MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-349G22
Chromosome	4 (Build37)
Map Location	117,931,467 - 118,067,352
singlet/doublet	doublet
Overlap gene	Ptprf, Hyi, BC059842
Upstream gene	Tmem53, 4931406I20Rik, LOC100041093, Prnpip1, Dmap1, LOC433749, Klf17, Ppia-ps4_1138.1, Slc6a9, B4galt2, Atp6v0b, Dph2, Ipo13, Artn, St3gal3, Jmjd2a
Downstream gene	Med8, Elovl1, Cdc20, Mpl, Tie1, LOC545675, LOC666596, 2610528J11Rik, 6330530A05Rik, 1110020C03Rik, Ebna1bp2, LOC100041290, Olfr62, Olfr1343-ps1, Olfr1342, Olfr1341, Olfr1340, Olfr1339, Olfr1338, Olfr1524-ps1, Olfr1337, Olfr219-ps1, GA_x5J8B7W3BSW-40181-41086, Olfr1335, Olfr1333, GA_x5J8B7TQTH0-2-774, Olfr1332-ps1, Olfr1331, Olfr1330, Olfr1329, Olfr1519, Lao1, LOC666703, OTTMUSG00000008833, Slc2a1, Zfp691, Ermap, Ccdc23, 4930538K18Rik, AU022252, Lepre1, Cldn19, Ybx1, Ppih, 1700041C02Rik, Ldha-ps2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Tmem53 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68777 MGI:1916027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4931406I20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66743 MGI:1913993
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041093 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Prnpip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140546 MGI:2153887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dmap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66233 MGI:1913483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433749 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 327 ESTs, 61 Proteins

name	Klf17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75753 MGI:2181068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppia-ps4_1138.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606540
definition	note : peptidylprolyl isomerase A pseudogene 4_1138.1 pseudo : _no_value

name	Slc6a9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14664 MGI:95760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B4galt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53418 MGI:1858493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6v0b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114143 MGI:1890510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dph2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67728 MGI:1914978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ipo13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230673 MGI:2385205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Artn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11876 MGI:1333791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	St3gal3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20441 MGI:1316659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jmjd2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230674 MGI:2446210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptprf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19268 MGI:102695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hyi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68180 MGI:1915430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC059842 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230676 MGI:2686975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 52 ESTs, 4 Proteins

name	Med8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80509 MGI:1915269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Elovl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54325 MGI:1858959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Cdc20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107995 MGI:1859866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17480 MGI:97076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tie1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21846 MGI:99906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545675 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC666596 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	2610528J11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66451 MGI:1913701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330530A05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230678 MGI:1923409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110020C03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68625 MGI:1915875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ebna1bp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69072 MGI:1916322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041290 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Olfr62 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18363 MGI:1333887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1343-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258707 MGI:3031177
definition	gene_synonym : MOR258-4P note : olfactory receptor 1343, pseudogene 1 pseudo : _no_value

name	Olfr1342 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258708 MGI:3031176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1341 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258852 MGI:3031175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1340 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258301 MGI:3031174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1339 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258851 MGI:3031173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1338 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258259 MGI:3031172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1524-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258157 MGI:3031358
definition	gene_synonym : MOR259-4P note : olfactory receptor 1524, pseudogene 1 pseudo : _no_value

name	Olfr1337 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258306 MGI:3031171
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr219-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404347 MGI:3030053
definition	note : olfactory receptor 219, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W3BSW-40181-41086 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257847
definition	note : olfactory receptor GA_x5J8B7W3BSW-40181-41086 pseudo : _no_value

name	Olfr1335 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435804 MGI:3031169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1333 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258265 MGI:3031167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7TQTH0-2-774 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257745
definition	note : olfactory receptor GA_x5J8B7TQTH0-2-774 pseudo : _no_value

name	Olfr1332-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257952 MGI:3031166
definition	gene_synonym : MOR259-7P note : olfactory receptor 1332, pseudogene 1 pseudo : _no_value

name	Olfr1331 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258159 MGI:3031165
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1330 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258331 MGI:3031164
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1329 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258214 MGI:3031163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1519 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258394 MGI:3031353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Lao1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100470 MGI:2140628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666703 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	OTTMUSG00000008833 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433751 MGI:3649462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein

name	Slc2a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20525 MGI:95755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp691 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195522 MGI:3041163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ermap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27028 MGI:1349816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69216 MGI:1916466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4930538K18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75180 MGI:1922430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AU022252 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230696 MGI:2140466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lepre1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56401 MGI:1888921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Cldn19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242653 MGI:3033992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ybx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22608 MGI:99146
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppih (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66101 MGI:106499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700041C02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73332 MGI:1920582
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ldha-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16830 MGI:96761
definition	gene_synonym : Ldh-1ps2; Ldh1-ps2 note : lactate dehydrogenase A, pseudogene 2 pseudo : _no_value

name	Tmem53 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345624 GeneID:68777 MGI:1916027
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 53 transcript_id : NM_026837.2

name	4931406I20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37059807 GeneID:66743 MGI:1913993
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931406I20 gene transcript_id : NM_025739.2

name	LOC100041093 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252872 GeneID:100041093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041093 transcript_id : XM_001475794.1

name	Prnpip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859764 GeneID:140546 MGI:2153887
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prion protein interacting protein 1 transcript_id : NM_080469.2

name	Dmap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981291 GeneID:66233 MGI:1913483
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA methyltransferase 1-associated protein 1 transcript_id : NM_023178.2

name	LOC433749 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372220 GeneID:433749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 327 ESTs, 61 Proteins product : similar to Rho family GTPase RhoA transcript_id : XM_485435.3

name	Klf17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88853590 GeneID:75753 MGI:2181068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kruppel-like factor 17 transcript_id : NM_029416.2

name	Slc6a9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116686111 GeneID:14664 MGI:95760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 6 (neurotransmitter transporter, glycine), member 9 transcript_id : NM_008135.4

name	B4galt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77682040 GeneID:53418 MGI:1858493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 transcript_id : NM_017377.4

