371954 GeneID:545647 MGI:3701987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs product : predicted gene, OTTMUSG00000011290 transcript_id : XM_620068.3

name	OTTMUSG00000011265 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371955 GeneID:545648 MGI:3701968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins product : predicted gene, OTTMUSG00000011265 transcript_id : XM_620069.3

name	Ifnz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802456 GeneID:319146 MGI:2448469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon zeta transcript_id : NM_197889.2

name	OTTMUSG00000011269 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371956 GeneID:545649 MGI:3701972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 4 Proteins product : predicted gene, OTTMUSG00000011269 transcript_id : XM_620070.3

name	OTTMUSG00000011270 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371957 GeneID:545650 MGI:3701974
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 4 Proteins product : predicted gene, OTTMUSG00000011270 transcript_id : XM_620071.3

name	OTTMUSG00000011272 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371958 GeneID:545651 MGI:3701976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins product : predicted gene, OTTMUSG00000011272 transcript_id : XM_620072.3

name	OTTMUSG00000011268 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371959 GeneID:545652 MGI:3701970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins product : predicted gene, OTTMUSG00000011268 transcript_id : XM_620073.3

name	OTTMUSG00000011273 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371960 GeneID:545653 MGI:3701978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 4 Proteins product : predicted gene, OTTMUSG00000011273 transcript_id : XM_620074.3

name	OTTMUSG00000011282 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371961 GeneID:545654 MGI:3701981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 4 Proteins product : predicted gene, OTTMUSG00000011282 transcript_id : XM_620075.3

name	OTTMUSG00000011285 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371962 GeneID:545655 MGI:3701983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs product : predicted gene, OTTMUSG00000011285 transcript_id : XM_620076.3

name	OTTMUSG00000011289 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371963 GeneID:668208 MGI:3701985
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs product : predicted gene, OTTMUSG00000011289 transcript_id : XM_001000025.1

name	Ifna7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45598383 GeneID:15970 MGI:107661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 7 transcript_id : NM_008334.2

name	Ifna11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680364 GeneID:15964 MGI:109210
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 11 transcript_id : NM_008333.1

name	Ifna6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46047422 GeneID:15969 MGI:107662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 6 transcript_id : NM_206871.1

name	Ifna5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754295 GeneID:15968 MGI:107663
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 5 transcript_id : NM_010505.1

name	Ifna4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754293 GeneID:15967 MGI:107664
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha 4 transcript_id : NM_010504.1

name	Dennd4c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486610 GeneID:329877 MGI:1914769
definition	codon_start : 1 note : likely ortholog of H. sapiens chromosome 9 open reading frame 55 (C9orf55) product : DENN/MADD domain containing 4C protein_id : NP_001074483.1

name	Rps6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677809 CCDS:CCDS18310.1 GeneID:20104 MGI:98159
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0042593 - glucose homeostasis [Evidence IDA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein S6 protein_id : NP_033122.1

name	Asah3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314858 CCDS:CCDS18311.1 GeneID:230379 MGI:1920932
definition	GO_component : GO:0005789 - endoplasmic reticulum membrane [Evidence IEA]; GO:0000139 - Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0017040 - ceramidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016811 - hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides [Evidence IEA] GO_process : GO:0006672 - ceramide metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : cancer related gene-liver 1; ceramide hydrolase; cancer related gene-liver 1 (CRG-L1) product : alkaline ceramidase 2 protein_id : NP_647467.1

name	Slc24a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369563 CCDS:CCDS18312.1 GeneID:76376 MGI:1923626
definition	codon_start : 1 product : solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 protein_id : NP_766014.1

name	Mllt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205416 GeneID:70122 MGI:1917372
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0007379 - segment specification [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; myeloid/lymphoid or mixed lineage-leukemia translocation to 3 homolog product : myeloid/lymphoid or mixed lineage-leukemia translocation to 3 homolog isoform 1 protein_id : NP_081602.3

name	Mllt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205404 GeneID:70122 MGI:1917372
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0007379 - segment specification [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; myeloid/lymphoid or mixed lineage-leukemia translocation to 3 homolog product : myeloid/lymphoid or mixed lineage-leukemia translocation to 3 homolog isoform 2 protein_id : NP_084207.2

