MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-315F02
Chromosome	4 (Build37)
Map Location	154,254,021 - 154,397,457
singlet/doublet	doublet
Overlap gene	Mmel1, 2810405K02Rik, Tnfrsf14, Hes5, Pank4, LOC100043358, Plch2
Upstream gene	BC039966, A430005L14Rik, Dffb, BC046331, Lrrc47, 1190007F08Rik, Ccdc27, Trp73, Wdr8, 1200015A19Rik, Megf6, Arhgef16, Prdm16, LOC100043342, LOC100042178, Actrt2, B230396O12Rik
Downstream gene	Pex10, Rer1, Morn1, Ski, 2610002J02Rik, Prkcz, Gabrd, 2010015L04Rik, Tmem52, Gnb1, Nadk, A530082C11Rik, Cdc2l1, Mmp23, Mib2, B930041F14Rik, Ssu72, EG381582, Atad3a, Vwa1, A230069A22Rik, E230028L10Rik, Mrpl20, Ccnl2, Aurkaip1, Mxra8, Dvl1, Tas1r3, BC002216, Cpsf3l, Pusl1, Centb5, Ube2j2, C1qdc2, B3galt6, Sdf4, LOC100043436, Tnfrsf4
Link	Open Mouse BAC browser

Click to get alignment info.

name	BC039966 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407793 MGI:3039570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	A430005L14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97159 MGI:2140680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dffb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13368 MGI:1196287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC046331 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230967 MGI:2687282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc47 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72946 MGI:1920196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1190007F08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68859 MGI:1916109
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381580 MGI:2685881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trp73 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22062 MGI:1336991
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59002 MGI:1891749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1200015A19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67808 MGI:1915058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Megf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230971 MGI:1919351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 114 ESTs, 4 Proteins

name	Arhgef16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230972 MGI:2446219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 47 ESTs, 7 Proteins

name	Prdm16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70673 MGI:1917923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043342 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043342
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042178 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs

name	Actrt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73353 MGI:1920603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B230396O12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242800 MGI:2445205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mmel1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27390 MGI:1351603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810405K02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66469 MGI:1913719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230979 MGI:2675303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hes5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15208 MGI:104876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pank4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269614 MGI:2387466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043358 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Plch2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269615 MGI:2443078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pex10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668173 MGI:2684988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rer1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67830 MGI:1915080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Morn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76866 MGI:1924116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ski (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20481 MGI:98310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610002J02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67513 MGI:1914763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkcz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18762 MGI:97602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gabrd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14403 MGI:95622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010015L04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544678 MGI:1917130
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69671 MGI:1916921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 1 Protein

name	Gnb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14688 MGI:95781
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nadk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192185 MGI:2183149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A530082C11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320541 MGI:2444240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc2l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12537 MGI:88353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mmp23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26561 MGI:1347361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mib2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76580 MGI:2679684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B930041F14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230991 MGI:2444790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssu72 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68991 MGI:1916241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG381582 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381582 MGI:3648074
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Atad3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108888 MGI:1919214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vwa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246228 MGI:2179729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A230069A22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320587 MGI:2444329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E230028L10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242805 MGI:2685285
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Mrpl20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66448 MGI:2137221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccnl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56036 MGI:1927119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aurkaip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66077 MGI:1913327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mxra8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74761 MGI:1922011
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dvl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13542 MGI:94941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas1r3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83771 MGI:1933547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC002216 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79554 MGI:1933107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpsf3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71957 MGI:1919207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pusl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433813 MGI:3047787
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 76 ESTs, 2 Proteins

name	Centb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140500 MGI:2153589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2j2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140499 MGI:2153608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	C1qdc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67389 MGI:1914639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B3galt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117592 MGI:2152819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20318 MGI:108079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043436 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs

name	Tnfrsf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22163 MGI:104512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC039966 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253335 GeneID:407793 MGI:3039570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : cDNA sequence BC039966 transcript_id : XM_001477621.1

name	A430005L14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802941 GeneID:97159 MGI:2140680
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A430005L14 gene transcript_id : NM_175287.3

name	Dffb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802948 GeneID:13368 MGI:1196287
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA fragmentation factor, beta subunit transcript_id : NM_007859.3

name	BC046331 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343602 GeneID:230967 MGI:2687282
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC046331 transcript_id : NM_177673.2

name	Lrrc47 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41152115 GeneID:72946 MGI:1920196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 47 transcript_id : NM_201226.1

name	Ccdc27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802895 GeneID:381580 MGI:2685881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 27 transcript_id : NM_001033455.2

name	Trp73 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375138 GeneID:22062 MGI:1336991
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformation related protein 73 transcript_id : NM_011642.2

name	Wdr8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778725 GeneID:59002 MGI:1891749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 8 transcript_id : NM_021499.2

name	1200015A19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71795665 GeneID:67808 MGI:1915058
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200015A19 gene transcript_id : NM_026388.2

name	Megf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372857 GeneID:230971 MGI:1919351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 114 ESTs, 4 Proteins product : multiple EGF-like-domains 6, transcript variant 1 transcript_id : XM_620148.3

name	Arhgef16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372806 GeneID:230972 MGI:2446219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 47 ESTs, 7 Proteins product : Rho guanine nucleotide exchange factor (GEF) 16, transcript variant 5 transcript_id : XM_902459.2

name	Prdm16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124107622 GeneID:70673 MGI:1917923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PR domain containing 16 transcript_id : NM_027504.3