name	Atp6v0b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382710 GeneID:114143 MGI:1890510
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal V0 subunit B transcript_id : NM_033617.2

name	Dph2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802472 GeneID:67728 MGI:1914978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DPH2 homolog (S. cerevisiae) transcript_id : NM_026344.3

name	Ipo13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802110 GeneID:230673 MGI:2385205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : importin 13 transcript_id : NM_146152.3

name	Artn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803588 GeneID:11876 MGI:1333791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : artemin transcript_id : NM_009711.3

name	St3gal3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801788 GeneID:20441 MGI:1316659
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST3 beta-galactoside alpha-2,3-sialyltransferase 3 transcript_id : NM_009176.3

name	Jmjd2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859780 GeneID:230674 MGI:2446210
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji domain containing 2A transcript_id : NM_172382.1

name	Ptprf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115648047 GeneID:19268 MGI:102695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, F transcript_id : NM_011213.2

name	Hyi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55742867 GeneID:68180 MGI:1915430
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxypyruvate isomerase homolog (E. coli) transcript_id : NM_026601.1

name	BC059842 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252884 GeneID:230676 MGI:2686975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 52 ESTs, 3 Proteins product : cDNA sequence BC059842 transcript_id : XM_001477657.1

name	Med8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114155156 GeneID:80509 MGI:1915269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 8 homolog (yeast) transcript_id : NM_173719.2

name	Med8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114155154 GeneID:80509 MGI:1915269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 8 homolog (yeast) transcript_id : NM_020000.2

name	Elovl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702349 GeneID:54325 MGI:1858959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 transcript_id : NM_019422.2

name	Elovl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702350 GeneID:54325 MGI:1858959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 transcript_id : NM_001039175.1

name	Elovl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702352 GeneID:54325 MGI:1858959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 transcript_id : NM_001039176.1

name	Cdc20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963586 GeneID:107995 MGI:1859866
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 20 homolog (S. cerevisiae) transcript_id : NM_023223.1

name	Mpl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754729 GeneID:17480 MGI:97076
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloproliferative leukemia virus oncogene transcript_id : NM_010823.1

name	Tie1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144446132 GeneID:21846 MGI:99906
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tyrosine kinase receptor 1 transcript_id : NM_011587.2

name	2610528J11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130308 GeneID:66451 MGI:1913701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610528J11 gene transcript_id : NM_025572.2

name	6330530A05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366443 GeneID:230678 MGI:1923409
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330530A05 gene transcript_id : NM_172383.2

name	1110020C03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802817 GeneID:68625 MGI:1915875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110020C03 gene transcript_id : NM_026789.2

name	Ebna1bp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130295 GeneID:69072 MGI:1916322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EBNA1 binding protein 2 transcript_id : NM_026932.3

name	LOC100041290 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252875 GeneID:100041290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100041290 transcript_id : XM_001476109.1

name	Olfr62 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203768 GeneID:18363 MGI:1333887
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 62 transcript_id : NM_146315.1

name	Olfr1342 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129410 GeneID:258708 MGI:3031176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1342 transcript_id : NM_146713.1

name	Olfr1341 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248517 GeneID:258852 MGI:3031175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1341 transcript_id : NM_146853.2

name	Olfr1340 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129682 GeneID:258301 MGI:3031174
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1340 transcript_id : NM_146304.1

name	Olfr1339 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129160 GeneID:258851 MGI:3031173
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1339 transcript_id : NM_146852.1

name	Olfr1338 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46391060 GeneID:258259 MGI:3031172
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1338 transcript_id : NM_207152.1

name	Olfr1337 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129668 GeneID:258306 MGI:3031171
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1337 transcript_id : NM_146309.1

name	Olfr1335 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70794769 GeneID:435804 MGI:3031169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1335 transcript_id : NM_207703.1

name	Olfr1333 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46391066 GeneID:258265 MGI:3031167
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1333 transcript_id : NM_207157.1

name	Olfr1331 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801469 GeneID:258159 MGI:3031165
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1331 transcript_id : NM_001011856.1

name	Olfr1330 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129631 GeneID:258331 MGI:3031164
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1330 transcript_id : NM_146334.1

name	Olfr1329 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801501 GeneID:258214 MGI:3031163
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1329 transcript_id : NM_001011870.1

name	Olfr1519 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238919 GeneID:258394 MGI:3031353
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : olfactory receptor 1519 transcript_id : NM_146399.1

name	Lao1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981607 GeneID:100470 MGI:2140628
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : L-amino acid oxidase 1 transcript_id : NM_133892.3

name	OTTMUSG00000008833 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252880 GeneID:433751 MGI:3649462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein product : predicted gene, OTTMUSG00000008833 transcript_id : XM_001476391.1

name	Slc2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802497 GeneID:20525 MGI:95755
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 2 (facilitated glucose transporter), member 1 transcript_id : NM_011400.2

name	Zfp691 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802012 GeneID:195522 MGI:3041163
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 691 transcript_id : NM_183140.2

name	Ermap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305040 GeneID:27028 MGI:1349816
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : erythroblast membrane-associated protein transcript_id : NM_013848.1

name	Ccdc23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313571 GeneID:69216 MGI:1916466
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 23 transcript_id : NM_024462.1

name	Ccdc23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872228 GeneID:69216 MGI:1916466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 23 transcript_id : NM_001038998.1

name	4930538K18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388843 GeneID:75180 MGI:1922430
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930538K18 gene transcript_id : NM_029198.2

name	AU022252 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59958367 GeneID:230696 MGI:2140466
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU022252 transcript_id : NM_001012400.1

name	Lepre1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109150432 GeneID:56401 MGI:1888921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leprecan 1 transcript_id : NM_019783.2

name	Lepre1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109150436 GeneID:56401 MGI:1888921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leprecan 1 transcript_id : NM_019782.2

name	Lepre1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109150438 GeneID:56401 MGI:1888921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leprecan 1 transcript_id : NM_001042411.1