name	BC057079 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487123 GeneID:230393 MGI:2676921
definition	codon_start : 1 note : novel protein containing HEAT repeats product : hypothetical protein LOC230393 protein_id : NP_001074653.1

name	Ptplad2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385228 CCDS:CCDS18317.1 GeneID:66775 MGI:1914025
definition	codon_start : 1 product : protein tyrosine phosphatase-like A domain containing 2 protein_id : NP_080036.1

name	Ifnb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754304 CCDS:CCDS18318.1 GeneID:15977 MGI:107657
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IDA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IDA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : interferon beta 1 fibroblast product : interferon beta, fibroblast protein_id : NP_034640.1

name	OTTMUSG00000007655 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46047408 CCDS:CCDS18319.1 GeneID:242517 MGI:3649418
definition	codon_start : 1 note : alpha-interferon; novel interferon alpha (Ifna) family member product : alpha-interferon precursor protein_id : NP_996753.1

name	Ifna14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46195448 CCDS:CCDS18320.1 GeneID:404549 MGI:3641425
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : interferon alpha 14 (Ifna14) product : interferon, alpha 14 protein_id : NP_996858.1

name	Ifna9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754298 CCDS:CCDS18321.1 GeneID:15972 MGI:107659
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : interferon alpha family gene 9 product : interferon alpha family, gene 9 protein_id : NP_034637.1

name	Ifna12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893507 CCDS:CCDS18322.1 GeneID:242519 MGI:2676324
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : interferon alpha family gene 12 product : interferon alpha family, gene 12 protein_id : NP_796335.1

name	C87499 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348560 GeneID:381590 MGI:2140706
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC381590 protein_id : NP_941065.1

name	Ifna13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893479 CCDS:CCDS18324.1 GeneID:230396 MGI:2667155
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : interferon alpha-13 product : interferon alpha family, gene 13 protein_id : NP_796321.1

name	OTTMUSG00000011275 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46047411 CCDS:CCDS18325.1 GeneID:230398 MGI:3649260
definition	codon_start : 1 note : novel member of the interferon alpha family Ifna product : interferon alpha 6T protein_id : NP_996750.1

name	Ifna2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126722649 CCDS:CCDS18326.1 GeneID:15965 MGI:107666
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : novel member of the interferon alpha family Ifna product : interferon alpha family, gene 2 protein_id : NP_034633.2

name	Ifnab (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865993 CCDS:CCDS18327.1 GeneID:15974 MGI:1097683
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : novel member of the interferon alpha family Ifna product : interferon alpha family, gene B protein_id : NP_032362.2

name	Klhl9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244068 GeneID:242521 MGI:2180122
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : kelch-like 9 protein_id : NP_766459.2

name	LOC100040477 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252603 GeneID:100040477
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474811.1

name	Ifnz (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51709341 GeneID:435791
definition	codon_start : 1 product : similar to interferon zeta protein_id : XP_487805.1

name	EG545645 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63514576 GeneID:545645 MGI:3704097
definition	codon_start : 1 product : similar to novel member of the interferon zeta family Ifnz protein_id : XP_620066.1

name	LOC668147 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94371952 GeneID:668147
definition	codon_start : 1 product : similar to novel member of the interferon zeta family Ifnz protein_id : XP_999655.1

name	OTTMUSG00000011291 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252612 GeneID:545646 MGI:3701990
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620067.2

name	OTTMUSG00000011290 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252613 GeneID:545647 MGI:3701987
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620068.2

name	OTTMUSG00000011265 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63514587 GeneID:545648 MGI:3701968
definition	codon_start : 1 product : similar to novel member of the interferon zeta family Ifnz protein_id : XP_620069.1

name	Ifnz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37497122 CCDS:CCDS18333.1 GeneID:319146 MGI:2448469
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA]; GO:0005132 - interferon-alpha/beta receptor binding [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0030183 - B cell differentiation [Evidence IDA]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IDA]; GO:0006952 - defense response [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : limitin; novel member of the interferon zeta family Ifnz product : interferon zeta protein_id : NP_922871.1

name	OTTMUSG00000011269 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63514591 GeneID:545649 MGI:3701972
definition	codon_start : 1 product : similar to novel member of the interferon zeta family Ifnz protein_id : XP_620070.1