name	LOC100043342 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253362 GeneID:100043342
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043342 transcript_id : XM_001480354.1

name	LOC100042178 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253337 GeneID:100042178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs product : hypothetical protein LOC100042178 transcript_id : XM_001477690.1

name	Actrt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982618 GeneID:73353 MGI:1920603
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin-related protein T2 transcript_id : NM_028513.2

name	B230396O12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098156 GeneID:242800 MGI:2445205
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B230396O12 gene transcript_id : NM_172878.2

name	Mmel1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305476 GeneID:27390 MGI:1351603
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane metallo-endopeptidase-like 1 transcript_id : NM_013783.1

name	2810405K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801670 GeneID:66469 MGI:1913719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810405K02 gene transcript_id : NM_025582.3

name	Tnfrsf14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341490 GeneID:230979 MGI:2675303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) transcript_id : NM_178931.2

name	Hes5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801760 GeneID:15208 MGI:104876
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hairy and enhancer of split 5 (Drosophila) transcript_id : NM_010419.3

name	Pank4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366380 GeneID:269614 MGI:2387466
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pantothenate kinase 4 transcript_id : NM_172990.2

name	LOC100043358 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253364 GeneID:100043358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100043358 transcript_id : XM_001480381.1

name	Plch2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583636 GeneID:269615 MGI:2443078
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase C, eta 2 transcript_id : NM_175556.3

name	Pex10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109150413 GeneID:668173 MGI:2684988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome biogenesis factor 10 transcript_id : NM_001042407.1

name	Rer1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385881 GeneID:67830 MGI:1915080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae) transcript_id : NM_026395.1

name	Morn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487377 GeneID:76866 MGI:1924116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MORN repeat containing 1 transcript_id : NM_001081100.1

name	Ski (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113205054 GeneID:20481 MGI:98310
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sloan-Kettering viral oncogene homolog transcript_id : NM_011385.2

name	2610002J02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381159 GeneID:67513 MGI:1914763
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610002J02 gene transcript_id : NM_001033134.2

name	Prkcz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872199 GeneID:18762 MGI:97602
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase C, zeta transcript_id : NM_008860.2

name	Prkcz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872204 GeneID:18762 MGI:97602
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase C, zeta transcript_id : NM_001039079.1

name	Gabrd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679912 GeneID:14403 MGI:95622
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-aminobutyric acid (GABA-A) receptor, subunit delta transcript_id : NM_008072.1

name	2010015L04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354426 GeneID:544678 MGI:1917130
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010015L04 gene transcript_id : NM_177674.4

name	Tmem52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372812 GeneID:69671 MGI:1916921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 1 Protein product : transmembrane protein 52, transcript variant 1 transcript_id : XM_131826.3

name	Gnb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111186467 GeneID:14688 MGI:95781
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein, beta 1 transcript_id : NM_008142.3

name	Nadk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149759 GeneID:192185 MGI:2183149
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NAD kinase transcript_id : NM_138671.1

name	A530082C11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922680 GeneID:320541 MGI:2444240
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A530082C11 gene transcript_id : NM_177186.4

name	Cdc2l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350164 GeneID:12537 MGI:88353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 2-like 1 transcript_id : NM_007661.3

name	Mmp23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129979 GeneID:26561 MGI:1347361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix metallopeptidase 23 transcript_id : NM_011985.2

name	Mib2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347530 GeneID:76580 MGI:2679684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mindbomb homolog 2 (Drosophila) transcript_id : NM_145124.2

name	B930041F14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248519 GeneID:230991 MGI:2444790
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B930041F14 gene transcript_id : NM_178699.3

name	Ssu72 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803020 GeneID:68991 MGI:1916241
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ssu72 RNA polymerase II CTD phosphatase homolog (yeast) transcript_id : NM_026899.2

name	EG381582 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372815 GeneID:381582 MGI:3648074
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : predicted gene, EG381582 transcript_id : XM_358624.4

name	Atad3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803434 GeneID:108888 MGI:1919214
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase family, AAA domain containing 3A transcript_id : NM_179203.2

name	Vwa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347205 GeneID:246228 MGI:2179729
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : von Willebrand factor A domain containing 1 transcript_id : NM_147776.3

name	A230069A22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802489 GeneID:320587 MGI:2444329
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A230069A22 gene transcript_id : NM_001033394.2

name	E230028L10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253339 GeneID:242805 MGI:2685285
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA E230028L10 gene transcript_id : XM_144122.7

name	Mrpl20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801166 GeneID:66448 MGI:2137221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L20 transcript_id : NM_025570.2

name	Ccnl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46592876 GeneID:56036 MGI:1927119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin L2 transcript_id : NM_207678.1

name	Aurkaip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384925 GeneID:66077 MGI:1913327
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aurora kinase A interacting protein 1 transcript_id : NM_025338.2

name	Mxra8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982601 GeneID:74761 MGI:1922011
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix-remodelling associated 8 transcript_id : NM_024263.3

name	Dvl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47933343 GeneID:13542 MGI:94941
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dishevelled, dsh homolog 1 (Drosophila) transcript_id : NM_010091.3

name	Tas1r3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130760 GeneID:83771 MGI:1933547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 1, member 3 transcript_id : NM_031872.2

name	BC002216 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362606 GeneID:79554 MGI:1933107
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC002216 transcript_id : NM_024472.3

name	Cpsf3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377466 GeneID:71957 MGI:1919207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cleavage and polyadenylation specific factor 3-like transcript_id : NM_028020.3