name	Cldn19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803203 GeneID:242653 MGI:3033992
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 19 transcript_id : NM_153105.5

name	Cldn19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370228 GeneID:242653 MGI:3033992
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 19 transcript_id : NM_001038590.1

name	Ybx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113205058 GeneID:22608 MGI:99146
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Y box protein 1 transcript_id : NM_011732.2

name	Ppih (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71534274 GeneID:66101 MGI:106499
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidyl prolyl isomerase H transcript_id : NM_028677.3

name	1700041C02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676404 GeneID:73332 MGI:1920582
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700041C02 gene transcript_id : NM_029286.1

name	Tmem53 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312110 CCDS:CCDS18533.1 GeneID:68777 MGI:1916027
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : transmembrane protein 53 protein_id : NP_081113.1

name	4931406I20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37059808 CCDS:CCDS18534.1 GeneID:66743 MGI:1913993
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66743 protein_id : NP_080015.3

name	LOC100041093 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252873 GeneID:100041093
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475844.1

name	Prnpip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859765 CCDS:CCDS18535.1 GeneID:140546 MGI:2153887
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IDA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : prion protein interacting protein 1 protein_id : NP_536717.2

name	Dmap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963557 CCDS:CCDS18536.1 GeneID:66233 MGI:1913483
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005657 - replication fork [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence IDA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0016481 - negative regulation of transcription [Evidence IEA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : DNMT1 associated protein-1 protein_id : NP_075667.1

name	LOC433749 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51709421 GeneID:433749
definition	codon_start : 1 product : similar to Rho family GTPase RhoA protein_id : XP_485435.1

name	Klf17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88853591 CCDS:CCDS18537.1 GeneID:75753 MGI:2181068
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007276 - gametogenesis [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : germ cell specific zinc finger protein product : zinc finger protein 393 protein_id : NP_083692.2

name	Slc6a9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71067352 CCDS:CCDS18538.1 GeneID:14664 MGI:95760
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0005328 - neurotransmitter:sodium symporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : glycine transporter 1 product : solute carrier family 6 member 9 protein_id : NP_032161.2

name	B4galt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8392959 CCDS:CCDS18539.1 GeneID:53418 MGI:1858493
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004461 - lactose synthase activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 note : beta-1,4-galactosyltransferase II; UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 2 product : UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 protein_id : NP_059073.1

name	Atp6v0b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15991795 CCDS:CCDS18540.1 GeneID:114143 MGI:1890510
definition	GO_component : GO:0005768 - endosome [Evidence IDA]; GO:0016471 - hydrogen-translocating V-type ATPase complex [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA]; GO:0005773 - vacuole [Evidence IEA] GO_function : GO:0008553 - hydrogen-exporting ATPase activity, phosphorylative mechanism [Evidence ISS]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0015991 - ATP hydrolysis coupled proton transport [Evidence ISS]; GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATPase, H+ transporting, lysosomal (vacuolar proton pump); lysosomal 21kDa; ATPase, H+ transporting, lysosomal 21kDa, V0 subunit B product : ATPase, H+ transporting, V0 subunit B protein_id : NP_291095.1

name	Dph2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468993 CCDS:CCDS18541.1 GeneID:67728 MGI:1914978
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : diptheria toxin resistance protein required for diphthamide biosynthesis (Saccharomyces)-like 1 product : diptheria toxin resistance protein required for diphthamide biosynthesis (Saccharomyces)-like 2 protein_id : NP_080620.1

name	Ipo13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122681 CCDS:CCDS18542.1 GeneID:230673 MGI:2385205
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006606 - protein import into nucleus [Evidence ISS]; GO:0000059 - protein import into nucleus, docking [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : importin 13 protein_id : NP_666264.1

name	Artn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753124 CCDS:CCDS18543.1 GeneID:11876 MGI:1333791
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0030116 - glial cell line-derived neurotrophic factor receptor binding [Evidence ISS]; GO:0008083 - growth factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005102 - receptor binding [Evidence IPI] GO_process : GO:0007411 - axon guidance [Evidence IMP] [Evidence IDA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence ISS]; GO:0050930 - induction of positive chemotaxis [Evidence IDA]; GO:0007422 - peripheral nervous system development [Evidence IMP] codon_start : 1 product : artemin protein_id : NP_033841.1

name	St3gal3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543705 CCDS:CCDS18544.1 GeneID:20441 MGI:1316659
definition	GO_component : GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008118 - N-acetyllactosaminide alpha-2,3-sialyltransferase activity [Evidence IEA]; GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : sialyltransferase 3; ST3Gal III; sialyltransferase (N-acetyllacosaminide alpha 2,3-sialyltransferase); sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase) product : sialyltransferase 6 protein_id : NP_033202.2

name	Jmjd2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859781 CCDS:CCDS18545.1 GeneID:230674 MGI:2446210
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : jumonji domain containing 2A protein_id : NP_759014.1

name	Ptprf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115648048 CCDS:CCDS18546.1 GeneID:19268 MGI:102695
definition	GO_component : GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007185 - transmembrane receptor protein tyrosine phosphatase signaling pathway [Evidence IEA] codon_start : 1 note : leukocyte antigen-related (LAR) PTP receptor product : protein tyrosine phosphatase, receptor type, F protein_id : NP_035343.2

name	Hyi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55742868 GeneID:68180 MGI:1915430
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hydroxypyruvate isomerase homolog protein_id : NP_080877.1

name	BC059842 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252885 GeneID:230676 MGI:2686975
definition	codon_start : 1 product : hypothetical protein LOC230676 protein_id : XP_001477707.1

name	Med8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29366816 CCDS:CCDS18548.1 GeneID:80509 MGI:1915269
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; activator-recruited cofactor 32 kDa component product : mediator of RNA polymerase II transcription, subunit 8 homolog isoform 2 protein_id : NP_776067.1

name	Med8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114155155 GeneID:80509 MGI:1915269
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; activator-recruited cofactor 32 kDa component product : mediator of RNA polymerase II transcription, subunit 8 homolog isoform 1 protein_id : NP_064384.2