name	OTTMUSG00000011270 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63514595 GeneID:545650 MGI:3701974
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620071.1

name	OTTMUSG00000011272 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63514599 GeneID:545651 MGI:3701976
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620072.1

name	OTTMUSG00000011268 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63514603 GeneID:545652 MGI:3701970
definition	codon_start : 1 product : similar to novel member of the interferon zeta family Ifnz protein_id : XP_620073.1

name	OTTMUSG00000011273 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63514606 GeneID:545653 MGI:3701978
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620074.1

name	OTTMUSG00000011282 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63514610 GeneID:545654 MGI:3701981
definition	codon_start : 1 product : similar to novel member of the interferon zeta family Ifnz protein_id : XP_620075.1

name	OTTMUSG00000011285 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252614 GeneID:545655 MGI:3701983
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620076.2

name	OTTMUSG00000011289 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252615 GeneID:668208 MGI:3701985
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001000025.2

name	Ifna7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45598384 CCDS:CCDS18342.1 GeneID:15970 MGI:107661
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : interferon alpha family, gene 7 product : interferon alpha 7 protein_id : NP_032360.2

name	Ifna11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680365 GeneID:15964 MGI:109210
definition	GO_process : GO:0009615 - response to virus [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : IFNa11 (B6); type I interferon; has confirmed antiviral activity product : interferon alpha family, gene 11 protein_id : NP_032359.1

name	Ifna6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46047423 GeneID:15969 MGI:107662
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : interferon alpha family, gene 8; interferon alpha 8/6 product : interferon alpha family, gene 6 protein_id : NP_996754.1

name	Ifna5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754296 CCDS:CCDS18345.1 GeneID:15968 MGI:107663
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : interferon alpha family, gene 5 protein_id : NP_034635.1

name	Ifna4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754294 CCDS:CCDS18346.1 GeneID:15967 MGI:107664
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : MuIFN-alpha 4; interferon alpha family, gene 4 product : interferon, alpha 4 protein_id : NP_034634.1

name	LOC100041062 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041062
definition	number : 1 pseudo : _no_value

name	EG624685 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149252611 GeneID:624685 MGI:3645185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG624685 transcript_id : XR_035266.1