name	Pusl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372870 GeneID:433813 MGI:3047787
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 73 ESTs, 1 Protein product : pseudouridylate synthase-like 1, transcript variant 7 transcript_id : XM_001004412.1

name	Centb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402196 GeneID:140500 MGI:2153589
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, beta 5 transcript_id : NM_207223.1

name	Ube2j2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85662416 GeneID:140499 MGI:2153608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2, J2 homolog (yeast) transcript_id : NM_021402.5

name	Ube2j2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85662414 GeneID:140499 MGI:2153608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2, J2 homolog (yeast) transcript_id : NM_001039158.1

name	Ube2j2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85662412 GeneID:140499 MGI:2153608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2, J2 homolog (yeast) transcript_id : NM_001039157.1

name	Ube2j2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85662418 GeneID:140499 MGI:2153608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2, J2 homolog (yeast) transcript_id : NM_001039159.1

name	C1qdc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365660 GeneID:67389 MGI:1914639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C1q domain containing 2 transcript_id : NM_026125.2

name	B3galt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802207 GeneID:117592 MGI:2152819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-Gal:betaGal beta 1,3-galactosyltransferase, polypeptide 6 transcript_id : NM_080445.3

name	Sdf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130195 GeneID:20318 MGI:108079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stromal cell derived factor 4 transcript_id : NM_011341.4

name	LOC100043436 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253366 GeneID:100043436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs product : hypothetical protein LOC100043436 transcript_id : XM_001480566.1

name	Tnfrsf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130086 GeneID:22163 MGI:104512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 4 transcript_id : NM_011659.2

name	BC039966 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253336 GeneID:407793 MGI:3039570
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477671.1

name	A430005L14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424952 CCDS:CCDS19003.1 GeneID:97159 MGI:2140680
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC97159 protein_id : NP_780496.1

name	Dffb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542553 CCDS:CCDS19004.1 GeneID:13368 MGI:1196287
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004516 - nicotinate phosphoribosyltransferase activity [Evidence IDA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006309 - DNA fragmentation during apoptosis [Evidence ISS] codon_start : 1 exception : mismatches in translation note : DNase inhibited by DNA fragmentation factor; DNA fragmentation factor, 40 kD, beta subunit; caspase-activated DNase product : DNA fragmentation factor, beta subunit protein_id : NP_031885.2

name	BC046331 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244100 CCDS:CCDS19005.1 GeneID:230967 MGI:2687282
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016595 - glutamate binding [Evidence ISS]; GO:0016594 - glycine binding [Evidence ISS]; GO:0016596 - thienylcyclohexylpiperidine binding [Evidence ISS] codon_start : 1 note : likely ortholog of H. sapiens glycine-, glutamate-, thienylcyclohexylpiperidine-binding protein product : glycine-, glutamate-, thienylcyclohexylpiperidine-binding protein protein_id : NP_808341.1

name	Lrrc47 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41152116 CCDS:CCDS19006.1 GeneID:72946 MGI:1920196
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : novel protein containing Leucine Rich Repeat domains product : leucine rich repeat containing 47 protein_id : NP_957678.1

name	Ccdc27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701967 CCDS:CCDS19008.1 GeneID:381580 MGI:2685881
definition	codon_start : 1 product : coiled-coil domain containing 27 protein_id : NP_001028627.1

name	Trp73 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794514 CCDS:CCDS19009.1 GeneID:22062 MGI:1336991
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence TAS]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence TAS]; GO:0030900 - forebrain development [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence IDA]; GO:0042981 - regulation of apoptosis [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : transformation related protein 73 protein_id : NP_035772.1

name	Wdr8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778726 CCDS:CCDS19010.1 GeneID:59002 MGI:1891749
definition	codon_start : 1 product : WD repeat domain 8 protein_id : NP_067474.2

name	1200015A19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312776 CCDS:CCDS19011.1 GeneID:67808 MGI:1915058
definition	GO_function : GO:0042802 - identical protein binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : hypothetical protein LOC67808 protein_id : NP_080664.1

name	Megf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82895993 GeneID:230971 MGI:1919351
definition	codon_start : 1 product : EGF-like-domain, multiple 3 isoform 1 protein_id : XP_620148.2

name	Arhgef16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94372807 GeneID:230972 MGI:2446219
definition	codon_start : 1 product : hypothetical protein isoform 5 protein_id : XP_907552.2

name	Prdm16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124107623 GeneID:70673 MGI:1917923
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : transcription factor MEL1 protein_id : NP_081780.3

name	LOC100043342 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253363 GeneID:100043342
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480404.1

name	LOC100042178 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253338 GeneID:100042178
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477740.1

name	Actrt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386316 CCDS:CCDS19014.1 GeneID:73353 MGI:1920603
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : actin related protein M2 (Arpm2) product : actin related protein M2 protein_id : NP_082789.1

name	B230396O12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098157 CCDS:CCDS19015.1 GeneID:242800 MGI:2445205
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC242800 protein_id : NP_766466.2

name	Mmel1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305477 GeneID:27390 MGI:1351603
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005615 - extracellular space [Evidence TAS]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence ISS]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0004245 - neprilysin activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : neprilysin 2; NEPLP beta; NEPLP alpha; NEPLP gamma; soluble secreted endopeptidase product : mel transforming oncogene-like 1 protein_id : NP_038811.1