name	Elovl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702353 CCDS:CCDS18549.1 GeneID:54325 MGI:1858959
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; sequence similarity to Cig30 1 product : elongation of very long chain fatty acids-like 1 isoform 1 protein_id : NP_001034265.1

name	Elovl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507145 CCDS:CCDS18549.1 GeneID:54325 MGI:1858959
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 2; sequence similarity to Cig30 1 product : elongation of very long chain fatty acids-like 1 isoform 1 protein_id : NP_062295.1

name	Elovl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702351 CCDS:CCDS18550.1 GeneID:54325 MGI:1858959
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 3; sequence similarity to Cig30 1 product : elongation of very long chain fatty acids-like 1 isoform 2 protein_id : NP_001034264.1

name	Cdc20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963587 CCDS:CCDS18551.1 GeneID:107995 MGI:1859866
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cell division cycle 20 homolog protein_id : NP_075712.1

name	Mpl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754730 CCDS:CCDS18552.1 GeneID:17480 MGI:97076
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : thrombopoietin receptor product : myeloproliferative leukemia virus oncogene protein_id : NP_034953.1

name	Tie1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144446133 CCDS:CCDS18553.1 GeneID:21846 MGI:99906
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016525 - negative regulation of angiogenesis [Evidence IMP]; GO:0030336 - negative regulation of cell migration [Evidence IMP]; GO:0045026 - plasma membrane fusion [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : tyrosine kinase receptor 1 protein_id : NP_035717.2

name	2610528J11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385014 CCDS:CCDS18554.1 GeneID:66451 MGI:1913701
definition	codon_start : 1 product : hypothetical protein LOC66451 protein_id : NP_079848.1

name	6330530A05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369507 GeneID:230678 MGI:1923409
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC230678 protein_id : NP_759015.1

name	1110020C03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312076 GeneID:68625 MGI:1915875
definition	codon_start : 1 product : hypothetical protein LOC68625 protein_id : NP_081065.1

name	Ebna1bp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312728 CCDS:CCDS18555.1 GeneID:69072 MGI:1916322
definition	GO_component : GO:0005730 - nucleolus [Evidence TAS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence TAS] GO_process : GO:0007059 - chromosome segregation [Evidence TAS]; GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence TAS] codon_start : 1 product : EBNA1 binding protein 2 protein_id : NP_081208.1

name	LOC100041290 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252876 GeneID:100041290
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476159.1

name	Olfr62 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203769 CCDS:CCDS18556.1 GeneID:18363 MGI:1333887
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory receptor MOR258-5; GA_x6K02T2QD9B-18877756-18876809 product : olfactory receptor 62 protein_id : NP_666427.1

name	Olfr1342 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129411 CCDS:CCDS18557.1 GeneID:258708 MGI:3031176
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QD9B-18856980-18857927; olfactory receptor MOR258-3 product : olfactory receptor 1342 protein_id : NP_666924.1

name	Olfr1341 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248518 GeneID:258852 MGI:3031175
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QD9B-18838170-18837232; olfactory receptor MOR258-1 product : olfactory receptor 1341 protein_id : NP_667064.2

name	Olfr1340 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129683 CCDS:CCDS18558.1 GeneID:258301 MGI:3031174
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2QD9B-18823451-18822504; olfactory receptor MOR258-6 product : olfactory receptor 1340 protein_id : NP_666416.1

name	Olfr1339 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129161 CCDS:CCDS18559.1 GeneID:258851 MGI:3031173
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QD9B-18815145-18814198; olfactory receptor MOR258-2 product : olfactory receptor 1339 protein_id : NP_667063.1

name	Olfr1338 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46391061 GeneID:258259 MGI:3031172
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2QD9B-18795136-18796077; olfactory receptor MOR259-9 product : olfactory receptor 1338 protein_id : NP_997035.1

name	Olfr1337 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129669 CCDS:CCDS18561.1 GeneID:258306 MGI:3031171
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2QD9B-18767132-18768073; olfactory receptor MOR259-10 product : olfactory receptor 1337 protein_id : NP_666421.1

name	Olfr1335 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70794770 CCDS:CCDS18562.1 GeneID:435804 MGI:3031169
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QD9B-18726774-18727577 product : olfactory receptor 1335 protein_id : NP_997586.1

name	Olfr1333 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46391067 CCDS:CCDS18563.1 GeneID:258265 MGI:3031167
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QD9B-18703033-18703986; olfactory receptor MOR259-6 product : olfactory receptor 1333 protein_id : NP_997040.1

name	Olfr1331 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801470 CCDS:CCDS18564.1 GeneID:258159 MGI:3031165
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2QD9B-18670866-18669913; olfactory receptor MOR259-3P product : olfactory receptor 1331 protein_id : NP_001011856.1

name	Olfr1330 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129632 CCDS:CCDS18565.1 GeneID:258331 MGI:3031164
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QD9B-18644371-18643424; olfactory receptor MOR259-8 product : olfactory receptor 1330 protein_id : NP_666446.1

name	Olfr1329 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801502 CCDS:CCDS18566.1 GeneID:258214 MGI:3031163
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2QD9B-18619941-18620882; olfactory receptor MOR259-2 product : olfactory receptor 1329 protein_id : NP_001011870.1

name	Olfr1519 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238920 GeneID:258394 MGI:3031353
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : olfactory receptor MOR259-1 product : olfactory receptor 1519 protein_id : NP_666511.1

name	Lao1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981608 CCDS:CCDS18568.1 GeneID:100470 MGI:2140628
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0001716 - L-amino-acid oxidase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0009063 - amino acid catabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation product : L-amino acid oxidase 1 protein_id : NP_598653.2

name	OTTMUSG00000008833 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252881 GeneID:433751 MGI:3649462
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476441.1

name	Slc2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094111 CCDS:CCDS18569.1 GeneID:20525 MGI:95755
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005351 - sugar porter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0008643 - carbohydrate transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : solute carrier family 2, member 1 product : solute carrier family 2 (facilitated glucose transporter), member 1 protein_id : NP_035530.1