clone name	MSMg01-106H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440A03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-356G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450M23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-545E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335H01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-157C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-546A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542N03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-530J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175O10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-535G23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-478K07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-329L22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-448K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145A08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-361M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526L09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-416D12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-525I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323D11
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-319E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246E02
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-288I21.b	B6Ng01-288I21.g
ACC	GA086187	GA086188
length	1,102	1,172
definition	B6Ng01-288I21.b	B6Ng01-288I21.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(87,354,971 - 87,356,075)	(87,489,691 - 87,490,851)
sequence	gaattccagtttcctttcaaattttctctttgtaaaaggaccattccctc ctctgttccctaggctgggctccttccctgtctcctgcttaatcctctct aatatacacaacacattgctccctgcttccctccatcccaccgggccatt caggttactgcctcacagtgggcctttctagagagcccctttctccatca gccatttctgcactctctttcccccacccccaaactaattctcttgccct atttccaagatgttatctgagctggctagatgtagtactttgcagatcat taaactgccccctgtataatttacagatccctccaacgatgcatgtctga ctatagatgtcaccaacagatgtctggggagttacatcctagccagtata tgctcccccgcagctctgagagttacactccgtctttattctccctctcc tcctgggctagcagtctccaccagaaagatgctgctgtttctctctttga taagatttcctcttttatttcctctgctcatacccaacagatacctccaa agagtcaattgactgagcttatcagcaaacagatggccccttcttctcac gtcgtctctaggtgctgtagacaaacaacatcagatcagatgtgtttcta caactgcttttattttcaaagcatcttaggaagaaagagctcaagaaagg gactggtacatatgtcacaggcaaaaggaactcatcttcaatcgtcatca ctacccaaataatcttgtttacttggacttcaacttgtttacaaaatatt aaatcttaaagcagcttgaaagttgcatgtaacatgtggaaaggaacaaa atatagacaaagaaataagacaataaagagggttcaggtaacctgtagcg atggtatgaaatatgactgatataagatccactgtaactcctccttattt ttatttttatttttatatttatattaccaagggcctgtgcaggtgaagct ctaatatcatagactgagtcctgtattagttcctgaatgcatttaatcaa tttgtccctggagcttcctaacagccaaagcaaaagggaaatgcggtcag cg	gaattccatatacatgaggcagatcagcttccattctgtgtcagaggcag ttggatgcctgagtgtctgagctactgctttatctgttatgtgtcggagt gtagagcctggtgacatgtatttaaactgctgtttgctaccagcccgagc taaaggaagtgctcctgagtgtcgggagactgcctgtgtacttttgttac tttctgaattttgccatggacattgttagagaaaagtatttgtcttcaat ttgagtcttcgtacaaagaaggcttttagaagtaattatttcatttaatt ttaaaatgatttatttcttttgtatgtttgattatattgcgtatgtgtgt gtgtgcgcaccaggagcatgcagattggtgattcctggggagcttgtcag gtccctagaactggagggtgacccattaggagtggctgtgaactgccatg taggtgctgcgaatcaatcccgcatctactgcaggagcagcagctgctct tacccacggggccatctttacagtccttaattggttttttttcaagacag ggcctcactatgtagccctgggtggtcttgaacttgtactgtagatgaag gctaggctgactttagactcaaggagatatgcctgtcctcctgagtactg agcattctgtcctttgctgtcacacccaagaaagggttagtaaggtgata atgataaagggagaaagagcaagactagtgaagccatttgcttgtttgcg ttgataaaagagtacactaaatgccaagactagcacaagtatatttctgt atttcttaactattttatatgcatgggataaagacaagagcatgcttttc tatcatataaagatttgatctagctttactgtgtactgtgattataaatt tgtattccattgtgtgtatgtgtgcatcgcctgtggcggtcagagggctc ctggtgtatgtctgtttttgtctttctaccatgttgggtcctggggatca atgcagtggctaggcttgaccagcatcacttttaccctgcttgagccatt ctctctggaccccacccactgtgtactttattaggatttcctgtgttcct acaagaaaggattttattaaataaataattcaggttcccctgtacaggtc cctctacctccttgatgtttat