name	2810405K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754130 CCDS:CCDS19016.1 GeneID:66469 MGI:1913719
definition	codon_start : 1 product : hypothetical protein LOC66469 protein_id : NP_079858.2

name	Tnfrsf14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725810 CCDS:CCDS19017.1 GeneID:230979 MGI:2675303
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0050798 - activated T cell proliferation [Evidence IDA]; GO:0006915 - apoptosis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : herpes virus entry mediator product : tumor necrosis factor receptor superfamily member 14 protein_id : NP_849262.1

name	Hes5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754182 CCDS:CCDS19018.1 GeneID:15208 MGI:104876
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0042491 - auditory receptor cell differentiation [Evidence IMP]; GO:0042668 - auditory receptor cell fate determination [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IGI]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0048469 - cell maturation [Evidence IGI]; GO:0007275 - development [Evidence IEA]; GO:0045665 - negative regulation of neuron differentiation [Evidence IGI]; GO:0007399 - nervous system development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : hairy and enhancer of split 5 protein_id : NP_034549.1

name	Pank4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370494 CCDS:CCDS19019.1 GeneID:269614 MGI:2387466
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004594 - pantothenate kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0015937 - coenzyme A biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : pantothenate kinase 4 protein_id : NP_766578.1

name	LOC100043358 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253365 GeneID:100043358
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480431.1

name	Plch2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583637 GeneID:269615 MGI:2443078
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0004435 - phosphoinositide phospholipase C activity [Evidence IEA]; GO:0004629 - phospholipase C activity [Evidence IDA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0030384 - phosphoinositide metabolism [Evidence IDA] codon_start : 1 note : phospholipase C eta2; phospholipase C-eta2 product : phospholipase C-like 4 protein_id : NP_780765.2

name	Pex10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109150414 CCDS:CCDS19021.1 GeneID:668173 MGI:2684988
definition	codon_start : 1 product : peroxisome biogenesis factor 10 protein_id : NP_001035866.1

name	Rer1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385882 CCDS:CCDS19022.1 GeneID:67830 MGI:1915080
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : RER1 homolog protein_id : NP_080671.1

name	Morn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487378 GeneID:76866 MGI:1924116
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA] codon_start : 1 product : MORN repeat containing 1 protein_id : NP_001074569.1

name	Ski (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113205055 CCDS:CCDS19024.1 GeneID:20481 MGI:98310
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0017053 - transcriptional repressor complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030326 - embryonic limb morphogenesis [Evidence IMP] codon_start : 1 product : Sloan-Kettering viral oncogene homolog protein_id : NP_035515.2

name	2610002J02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701642 GeneID:67513 MGI:1914763
definition	codon_start : 1 product : hypothetical protein LOC67513 protein_id : NP_001028306.1

name	Prkcz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872200 CCDS:CCDS19026.1 GeneID:18762 MGI:97602
definition	GO_component : GO:0045179 - apical cortex [Evidence IDA]; GO:0005938 - cell cortex [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005923 - tight junction [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004700 - atypical protein kinase C activity [Evidence IEA]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant 1; protein kinase C zeta subspecies product : protein kinase C, zeta isoform a protein_id : NP_032886.2

name	Prkcz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872205 CCDS:CCDS19027.1 GeneID:18762 MGI:97602
definition	GO_component : GO:0045179 - apical cortex [Evidence IDA]; GO:0005938 - cell cortex [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005923 - tight junction [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004700 - atypical protein kinase C activity [Evidence IEA]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : isoform b is encoded by transcript variant 2; protein kinase C zeta subspecies product : protein kinase C, zeta isoform b protein_id : NP_001034168.1

name	Gabrd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679913 CCDS:CCDS19028.1 GeneID:14403 MGI:95622
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005230 - extracellular ligand-gated ion channel activity [Evidence IEA]; GO:0004890 - GABA-A receptor activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IEA]; GO:0007214 - gamma-aminobutyric acid signaling pathway [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : gamma-aminobutyric acid (GABA-A) receptor, subunit delta protein_id : NP_032098.1

name	2010015L04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85662377 GeneID:544678 MGI:1917130
definition	codon_start : 1 product : hypothetical protein LOC544678 protein_id : NP_808342.2

name	Tmem52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20850871 GeneID:69671 MGI:1916921
definition	codon_start : 1 product : transmembrane protein 52 isoform 1 protein_id : XP_131826.1

name	Gnb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680045 CCDS:CCDS19030.1 GeneID:14688 MGI:95781
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence ISS] [Evidence IPI] GO_function : GO:0003924 - GTPase activity [Evidence ISS] GO_process : GO:0008283 - cell proliferation [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS] [Evidence IDA]; GO:0007200 - G-protein signaling, coupled to IP3 second messenger (phospholipase C activating) [Evidence IDA]; GO:0007603 - phototransduction, visible light [Evidence ISS]; GO:0050909 - sensory perception of taste [Evidence IDA] codon_start : 1 product : guanine nucleotide-binding protein, beta-1 subunit protein_id : NP_032168.1

name	Nadk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149760 CCDS:CCDS19031.1 GeneID:192185 MGI:2183149
definition	GO_component : GO:0005829 - cytosol [Evidence ISS] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003951 - NAD+ kinase activity [Evidence IEA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046034 - ATP metabolism [Evidence ISS]; GO:0008152 - metabolism [Evidence IEA]; GO:0016310 - phosphorylation [Evidence ISS] codon_start : 1 exception : mismatches in translation product : putative inorganic polyphosphate/ATP-NAD kinase protein_id : NP_619612.1