name	Zfp691 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147153 CCDS:CCDS18570.1 GeneID:195522 MGI:3041163
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 691 protein_id : NP_898963.1

name	Ermap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305041 CCDS:CCDS18571.1 GeneID:27028 MGI:1349816
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : erythroblast membrane-associated protein protein_id : NP_038876.1

name	Ccdc23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872229 CCDS:CCDS18572.1 GeneID:69216 MGI:1916466
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1 product : coiled-coil domain containing 23 isoform a protein_id : NP_001034087.1

name	Ccdc23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313572 GeneID:69216 MGI:1916466
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2 product : coiled-coil domain containing 23 isoform b protein_id : NP_077782.1

name	4930538K18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037399 CCDS:CCDS18574.1 GeneID:75180 MGI:1922430
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC75180 protein_id : NP_083474.1

name	AU022252 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59958368 CCDS:CCDS18575.1 GeneID:230696 MGI:2140466
definition	codon_start : 1 product : hypothetical protein LOC230696 protein_id : NP_001012400.1

name	Lepre1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109150437 CCDS:CCDS18576.1 GeneID:56401 MGI:1888921
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0031418 - L-ascorbic acid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016706 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0019797 - procollagen-proline 3-dioxygenase activity [Evidence IEA] GO_process : GO:0016049 - cell growth [Evidence IDA]; GO:0019538 - protein metabolism [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; growth supressor 1 product : leprecan 1 isoform 1 protein_id : NP_062756.2

name	Lepre1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109150433 GeneID:56401 MGI:1888921
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0031418 - L-ascorbic acid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016706 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0019797 - procollagen-proline 3-dioxygenase activity [Evidence IEA] GO_process : GO:0016049 - cell growth [Evidence IDA]; GO:0019538 - protein metabolism [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; growth supressor 1 product : leprecan 1 isoform 2 protein_id : NP_062757.2

name	Lepre1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109150439 GeneID:56401 MGI:1888921
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0031418 - L-ascorbic acid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016706 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0019797 - procollagen-proline 3-dioxygenase activity [Evidence IEA] GO_process : GO:0016049 - cell growth [Evidence IDA]; GO:0019538 - protein metabolism [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; growth supressor 1 product : leprecan 1 isoform 3 protein_id : NP_001035874.1

name	Cldn19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370229 CCDS:CCDS18577.1 GeneID:242653 MGI:3033992
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence ISS] [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IMP] GO_process : GO:0019227 - action potential propagation [Evidence IMP]; GO:0043297 - apical junction assembly [Evidence IMP]; GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : claudin 19 isoform 1 protein_id : NP_001033679.1

name	Cldn19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346535 CCDS:CCDS18578.1 GeneID:242653 MGI:3033992
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence ISS] [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IMP] GO_process : GO:0019227 - action potential propagation [Evidence IMP]; GO:0043297 - apical junction assembly [Evidence IMP]; GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : claudin 19 isoform 2 protein_id : NP_694745.1

name	Ybx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113205059 CCDS:CCDS18579.1 GeneID:22608 MGI:99146
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003697 - single-stranded DNA binding [Evidence IDA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : DNA binding protein B; Y-box binding protein 1 product : nuclease sensitive element binding protein 1 protein_id : NP_035862.2

name	Ppih (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312022 CCDS:CCDS18580.1 GeneID:66101 MGI:106499
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : rotamase H; cyclophilin H product : peptidylprolyl isomerase H protein_id : NP_082953.1

name	1700041C02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117676405 GeneID:73332 MGI:1920582
definition	codon_start : 1 product : hypothetical protein LOC73332 protein_id : NP_083562.1

name	LOC545675 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:545675
definition	number : 2 pseudo : _no_value

name	LOC545675 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:545675
definition	number : 1 pseudo : _no_value

name	LOC666596 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666596
definition	number : 1 pseudo : _no_value

name	LOC666596 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666596
definition	number : 2 pseudo : _no_value

name	LOC666703 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666703
definition	number : 1 pseudo : _no_value