quality values	Open. Hide. 49 31 14 22 58 58 31 16 49 62 62 62 62 62 54 62 62 37 12 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 43 34 49 29 35 44 27 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 51 49 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 52 47 62 52 54 43 62 58 58 58 58 58 58 58 58 54 54 58 58 58 58 52 58 54 58 58 58 58 58 54 58 52 58 58 54 52 58 54 58 47 54 54 54 58 58 58 58 54 34 58 54 46 58 54 54 52 58 54 58 58 58 54 58 58 58 54 42 58 58 58 54 58 54 47 52 58 52 58 58 54 49 58 45 39 58 48 27 54 47 41 47 58 54 58 58 46 53 53 41 51 58 58 50 53 58 47 58 49 49 50 28 58 53 58 47 58 58 46 53 31 42 46 43 58 58 51 54 58 51 50 54 53 52 40 50 50 50 41 32 51 36 54 52 58 50 58 51 50 53 30 42 19 49 50 51 51 50 53 58 58 40 35 41 58 58 51 40 32 58 51 53 52 37 43 50 53 50 44 12 21 32 51 37 51 58 50 46 58 23 40 49 40 39 34 39 53 58 50 37 58 44 32 21 35 58 51 40 27 40 32 52 41 53 51 41 50 41 50 40 12 41 40 49 58 58 51 33 49 32 42 34 52 43 39 52 49 53 39 45 21 54 45 53 42 35 42 34 53 40 30 39 39 39 40 44 35 31 30 23 44 35 35 37 45 35 52 54 33 54 40 28 33 44 44 34 42 42 28 35 31 31 20 31 28 21 34 41 30 54 22 26 37 32 54 54 30 37 37 42 37 31 54 30 37 45 45 28 32 53 40 31 33 36 33 43 43 53 34 39 53 34 32 31 35 29 27 24 41 51 31 31 30 37 29 37 53 31 53 35 52 47 41 33 36 31 33 31 31 51 51 30 30 33 30 30 23 31 31 30 47 37 28 43 47 33 31 31 32 13 31 21 29 29 32 28 47 42 32 42 27 48 27 14 31 31 15 24 21 13 18 24 13 29 32 41 15 21 16 29 17 32 26 31 41 21 26 31 32 30 47 27 34 27 24 25 32 33 33 31 26 18 25 33 21 32 21 34 31 21 32 20 30 33 37 21 34 30 36 34 25 31 29 18 29 29 13 7 17 44 47 43 31 42 23 44 48 38 28 14 11 44 44 47 30 9 16 23 24 41 16 18 18 24 30 29 7 17 17 15 10 22 32 12 14 11 43 22 22 19 31 13 20 15 29 7 21 32 18 33 32 13 21 13 5 6 10 29 8 14 22 23 21 22 21 28 22 29 8 18 19 21 14 12 5 8 7 6 19 19 18 16 16 15 13 20 14 18 10 26 20 17 16 28 21 7 13 24 27 13 31 18 33 7 6 5 14 32 15 8 14 12 26 13 15 10 11 14 24 20 28 13 7 7 5 8 11 6 16 13 7 9 20 28 28 17 10 28 7 11 21 10 16 10 16 14 18 16 21 16 16 20 9	Open. Hide. 62 47 50 44 62 62 44 39 62 62 62 62 51 24 28 31 24 23 29 28 28 27 43 37 54 59 62 62 62 62 62 59 49 62 62 62 62 62 62 62 62 59 59 59 62 59 62 62 62 62 62 62 62 62 59 59 62 62 59 62 54 33 33 54 62 62 62 62 62 59 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 59 62 59 62 59 62 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 56 54 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 43 62 62 62 62 62 47 45 62 46 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 54 62 62 62 62 62 52 62 62 58 58 58 58 54 54 54 40 34 46 52 54 58 49 58 58 54 58 54 58 58 58 58 58 54 58 52 58 58 58 58 58 58 58 58 58 58 58 43 58 58 58 58 58 58 58 54 48 30 54 54 58 52 45 58 58 54 54 58 58 58 40 37 54 54 58 58 54 54 52 52 54 52 54 54 58 58 54 58 58 52 54 54 54 58 58 51 49 58 58 58 54 51 58 58 58 49 53 39 53 53 50 58 50 50 58 41 54 51 42 58 49 58 54 45 37 58 54 50 53 46 51 38 58 50 37 37 48 58 38 28 36 33 46 39 47 51 48 48 49 50 51 50 39 39 50 49 50 49 28 49 39 32 51 58 39 28 43 28 49 50 42 49 51 40 40 52 58 58 58 47 53 51 51 50 40 32 50 29 49 58 50 31 46 42 49 58 27 11 58 26 19 54 37 39 50 25 42 40 35 27 51 29 18 41 30 40 51 41 30 46 58 51 32 58 50 47 35 54 54 44 40 51 19 31 18 40 37 49 29 41 37 39 52 49 29 39 32 31 44 26 53 54 50 45 32 49 38 32 26 54 54 40 35 34 53 53 33 40 37 26 54 54 53 39 49 22 42 32 32 29 29 40 41 49 41 37 47 18 20 20 42 37 33 30 33 42 18 37 37 37 29 31 40 43 43 45 40 32 46 31 32 36 53 36 21 38 51 34 30 29 33 26 23 31 37 31 47 52 53 28 32 31 19 32 45 32 15 27 52 52 32 15 18 32 45 24 11 32 27 8 46 41 51 18 31 22 31 31 34 33 47 47 22 31 31 31 30 30 30 30 31 36 31 51 38 22 33 17 46 38 25 23 20 28 14 15 21 32 34 46 9 13 31 36 46 31 42 24 24 31 23 46 16 31 20 24 33 25 31 31 47 32 36 46 41 40 22 31 31 32 37 26 30 30 21 30 27 41 23 32 29 33 31 31 18 32 29 32 31 33 34 31 26 25 30 18 32 23 20 20 26 27 18 14 30 26 11 42 19 48 38 27 38 24 26 24 36 31 18 36 18 34 25 31 26 24 24 32 24 48 41 41 25 31 16 31 24 41 24 32 19 31 17 26 22 32 33 11 25 6 28 18 11 21 19 19 29 39 39 33 21 24 10 29 5 17 34 28 11 4 7 6 24 8 21 13 16 19 11 21 12 15 17 13 11 21 7 13 3 15 20 21 14 26 47 47 27 14 12 14 6 5 16 20 13 12 20 29 14 18 16 18 21 5 5 4 3 4 8 11 10 11 27 10 18 28 12 10 4 5 8 6 7 5 6 3 5 10 13 26 28 38 20 18 12 12 8 6 6 14 4 22 12 5 16 7 6 5 4 10 15 5 6 6 15 8 7 16 16 16 30 23 7 4 12 5 15 11 6 7 4 6 5 12 7 10 9 28 13 1 4 7 3 3 2 13 6 12 9 8 6 22 27 13 5 16 5 3 2 3 5 3 3 2 18 5 2 2 3 4 6 4 3 4 6 4 7 11 5 4 4 6 13 6 4 10