name	A530082C11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893193 GeneID:320541 MGI:2444240
definition	codon_start : 1 product : solute carrier family 35, member E2 protein_id : NP_796160.1

name	Cdc2l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33695123 CCDS:CCDS19033.1 GeneID:12537 MGI:88353
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IMP]; GO:0001824 - blastocyst development [Evidence IMP]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007088 - regulation of mitosis [Evidence IMP] codon_start : 1 note : cell division cycle 2-like 2; PITSLRE proteins; cell division cycle 2 homolog (S. pombe)-like 2; cell division cycle 2 homolog (S. pombe)-like 1 product : cell division cycle 2-like 1 protein_id : NP_031687.2

name	Mmp23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754710 CCDS:CCDS19034.1 GeneID:26561 MGI:1347361
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005622 - intracellular [Evidence ISS] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence ISS] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : cysteine array matrix metalloproteinase product : matrix metalloproteinase 23 protein_id : NP_036115.1

name	Mib2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347531 CCDS:CCDS19035.1 GeneID:76580 MGI:2679684
definition	GO_component : GO:0005769 - early endosome [Evidence IDA]; GO:0000151 - ubiquitin ligase complex [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007219 - Notch signaling pathway [Evidence IEA]; GO:0016567 - protein ubiquitination [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : dystrophin-like; zinc finger, ZZ type with ankyrin repeat domain 1 product : skeletrophin protein_id : NP_660106.2

name	B930041F14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248520 GeneID:230991 MGI:2444790
definition	codon_start : 1 product : hypothetical protein LOC230991 protein_id : NP_848814.2

name	Ssu72 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312173 CCDS:CCDS19036.1 GeneID:68991 MGI:1916241
definition	codon_start : 1 exception : mismatches in translation product : Ssu72 RNA polymerase II CTD phosphatase homolog protein_id : NP_081175.1

name	EG381582 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38079078 GeneID:381582 MGI:3648074
definition	codon_start : 1 product : similar to hCG19301 protein_id : XP_358624.1

name	Atad3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725845 CCDS:CCDS19037.1 GeneID:108888 MGI:1919214
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : AAA-ATPase TOB3 protein_id : NP_849534.1

name	Vwa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559909 CCDS:CCDS19039.1 GeneID:246228 MGI:2179729
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : von Willebrand factor A-domain containing 1 product : von Willebrand factor A domain-related protein protein_id : NP_680085.2

name	A230069A22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701895 CCDS:CCDS19040.1 GeneID:320587 MGI:2444329
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC320587 protein_id : NP_001028566.1

name	E230028L10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253340 GeneID:242805 MGI:2685285
definition	codon_start : 1 product : hypothetical protein LOC242805 protein_id : XP_144122.6

name	Mrpl20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270194 CCDS:CCDS19041.1 GeneID:66448 MGI:2137221
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005762 - mitochondrial large ribosomal subunit [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IDA] GO_process : GO:0006412 - protein biosynthesis [Evidence IDA] codon_start : 1 product : mitochondrial ribosomal protein L20 protein_id : NP_079846.1

name	Ccnl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46592877 CCDS:CCDS19042.1 GeneID:56036 MGI:1927119
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : paneth cell enhanced expression product : cyclin L2 protein_id : NP_997561.1

name	Aurkaip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384706 CCDS:CCDS19043.1 GeneID:66077 MGI:1913327
definition	GO_component : GO:0005680 - anaphase-promoting complex [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS] GO_process : GO:0007067 - mitosis [Evidence ISS]; GO:0045862 - positive regulation of proteolysis [Evidence ISS]; GO:0016567 - protein ubiquitination [Evidence ISS] codon_start : 1 product : Aurora-A kinase interacting protein protein_id : NP_079614.1

name	Mxra8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982602 CCDS:CCDS19044.1 GeneID:74761 MGI:1922011
definition	codon_start : 1 exception : mismatches in translation product : limitrin protein_id : NP_077225.3

name	Dvl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47933344 CCDS:CCDS19045.1 GeneID:13542 MGI:94941
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007222 - frizzled signaling pathway [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence TAS] codon_start : 1 product : dishevelled, dsh homolog 1 protein_id : NP_034221.3

name	Tas1r3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13994201 CCDS:CCDS19046.1 GeneID:83771 MGI:1933547
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : saccharin preference product : taste receptor, type 1, member 3 protein_id : NP_114078.1

name	BC002216 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560025 CCDS:CCDS19047.1 GeneID:79554 MGI:1933107
definition	codon_start : 1 product : hypothetical protein LOC79554 protein_id : NP_077792.2

name	Cpsf3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312614 CCDS:CCDS19048.1 GeneID:71957 MGI:1919207
definition	GO_component : GO:0032039 - integrator complex [Evidence ISS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0016180 - snRNA processing [Evidence ISS] codon_start : 1 product : cleavage and polyadenylation specific factor 3-like protein_id : NP_082296.1

name	Pusl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94372871 GeneID:433813 MGI:3047787
definition	codon_start : 1 product : pseudouridylate synthase-like 1 isoform 7 protein_id : XP_001004412.1

name	Centb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402197 GeneID:140500 MGI:2153589
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 product : centaurin, beta 5 protein_id : NP_997106.1

name	Ube2j2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85662413 CCDS:CCDS19050.1 GeneID:140499 MGI:2153608
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 2; ubiquitin conjugating enzyme 6; Ubc6p homolog product : ubiquitin-conjugating enzyme E2, J2 homolog isoform a protein_id : NP_001034246.1