clone name	MSMg01-349G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461O23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-306E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277K11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-080E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-169P11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-536D13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-126C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326H14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-355F01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-548K24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-398A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299G14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-324P06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-450B18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-441B07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-544P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425L22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-202P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396B10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-396D02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-293F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213P04
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-349G22.b	B6Ng01-349G22.g
ACC	GA130427	GA130428
length	992	1,105
definition	B6Ng01-349G22.b	B6Ng01-349G22.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(117,931,467 - 117,932,436)	(118,066,243 - 118,067,352)
sequence	gaattcaacagtacctctcctcttcccaagcttggctctgggtgtaccta atgagggactagagaatgtctgccctttgtttacctttcggcaagaaagc tgggcagtatggtggtggcagaggcaccactccactcttccctctcacat gcccagcacaggtcagtgtgcaggaacatttgctgcacccaggctcccat gccaggaagactcagcctcagagggagaaaagtaaagggcagggtgacag cacccggggcacagacaagatgaagctggaggagccaccgcaggcagagg aacctccatcaaagttgcaacttctagggatatcctagaagggtgtctgg ctggggttataggagatctctcatcatggccctgaatccccaggtttggc caggaattggctatacacttccctgtttggagccctataaattctgatgt aaaccctgggtctctttggctgtaagtatgatgccacagagctctgactc ttagctgatttttgggggggggggttcaagacagggtttctctgtgtagc cctggctgtcctggaattcactctgtagaccaggctggcctcaaactctg cctgcctctgccttccaagtgctaggattaaaggcgtgcaccaccactgc ccggctcagctgattcttgaaaggatcatatttaaacagcagcaggaaga gaaaagaggaggggagtgaggactgaagatgcacagctttccttgggcct ggcaccactttggaagcttaagagttaagccctgaggcctagggcaacct tccccattccccatctagcattcagggatcccaaaggctgctagagcttc agcttatcatcactgaccaccgcatcgggcggtgttctttctaggcttta ctcttgtctggtcctgaacaactgggggtgcagatggaggggcggctagg tcctggtcagagttaaagtccataggagctctcccagcctct	gaattcattccaagtgaagccaagggccatcgtgtagacagctgtaggtg cgtggggaagggatgaagataaggaagcgaatggccaggaaaggaaatga gtcacatggacaggtctgccgtcatccactgcagagattggcagtgagtg tggaggctttccaggccctgagtttcagagctgtgtgactttgctgtagt gtgtgacagtagccacagacaaaatacaaaatgaatacgtgcggctgtcc cacaaactccactaacagaaatataggtctgggctgatttgggctgtaga ttagaagtagatgggtccatagccttgttgttggtatcaccaaagcttat tgtcaatgcaggctctcaggcctcacagcagacgtgtgtgttaacacaat cccaaagggcttgtatgcacctcaaagattaagaagccttttgttagacc tataatgacaagaagccggtggaacccttaacaaagcccgtagagaaggc taaagagtgtttttgacctggatgaaggagggctgagtgtggtgtggcca gctggcattgatcttagaaaggctaaaggataggtacagggtgggggtcg atcctgggagcactgtgaccatttccctccgtggtctgggaattgggagc agtagattcctctcctgctcttctttcctggctctgatggaacagggtct tcccttgctctctccaggtgggaggcgtttactcctatgattgtagcttt ggtcacgtgcctaacgtggagttgatgaagttcatcgccatggcaacgtt tggctcctacctgtccacttgtcctgagaccgagccaggcaacctgggtc tgactgtgtaccaccgggcgttcctgctctactcctttcctgcgcagtgg ggaagccctgaaccctgagtactactgtggtaaggccaggcccttgttgg tgggacaaggcagaatggcctgaagatggcatgaccttggctttgggaga ctggtggtctaactggggctgcttctctgaactccttctctataatctca gtgtagcccctcccatgaacatacatcgcctgaaaccatctccactttca cttcc
quality values	Open. Hide. 49 49 33 41 62 31 25 54 41 27 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 44 30 59 62 59 59 38 49 28 45 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 59 49 62 59 62 62 62 62 62 59 59 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 59 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 49 62 62 62 62 62 56 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 42 51 56 56 56 56 62 56 50 51 56 56 47 47 39 56 51 50 56 56 62 62 56 47 51 51 56 56 51 51 28 24 40 50 56 56 56 56 62 43 54 56 56 56 46 41 37 33 43 62 56 56 38 22 47 43 41 38 34 62 54 41 62 62 43 56 56 56 40 41 46 43 47 47 48 54 48 52 52 62 45 54 62 62 52 52 14 13 10 8 11 9 9 27 24 9 19 31 43 52 47 62 62 27 31 31 52 16 15 24 29 42 46 54 52 50 52 47 40 40 41 39 52 52 54 39 29 52 23 28 26 50 35 29 13 32 54 58 54 32 47 52 46 32 42 42 32 35 22 45 28 26 37 32 46 31 12 50 41 46 42 52 50 46 39 35 28 9 23 30 13 33 19 12 16 52 26 39 28 28 22 18 33 10 19 25 10 52 16 15 29 13 14 21 26 15 26 20 16 32 32 38 11 13 51 32 40 37 25 34 20 16 16 26 18 14 21 19 10 37 42 47 23 39 24 16 34 17 16 21 28 35 24 24 7 27 28 50 15 46 30 9 17 10 9 13 14 6 22 11 7 7 12 12 12 36 46 39 39 35 35 7 17 16 34 46 49 16 52 36 31 34 18 17 37 29 9 24 22 24 19 12 18 10 21 21 31 19 24 51 39 35 16 9 17 20 14 17 18 26 19 14 10 6 4 5 11 28 20 31 22 32 32 18 40 47 18 29 38 32 49 20 19 35 26 22 9 9 10 13 19 24 28 26 30 29 29 23 19 15 13 18 18 9 10 11 21 21 14 9 15 13 6 6 13 11 14 8 19 12 18 10 22 27 16 17 14 10 6 16 31 13 19 26 31 21 10 16 31 17 24 20 14 11 16 10 23 14 9 6 22 21 32 21 25 19 32 20 18 24 18 13 9 13 14 9 11 21 22 21 21 12 16 15 20 14 16 9 18 14 21 18 15 9 5 5 15 32 27 15 18 28 6 13 12 7 32 7 8 6 4 6 17 7 9 14 23 24 8 12 8 22 34 10 15 22 23 23 7 11 9 6 12 19 7 9 7 18	Open. Hide. 62 49 56 44 49 44 47 62 62 59 44 38 29 38 59 56 37 33 46 51 59 62 62 62 62 62 62 59 62 62 62 49 54 62 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 49 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 49 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 54 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 45 54 52 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 44 46 46 54 54 58 47 52 54 54 58 52 54 54 52 54 54 58 52 58 58 58 58 37 54 52 58 58 58 58 58 58 54 58 58 58 58 58 58 54 54 58 45 52 54 45 52 54 54 58 58 58 49 58 58 34 58 54 46 58 54 58 47 58 58 52 58 45 42 51 41 58 45 41 44 50 53 58 58 58 58 50 40 58 58 58 37 45 51 58 51 50 53 58 58 47 58 58 33 49 58 58 41 45 58 51 50 51 49 58 53 40 41 50 54 58 58 41 58 58 58 58 44 50 50 58 49 50 31 48 50 48 58 43 41 40 52 33 40 54 58 37 38 37 41 50 41 50 44 50 31 42 39 37 32 40 37 42 49 46 43 40 50 50 58 49 58 37 31 51 50 41 43 58 25 49 51 50 41 41 37 41 39 41 41 44 50 40 53 26 44 41 54 42 38 35 49 53 39 41 54 40 34 32 37 51 35 29 49 41 44 40 52 23 54 49 49 40 40 34 37 54 54 41 45 40 41 24 34 31 40 43 46 40 52 38 52 32 31 19 23 30 26 51 24 47 54 54 33 28 54 25 28 28 54 18 22 37 31 25 52 41 52 52 53 39 21 40 46 31 32 39 43 32 51 40 15 26 29 35 26 24 29 30 32 45 34 32 33 32 32 52 40 45 35 33 26 30 31 30 45 23 37 45 31 14 31 30 31 31 31 33 32 27 34 17 30 26 34 31 35 37 43 30 43 51 31 44 31 31 45 22 30 32 31 24 25 32 40 36 22 32 29 31 31 22 27 32 22 31 27 37 42 24 41 24 30 19 27 8 29 24 18 12 30 24 32 25 20 24 28 30 36 27 30 31 31 26 27 19 27 31 31 31 31 29 22 32 30 30 31 18 35 23 18 29 30 7 10 33 26 31 19 28 20 31 13 11 26 17 29 21 44 14 22 20 32 31 20 19 27 21 13 24 37 35 36 31 20 24 31 25 21 22 28 20 14 19 17 19 25 31 26 31 18 32 22 27 32 32 32 32 28 23 18 25 16 28 11 17 21 21 17 22 18 12 9 24 28 11 8 19 8 8 15 30 19 10 31 19 6 6 9 18 4 4 4 8 6 8 19 12 14 4 4 4 43 5 3 4 4 6 6 11 16 16 14 25 27 26 15 11 18 18 8 18 6 13 40 18 11 24 15 19 14 4 5 11 27 14 12 11 21 6 19 24 21 18 20 16 27 28 28 22 9 8 30 11 22 27 20 15 13 6 3 3 3 3 8 10 4 17 11 12 11 15 8 22 7 7 17 6 5 7 14 21 5 4 4 5 21 5 17 28 23 16 13 4 29 4 1 3 4 5 5 6 5 9 8 6 5 18 6 4 4 5 6 8 18 20 6 6 4 6 11 7 4 4 20 6 4 9 8 10 5 4 5 4 7 3 12