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_87354971_87356075
seq2: B6Ng01-288I21.b_49_1150

seq1  GAATTCCAGTTTCCTTTCAAATTTTCTCTTTGTAAAAGGACCATTCCCTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGTTTCCTTTCAAATTTTCTCTTTGTAAAAGGACCATTCCCTC  50

seq1  CTCTGTTCCCTAGGCTGGGCTCCTTCCCTGTCTCCTGCTTAATCCTCTCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGTTCCCTAGGCTGGGCTCCTTCCCTGTCTCCTGCTTAATCCTCTCT  100

seq1  AATATACACAACACATTGCTCCCTGCTTCCCTCCATCCCACCGGGCCATT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATATACACAACACATTGCTCCCTGCTTCCCTCCATCCCACCGGGCCATT  150

seq1  CAGGTTACTGCCTCACAGTGGGCCTTTCTAGAGAGCCCCTTTCTCCATCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGTTACTGCCTCACAGTGGGCCTTTCTAGAGAGCCCCTTTCTCCATCA  200

seq1  GCCATTTCTGCACTCTCTTTCCCCCACCCCCAAACTAATTCTCTTGCCCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCATTTCTGCACTCTCTTTCCCCCACCCCCAAACTAATTCTCTTGCCCT  250

seq1  ATTTCCAAGATGTTATCTGAGCTGGCTAGATGTAGTACTTTGCAGATCAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCCAAGATGTTATCTGAGCTGGCTAGATGTAGTACTTTGCAGATCAT  300

seq1  TAAACTGCCCCCTGTATAATTTACAGATCCCTCCAACGATGCATGTCTGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACTGCCCCCTGTATAATTTACAGATCCCTCCAACGATGCATGTCTGA  350

seq1  CTATAGATGTCACCAACAGATGTCTGGGGAGTTACATCCTAGCCAGTATA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATAGATGTCACCAACAGATGTCTGGGGAGTTACATCCTAGCCAGTATA  400

seq1  TGCTCCCCCGCAGCTCTGAGAGTTACACTCCGTCTTTATTCTCCCTCTCC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCCCCCGCAGCTCTGAGAGTTACACTCCGTCTTTATTCTCCCTCTCC  450

seq1  TCCTGGGCTAGCAGTCTCCACCAGAAAGATGCTGCTGTTTCTCTCTTTGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGGGCTAGCAGTCTCCACCAGAAAGATGCTGCTGTTTCTCTCTTTGA  500

seq1  TAAGATTTCCTCTTTTATTTCCTCTGCTCATACCCAACAGATACCTCCAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGATTTCCTCTTTTATTTCCTCTGCTCATACCCAACAGATACCTCCAA  550

seq1  AGAGTCAATTGACTGAGCTTATCAGCAAACAGATGGCCCCTTCTTCTCAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGTCAATTGACTGAGCTTATCAGCAAACAGATGGCCCCTTCTTCTCAC  600

seq1  GTCGTCTCTAGGTGCTGTAGACAAACAACATCAGATCAGATGTGTTTCTA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCGTCTCTAGGTGCTGTAGACAAACAACATCAGATCAGATGTGTTTCTA  650

seq1  CAACTGCTTTTATTTTCAAAGCATCTTAGGAAGAAAGAGCTCAAGAAAGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTGCTTTTATTTTCAAAGCATCTTAGGAAGAAAGAGCTCAAGAAAGG  700