name	Ube2j2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85662417 CCDS:CCDS19050.1 GeneID:140499 MGI:2153608
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; ubiquitin conjugating enzyme 6; Ubc6p homolog product : ubiquitin-conjugating enzyme E2, J2 homolog isoform a protein_id : NP_067377.4

name	Ube2j2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85662415 CCDS:CCDS19051.1 GeneID:140499 MGI:2153608
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 3; ubiquitin conjugating enzyme 6; Ubc6p homolog product : ubiquitin-conjugating enzyme E2, J2 homolog isoform b protein_id : NP_001034247.1

name	Ube2j2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85662419 CCDS:CCDS19051.1 GeneID:140499 MGI:2153608
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 4; ubiquitin conjugating enzyme 6; Ubc6p homolog product : ubiquitin-conjugating enzyme E2, J2 homolog isoform b protein_id : NP_001034248.1

name	C1qdc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385632 CCDS:CCDS19052.1 GeneID:67389 MGI:1914639
definition	codon_start : 1 product : C1q domain containing 2 protein_id : NP_080401.1

name	B3galt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17978260 CCDS:CCDS19053.1 GeneID:117592 MGI:2152819
definition	GO_component : GO:0005797 - Golgi medial cisterna [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0047220 - galactosylxylosylprotein 3-beta-galactosyltransferase activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0008499 - UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity [Evidence IDA] GO_process : GO:0006024 - glycosaminoglycan biosynthesis [Evidence IDA] codon_start : 1 note : UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 6 product : UDP-Gal:betaGal beta 1,3-galactosyltransferase, polypeptide 6 protein_id : NP_536693.1

name	LOC100043436 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253367 GeneID:100043436
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480616.1

name	Sdf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755446 CCDS:CCDS19054.1 GeneID:20318 MGI:108079
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : stromal cell derived factor 4 protein_id : NP_035471.1

name	Tnfrsf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755909 CCDS:CCDS19055.1 GeneID:22163 MGI:104512
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005031 - tumor necrosis factor receptor activity [Evidence IPI] GO_process : GO:0006968 - cellular defense response [Evidence IMP]; GO:0006954 - inflammatory response [Evidence IPI] [Evidence IMP]; GO:0050710 - negative regulation of cytokine secretion [Evidence IPI]; GO:0042981 - regulation of apoptosis [Evidence IMP]; GO:0045859 - regulation of protein kinase activity [Evidence IMP] codon_start : 1 note : tax-transcriptionally activated glycoprotein 1 product : tumor necrosis factor receptor superfamily, member 4 protein_id : NP_035789.1

name	1190007F08Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149253303 GeneID:68859 MGI:1916109
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1190007F08 gene transcript_id : XR_035126.1