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_117931467_117932436
seq2: B6Ng01-349G22.b_47_1038

seq1  GAATTCAACAGTACCTCTCCTCTTCCCAAGCTTGGCTCTGGGTGTACCTA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAACAGTACCTCTCCTCTTCCCAAGCTTGGCTCTGGGTGTACCTA  50

seq1  ATGAGGGACTAGAGAATGTCTGCCCTTTGTTTACCTTTCGGCAAGAAAGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGGGACTAGAGAATGTCTGCCCTTTGTTTACCTTTCGGCAAGAAAGC  100

seq1  TGGGCAGTATGGTGGTGGCAGAGGCACCACTCCACTCTTCCCTCTCACAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCAGTATGGTGGTGGCAGAGGCACCACTCCACTCTTCCCTCTCACAT  150

seq1  GCCCAGCACAGGTCAGTGTGCAGGAACATTTGCTGCACCCAGGCTCCCAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCAGCACAGGTCAGTGTGCAGGAACATTTGCTGCACCCAGGCTCCCAT  200

seq1  GCCAGGAAGACTCAGCCTCAGAGGGAGAAAAGTAAAGGGCAGGGTGACAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGGAAGACTCAGCCTCAGAGGGAGAAAAGTAAAGGGCAGGGTGACAG  250

seq1  CACCCGGGGCACAGACAAGATGAAGCTGGAGGAGCCACCGCAGGCAGAGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCCGGGGCACAGACAAGATGAAGCTGGAGGAGCCACCGCAGGCAGAGG  300

seq1  AACCTCCATCAAAGTTGCAACTTCTAGGGATATCCTAGAAGGGTGTCTGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCTCCATCAAAGTTGCAACTTCTAGGGATATCCTAGAAGGGTGTCTGG  350

seq1  CTGGGGTTATAGGAGATCTCTCATCATGGCCCTGAATCCCCAGGTTTGGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGGTTATAGGAGATCTCTCATCATGGCCCTGAATCCCCAGGTTTGGC  400

seq1  CAGGAATTGGCTATACACTTCCCTGTTTGGAGCCCTATAAATTCTGATGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAATTGGCTATACACTTCCCTGTTTGGAGCCCTATAAATTCTGATGT  450

seq1  AAACCCTGGGTCTCTTTGGCTGTAAGTATGATGCCACAGAGCTCTGACTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACCCTGGGTCTCTTTGGCTGTAAGTATGATGCCACAGAGCTCTGACTC  500

seq1  TTAGCTGATTTTTGGGGGGGGGGGTTCAAGACAGGGTTTCTCTGTGTAGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGCTGATTTTTGGGGGGGGGGGTTCAAGACAGGGTTTCTCTGTGTAGC  550

seq1  CCTGGCTGTCCTGGAATTCACTCTGTAGACCAGGCTGGCCTCAAACTCTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGCTGTCCTGGAATTCACTCTGTAGACCAGGCTGGCCTCAAACTCTG  600

seq1  CCTGCCTCTGCCTCCCAAGTGCTAGGATTAAAGGCGTGCACCACCACTGC  650
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  CCTGCCTCTGCCTTCCAAGTGCTAGGATTAAAGGCGTGCACCACCACTGC  650

seq1  CCGGCTCAGCTGATTCTTGAAAGGATCATA-TTAAACAGCAGCAGGAAGA  699
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  CCGGCTCAGCTGATTCTTGAAAGGATCATATTTAAACAGCAGCAGGAAGA  700

seq1  G-AAAGAGGAGGGGAGTGAGGACTGAAGATGCACAGC-TTCCTT-GGCCT  746
      | ||||||||||||||||||||||||||||||||||| |||||| |||||
seq2  GAAAAGAGGAGGGGAGTGAGGACTGAAGATGCACAGCTTTCCTTGGGCCT  750

seq1  GGCACCAC-TTGGAAGC-TAAGAG-TAAGCCCTGAGGCCTAGGGCAACC-  792
      |||||||| |||||||| |||||| |||||||||||||||||||||||| 
seq2  GGCACCACTTTGGAAGCTTAAGAGTTAAGCCCTGAGGCCTAGGGCAACCT  800