seq1  GACTGGTACATATGTCACAGGCAAAAGGAACTCATCTTCAATCGTCATCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTGGTACATATGTCACAGGCAAAAGGAACTCATCTTCAATCGTCATCA  750

seq1  CTACCCAAATAATCTTGTTTACTTGGACTTCAACTTGTTTACAAAATATT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACCCAAATAATCTTGTTTACTTGGACTTCAACTTGTTTACAAAATATT  800

seq1  AAATCTTAAAGCAGCTTGAAAGTTGCATGTAACATGTGGAAAGGAACAAA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATCTTAAAGCAGCTTGAAAGTTGCATGTAACATGTGGAAAGGAACAAA  850

seq1  ATATAGACAAAGAAATAAGACAATAAAGAGGGTTCAGGTAACCTGTAGCG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATAGACAAAGAAATAAGACAATAAAGAGGGTTCAGGTAACCTGTAGCG  900

seq1  ATGGTATGAAATATGACTGATATAAGATCCACTGTAACTCCTCCTTTATT  950
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  ATGGTATGAAATATGACTGATATAAGATCCACTGTAACTCCTCC-TTATT  949

seq1  TTTATTTTTATTTTTATATTTATATTTACCAAGGGCCTTGTGCAGGTTGA  1000
      |||||||||||||||||||||||| |||||||||||| |||||||| |||
seq2  TTTATTTTTATTTTTATATTTATA-TTACCAAGGGCC-TGTGCAGG-TGA  996

seq1  AGCTCTATATTCATAGACTGAAGTCCTGTA-TAGTTCCTGAATGCATTTA  1049
      |||||||   |||||||||| ||||||||| |||||||||||||||||||
seq2  AGCTCTAATATCATAGACTG-AGTCCTGTATTAGTTCCTGAATGCATTTA  1045

seq1  ATCAAATTTGTCCCT-GAGCTTCCTAACAGCCAAAGCAAAAGGG-AATGC  1097
      ||| ||||||||||| |||||||||||||||||||||||||||| |||||
seq2  ATC-AATTTGTCCCTGGAGCTTCCTAACAGCCAAAGCAAAAGGGAAATGC  1094

seq1  GGTCAGCG  1105
      ||||||||
seq2  GGTCAGCG  1102

seq1: chr4_87489691_87490851
seq2: B6Ng01-288I21.g_69_1240 (reverse)

seq1  ATAAACATC-AGGAGGTGGAGGGGGACCTCTACAGGGGAACTTAAATTAT  49
      ||||||||| |||||||  || ||||||| ||||||||||| | ||||||
seq2  ATAAACATCAAGGAGGT--AGAGGGACCTGTACAGGGGAACCTGAATTAT  48

seq1  TTA-TTAATAAAAT-CTTTC-TGTAG---AACAGGAATTCTTAATAAAGT  93
      ||| |||||||||| ||||| |||||    ||||||| || |||||||||
seq2  TTATTTAATAAAATCCTTTCTTGTAGGAACACAGGAAATCCTAATAAAGT  98

seq1  ACACAGT-GGTGGG--TCAGAGAG-ATGGCTC-AGCA-GGTAAAAGTGAT  137
      ||||||| ||||||   ||||||| ||||||| |||| ||||||||||||
seq2  ACACAGTGGGTGGGGTCCAGAGAGAATGGCTCAAGCAGGGTAAAAGTGAT  148

seq1  GGCTGTCAAGCCTAGCCACCTGCATTTGATCCCCAGGA-CCAACATGGTA  186
      |   |||||||||||||| ||||| ||||||||||||| |||||||||||
seq2  GCTGGTCAAGCCTAGCCA-CTGCA-TTGATCCCCAGGACCCAACATGGTA  196

seq1  GAAAGACAAAAACAGACATACACCAGGAGCCCTCTGACCGCCACAGGCGA  236
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGACAAAAACAGACATACACCAGGAGCCCTCTGACCGCCACAGGCGA  246

seq1  TGCACACATACACACAATGGAATACAAATTTATAATCACAGTACACAGTA  286
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCACACATACACACAATGGAATACAAATTTATAATCACAGTACACAGTA  296