clone name	MSMg01-395O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486J15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-086D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-326F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132M19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-315F02.b	B6Ng01-315F02.g
ACC	GA106000	GA106001
length	1,024	322
definition	B6Ng01-315F02.b	B6Ng01-315F02.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(154,396,442 - 154,397,457)	(154,254,021 - 154,254,324)
sequence	gaattctgcattctgtcacctgtcacctgccacccaggtcaggaggttgt gtatctaggcactggtatctaggatgtgccagggttgtgggatggttgga ggctcctagatcatcctctgaaacagctttgggtcctcactagaggcagt aacattgaactctcagacaagggtagacacagcactacattggatttgga gttaaatagttaataaaatgtcttaggctcgggttgctgctgggcctgtg tccctccctgcagcacagcagccagaacgggctcaacacctgaggggcct acacttcaccatccagcacttctgaggtgattaaagtgttccaagccagc agacccttgcacctcagggttcctcagggtcagagtgactgtggggatca gtccaccccagaaggcttcccactgtagaaaacagattgaagttggtggc ttttggagccctcctgtttggggcattctgagacggtctcacaggagcag aattggggtcacattagggctcctaaactgtgcttgtccccgtccccccc cccccatgctgtggccaggctgctgtactgtggccatcaagatacagtga gctgggcagagtgcagctgctcactggaagcgtttccttggagatgtatg taggacagaagttggaagtccagatctgaggtgccccacaaaggcttccg aggtgtgaatcactctgcagagactgggggatgcagcgttgtcctggccg cctgtttctggggactgttgcaaagtggatgctgttgcccatctacaggc agggcttatgactcccagaaccatgggagcctcagctcaagggtccaggc tgtccctgccctcattcccccaacacccccccaccccccgctctcccaga ctgctgatcctccctaagtgctccactgggaagcagcccaagggcagtat aatcccaattgatttctcagaaggtaacagcttaggacttgaaccctagc ttgtttttgatgattgttgcaagc	aggaccttaggtagagcagtcagtactcttaaccactgagccatctctcc agtcccgaggaaccagtttcaatacccagcaactacatagcagctcacag ctataataaattttataaaattaaggtcttagccaagttgaggagttttt aatgttttgaaaaacaaaattttagaaaaacaaagtttcagagggattgc gaagactattcttttatgaatgtatgtgtagcacacacagagatatatgt ttgtatgtgtggaggtatacatgtgtatgggagtgtgtgtgtatagggta cattcataaaagaatagtcttc
quality values	Open. Hide. 54 31 21 26 58 43 47 47 54 46 54 62 62 49 47 62 32 38 54 62 62 62 62 47 56 47 62 62 62 62 59 41 59 59 44 44 34 38 56 59 59 56 62 59 59 59 62 62 62 62 62 62 62 59 49 62 62 62 62 62 59 59 62 62 62 62 62 59 54 42 54 56 54 59 59 62 62 62 62 62 54 59 62 59 59 62 62 62 54 54 54 59 59 62 62 59 62 62 56 62 59 62 59 59 62 62 59 59 46 33 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 54 62 62 59 59 54 62 51 59 59 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 50 54 62 59 62 59 62 62 59 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 44 59 62 62 62 62 62 62 62 62 62 62 62 62 56 51 62 62 62 62 62 49 62 62 62 56 62 62 56 62 62 56 62 56 62 62 47 54 62 62 62 62 62 62 62 37 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 43 62 56 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 56 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 54 62 62 62 62 62 62 62 62 62 52 48 62 47 49 54 52 46 58 46 54 58 58 58 58 58 58 58 54 58 58 58 54 54 52 46 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 52 58 58 58 58 58 54 58 58 58 41 52 46 58 58 58 58 58 58 58 58 41 42 58 58 51 58 58 51 54 52 58 51 50 50 50 58 48 48 58 58 58 58 58 45 58 58 58 58 58 58 51 52 50 58 46 51 51 52 52 34 54 58 58 58 54 54 50 39 51 58 44 54 54 40 58 50 54 58 46 46 54 51 51 41 48 58 50 51 51 58 51 40 54 58 53 53 38 49 39 39 51 50 58 49 39 51 51 54 51 58 58 35 51 52 51 53 41 51 52 53 53 54 44 21 46 50 50 52 58 48 54 53 49 49 49 49 26 54 38 51 49 40 54 40 54 19 54 38 51 41 40 50 54 49 52 50 49 54 54 53 50 51 49 24 46 27 41 39 41 47 47 54 49 32 41 31 51 41 51 42 54 49 39 45 47 37 45 51 40 41 31 52 51 27 32 32 30 49 35 35 40 45 45 40 40 41 36 24 19 52 47 51 53 40 41 35 53 46 31 25 40 32 38 31 32 35 34 31 19 47 34 34 53 53 31 42 31 43 31 45 31 31 33 31 43 31 46 31 30 32 44 30 29 31 22 21 32 21 51 31 32 23 51 31 31 31 29 21 9 46 19 32 21 31 41 31 32 38 25 41 43 34 22 33 23 46 33 23 30 31 31 30 31 31 31 31 33 38 48 33 22 31 30 46 32 29 31 32 33 44 28 46 46 41 30 24 34 23 19 26 46 41 39 44 39 35 27 31 39 36 41 36 35 39 31 36 31 37 25 44 22 35 22 42 28 32 29 25 32 29 33 25 31 31 29 23 44 24 12 18 38 19 15 33 27 30 27 42 33 27 11 18 36 31 17 29 19 34 7 4 4 34 7 13 4 4 21 29 17 31 21 32 17 10 18 32 19 11 31 10 19 6 15 17 30 23 24 36 37 17 6 17 13 8 6 19 9 17 18 24 12 28 27 18 14 7 10 8 11 9 21 15 26 21 11 15 18 8 33 13 20 23 20 20 24 8 7 8 38 38 28 5 5 14 20 24 27 9 5 4 8 10 5 3 8 27 11 5	Open. Hide. 59 56 62 59 43 56 32 40 36 22 33 46 59 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 54 59 62 62 62 59 59 59 62 59 62 59 62 59 62 62 54 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 56 54 56 62 62 62 62 59 62 59 62 62 62 62 62 62 62 56 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 50 62 48 54 62 59 59 62 62 62 59 62 62 62 59 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 49 37 62 62 62 62 62 62 62 34 45 18 18 29 19 18 34 24 24 12 13 11 45 13 10 11 27 25 19 14 22 49 46 44 32 28 49 56 34 24 18 24

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_154396442_154397457
seq2: B6Ng01-315F02.b_45_1068 (reverse)

seq1  GCTTGCCAC-ATCATCAAA---CAGCTA-GGTTCAAGTCCT-AGCTGTTA  44
      |||||| || |||||||||    ||||| |||||||||||| ||||||||
seq2  GCTTGCAACAATCATCAAAAACAAGCTAGGGTTCAAGTCCTAAGCTGTTA  50

seq1  CC-TCTGAGAAATCAATT-GGATTATACTGCCCCTTTGGCCTGCTTCCCA  92
      || ||||||||||||||| ||||||||||||||  |||| ||||||||||
seq2  CCTTCTGAGAAATCAATTGGGATTATACTGCCC--TTGGGCTGCTTCCCA  98

seq1  GTGGAGCACTTAGGGAGGATCAGCAGTCTGGGAGAGCGGGGGGTGGGGGG  142
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGAGCACTTAGGGAGGATCAGCAGTCTGGGAGAGCGGGGGGTGGGGGG  148

seq1  GTGTTGGGGGAATGAGGGCAGGGACAGCCTGGACCCTTGAGCTGAGGCT-  191
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  GTGTTGGGGGAATGAGGGCAGGGACAGCCTGGACCCTTGAGCTGAGGCTC  198

seq1  CCATGGTTCTGGGAGTCATAAGCCCTGCCTGTAGATGGGCAACAGCATCC  241
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATGGTTCTGGGAGTCATAAGCCCTGCCTGTAGATGGGCAACAGCATCC  248