seq1  AAGCTAGATCAAATCTTTATATGATAGAAAAGCATGCTCTTGTCTTTATC  336
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCTAGATCAAATCTTTATATGATAGAAAAGCATGCTCTTGTCTTTATC  346

seq1  CCATGCATATAAAATAGTTAAGAAATACAGAAATATACTTGTGCTAGTCT  386
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATGCATATAAAATAGTTAAGAAATACAGAAATATACTTGTGCTAGTCT  396

seq1  TGGCATTTAGTGTACTCTTTTATCAACGCAAACAAGCAAATGGCTTCACT  436
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCATTTAGTGTACTCTTTTATCAACGCAAACAAGCAAATGGCTTCACT  446

seq1  AGTCTTGCTCTTTCTCCCTTTATCATTATCACCTTACTAA-CCTTTCTTG  485
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  AGTCTTGCTCTTTCTCCCTTTATCATTATCACCTTACTAACCCTTTCTTG  496

seq1  GGTGTGACAGCAAAGGACAGAATGCTCAGTACTCAGGAGGACAGGCATAT  535
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGTGACAGCAAAGGACAGAATGCTCAGTACTCAGGAGGACAGGCATAT  546

seq1  CTCCTTGAGTCTAAAGTCAGCCTAGCCTTCATCTACAGTACAAGTTCAAG  585
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTTGAGTCTAAAGTCAGCCTAGCCTTCATCTACAGTACAAGTTCAAG  596

seq1  ACCACCCAGGGCTACATAGTGAGGCCCTGTCTTGAAAAAAAACCAATTAA  635
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCACCCAGGGCTACATAGTGAGGCCCTGTCTTGAAAAAAAACCAATTAA  646

seq1  GGACTGTAAAGATGGCCCCGTGGGTAAGAGCAGCTGCTGCTCCTGCAGTA  685
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACTGTAAAGATGGCCCCGTGGGTAAGAGCAGCTGCTGCTCCTGCAGTA  696

seq1  GATGCGGGATTGATTCGCAGCACCTACATGGCAGTTCACAGCCACTCCTA  735
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGCGGGATTGATTCGCAGCACCTACATGGCAGTTCACAGCCACTCCTA  746

seq1  ATGGGTCACCCTCCAGTTCTAGGGACCTGACAAGCTCCCCAGGAATCACC  785
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGGTCACCCTCCAGTTCTAGGGACCTGACAAGCTCCCCAGGAATCACC  796

seq1  AATCTGCATGCTCCTGGTGCGCACACACACACATACGCAATATAATCAAA  835
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCTGCATGCTCCTGGTGCGCACACACACACATACGCAATATAATCAAA  846

seq1  CATACAAAAGAAATAAATCATTTTAAAATTAAATGAAATAATTACTTCTA  885
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATACAAAAGAAATAAATCATTTTAAAATTAAATGAAATAATTACTTCTA  896

seq1  AAAGCCTTCTTTGTACGAAGACTCAAATTGAAGACAAATACTTTTCTCTA  935
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCCTTCTTTGTACGAAGACTCAAATTGAAGACAAATACTTTTCTCTA  946

seq1  ACAATGTCCATGGCAAAATTCAGAAAGTAACAAAAGTACACAGGCAGTCT  985
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAATGTCCATGGCAAAATTCAGAAAGTAACAAAAGTACACAGGCAGTCT  996

seq1  CCCGACACTCAGGAGCACTTCCTTTAGCTCGGGCTGGTAGCAAACAGCAG  1035
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCGACACTCAGGAGCACTTCCTTTAGCTCGGGCTGGTAGCAAACAGCAG  1046

seq1  TTTAAATACATGTCACCAGGCTCTACACTCCGACACATAACAGATAAAGC  1085
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAAATACATGTCACCAGGCTCTACACTCCGACACATAACAGATAAAGC  1096

seq1  AGTAGCTCAGACACTCAGGCATCCAACTGCCTCTGACACAGAATGGAAGC  1135
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAGCTCAGACACTCAGGCATCCAACTGCCTCTGACACAGAATGGAAGC  1146

seq1  TGATCTGCCTCATGTATATGGAATTC  1161
      ||||||||||||||||||||||||||
seq2  TGATCTGCCTCATGTATATGGAATTC  1172

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information