seq1  ACTTTGCAACAGTCCCCAGAAACAGGCGGCCAGGACAACGCTGCAT-CCC  290
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  ACTTTGCAACAGTCCCCAGAAACAGGCGGCCAGGACAACGCTGCATCCCC  298

seq1  CAGTCTCTGCAGAGTGATTCACACCTCGGAAGCCTTTGTGGGGCACCTCA  340
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCTCTGCAGAGTGATTCACACCTCGGAAGCCTTTGTGGGGCACCTCA  348

seq1  GATCTGGACTTCCAACTTCTGTCCTACATACATCTCCAAGGAAACGCTTC  390
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTGGACTTCCAACTTCTGTCCTACATACATCTCCAAGGAAACGCTTC  398

seq1  CAGTGAGCAGCTGCACTCTGCCCAGCTCACTGTATCTTGATGGCCACAGT  440
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGAGCAGCTGCACTCTGCCCAGCTCACTGTATCTTGATGGCCACAGT  448

seq1  ACAGCAGCCTGGCCACAGCATGGGGGGGGGGGGACGGGGACAAGCACAGT  490
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGCAGCCTGGCCACAGCATGGGGGGGGGGGGACGGGGACAAGCACAGT  498

seq1  TTAGGAGCCCTAATGTGACCCCAATTCTGCTCCTGTGAGACCGTCTCAGA  540
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGGAGCCCTAATGTGACCCCAATTCTGCTCCTGTGAGACCGTCTCAGA  548

seq1  ATGCCCCAAACAGGAGGGCTCCAAAAGCCACCAACTTCAATCTGTTTTCT  590
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCCCCAAACAGGAGGGCTCCAAAAGCCACCAACTTCAATCTGTTTTCT  598

seq1  ACAGTGGGAAGCCTTCTGGGGTGGACTGATCCCCACAGTCACTCTGACCC  640
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTGGGAAGCCTTCTGGGGTGGACTGATCCCCACAGTCACTCTGACCC  648

seq1  TGAGGAACCCTGAGGTGCAAGGGTCTGCTGGCTTGGAACACTTTAATCAC  690
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGAACCCTGAGGTGCAAGGGTCTGCTGGCTTGGAACACTTTAATCAC  698

seq1  CTCAGAAGTGCTGGATGGTGAAGTGTAGGCCCCTCAGGTGTTGAGCCCGT  740
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGAAGTGCTGGATGGTGAAGTGTAGGCCCCTCAGGTGTTGAGCCCGT  748

seq1  TCTGGCTGCTGTGCTGCAGGGAGGGACACAGGCCCAGCAGCAACCCGAGC  790
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGCTGCTGTGCTGCAGGGAGGGACACAGGCCCAGCAGCAACCCGAGC  798

seq1  CTAAGACATTTTATTAACTATTTAACTCCAAATCCAATGTAGTGCTGTGT  840
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAGACATTTTATTAACTATTTAACTCCAAATCCAATGTAGTGCTGTGT  848

seq1  CTACCCTTGTCTGAGAGTTCAATGTTACTGCCTCTAGTGAGGACCCAAAG  890
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACCCTTGTCTGAGAGTTCAATGTTACTGCCTCTAGTGAGGACCCAAAG  898

seq1  CTGTTTCAGAGGATGATCTAGGAGCCTCCAACCATCCCACAACCCTGGCA  940
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTTCAGAGGATGATCTAGGAGCCTCCAACCATCCCACAACCCTGGCA  948

seq1  CATCCTAGATACCAGTGCCTAGATACACAACCTCCTGACCTGGGTGGCAG  990
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCCTAGATACCAGTGCCTAGATACACAACCTCCTGACCTGGGTGGCAG  998

seq1  GTGACAGGTGACAGAATGCAGAATTC  1016
      ||||||||||||||||||||||||||
seq2  GTGACAGGTGACAGAATGCAGAATTC  1024

seq1: chr4_154254021_154254324
seq2: B6Ng01-315F02.g_68_371

seq1  GAATTCAGGACCTTAGGTAGAGCAGTCAGTACTCTTAACCACTGAGCCAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGGACCTTAGGTAGAGCAGTCAGTACTCTTAACCACTGAGCCAT  50

seq1  CTCTCCAGTCCCGAGGAACCAGTTTCAATACCCAGCAACTACATAGCAGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCCAGTCCCGAGGAACCAGTTTCAATACCCAGCAACTACATAGCAGC  100

seq1  TCACAGCTATAATAAATTTTATAAAATTAAGGTCTTAGCCAAGTTGAGGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACAGCTATAATAAATTTTATAAAATTAAGGTCTTAGCCAAGTTGAGGA  150

seq1  GTTTTTAATGTTTTGAAAAACAAAATTTTAGAAAAACAAAGTTTCAGAGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTTAATGTTTTGAAAAACAAAATTTTAGAAAAACAAAGTTTCAGAGG  200

seq1  GATTGCGAAGACTATTCTTTTATGAATGTATGTGTAGCACACACAGAGAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTGCGAAGACTATTCTTTTATGAATGTATGTGTAGCACACACAGAGAT  250

seq1  ATATGTTTGTATGTGTGGAGGTATACATGTGTATGGGAGTGTGTGTGTAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATGTTTGTATGTGTGGAGGTATACATGTGTATGGGAGTGTGTGTGTAT  300

seq1  AGGG  304
      ||||
seq2  AGGG  304

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information