seq1  TCCCCA-TCCCCATCTAGCA-TCAGGGATCCC-AAGGCTGCTAGAGCTAC  839
      |||||| ||||||||||||| ||||||||||| ||||||||||||||| |
seq2  TCCCCATTCCCCATCTAGCATTCAGGGATCCCAAAGGCTGCTAGAGCTTC  850

seq1  AGC-TATCATCACTGACCACCGCATCGAGC-GTGTTC-TTCCAGGC-TTA  885
      ||| ||||||||||||||||||||||| || |||||| ||| |||| |||
seq2  AGCTTATCATCACTGACCACCGCATCGGGCGGTGTTCTTTCTAGGCTTTA  900

seq1  CTCCTGTCTG--TCTGAACAACT-GGGGTGCAGGATGAGGGGCGGCTAGG  932
      ||| ||||||   |||||||||| |||||||||   ||||||||||||||
seq2  CTCTTGTCTGGTCCTGAACAACTGGGGGTGCAGATGGAGGGGCGGCTAGG  950

seq1  TCCTGG-CAGAGTCAGAG-CCA-AGGAGCTCT-CCAGCCTCT  970
      |||||| |||||| | || ||| ||||||||| |||||||||
seq2  TCCTGGTCAGAGTTAAAGTCCATAGGAGCTCTCCCAGCCTCT  992

seq1: chr4_118066243_118067352
seq2: B6Ng01-349G22.g_66_1170 (reverse)

seq1  GGAAGGAGAAAGTGGAGAT-GTGTCAGCTGATGTATGTACAGGGGAGGGG  49
      |||| | |||||||||||| || ||||  ||||||||| || ||||||||
seq2  GGAA-GTGAAAGTGGAGATGGTTTCAGGCGATGTATGTTCATGGGAGGGG  49

seq1  CTACACTGAGATTATTAGGAGAAAGAGAACCAGAGAAGCCAGCCCCAGTT  99
      |||||||||||||||   ||||| |||   |||||||| |||||||||||
seq2  CTACACTGAGATTAT--AGAGAAGGAG-TTCAGAGAAG-CAGCCCCAGTT  95

seq1  AGACCACCAGTCCTCCCAAAGCCAAGGTCATGCCATCTCCAAGGGCCA-T  148
      ||||||||||| |||||||||||||||||||||||||| ||  ||||| |
seq2  AGACCACCAGT-CTCCCAAAGCCAAGGTCATGCCATCTTCA--GGCCATT  142

seq1  CTGCCCTTGTCCCACCCAC-AGGGCCTGGCCTTACCACAGTAGTACTCAG  197
      ||| |||||||||||| || ||||||||||||||||||||||||||||||
seq2  CTG-CCTTGTCCCACCAACAAGGGCCTGGCCTTACCACAGTAGTACTCAG  191

seq1  GGTTCAGGGCTTCCCCACTGCGCAGG-AAGGAGTAGAGCAGGAACGCCCG  246
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  GGTTCAGGGCTTCCCCACTGCGCAGGAAAGGAGTAGAGCAGGAACGCCCG  241

seq1  GTGGTACACAGTCAGACCCAGGTTGCCTGGCTCGGTCTCAGGACAAGTGG  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTACACAGTCAGACCCAGGTTGCCTGGCTCGGTCTCAGGACAAGTGG  291

seq1  ACAGGTAGGAGCCAAACGTTGCCATGGCGATGAACTTCATCAACTCCACG  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGTAGGAGCCAAACGTTGCCATGGCGATGAACTTCATCAACTCCACG  341

seq1  TTAGGCACGTGACCAAAGCTACAATCATAGGAGTAAACGCCTCCCACCTG  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGGCACGTGACCAAAGCTACAATCATAGGAGTAAACGCCTCCCACCTG  391

seq1  GAGAGAGCAAGGGAAGACCCTGTTCCATCAGAGCCAGGAAAGAAGAGCAG  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGAGCAAGGGAAGACCCTGTTCCATCAGAGCCAGGAAAGAAGAGCAG  441

seq1  GAGAGGAATCTACTGCTCCCAATTCCCAGACCACGGAGGGAAATGGTCAC  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGGAATCTACTGCTCCCAATTCCCAGACCACGGAGGGAAATGGTCAC  491

seq1  AGTGCTCCCAGGATCGACCCCCACCCTGTACCTATCCTTTAGCCTTTCTA  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGCTCCCAGGATCGACCCCCACCCTGTACCTATCCTTTAGCCTTTCTA  541

seq1  AGATCAATGCCAGCTGGCCACACCACACTCAGCCCTCCTTCATCCAGGTC  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATCAATGCCAGCTGGCCACACCACACTCAGCCCTCCTTCATCCAGGTC  591

seq1  AAAAACACTCTTTAGCCTTCTCTACGGGCTTTGTTAAGGGTTCCACCGGC  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAACACTCTTTAGCCTTCTCTACGGGCTTTGTTAAGGGTTCCACCGGC  641

seq1  TTCTTGTCATTATAGGTCTAACAAAAGGCTTCTTAATCTTTGAGGTGCAT  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTGTCATTATAGGTCTAACAAAAGGCTTCTTAATCTTTGAGGTGCAT  691

seq1  ACAAGCCCTTTGGGATTGTGTTAACACACACGTCTGCTGTGAGGCCTGAG  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGCCCTTTGGGATTGTGTTAACACACACGTCTGCTGTGAGGCCTGAG  741

seq1  AGCCTGCATTGACAATAAGCTTTGGTGATACCAACAACAAGGCTATGGAC  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCTGCATTGACAATAAGCTTTGGTGATACCAACAACAAGGCTATGGAC  791

seq1  CCATCTACTTCTAATCTACAGCCCAAATCAGCCCAGACCTATATTTCTGT  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATCTACTTCTAATCTACAGCCCAAATCAGCCCAGACCTATATTTCTGT  841

seq1  TAGTGGAGTTTGTGGGACAGCCGCACGTATTCATTTTGTATTTTGTCTGT  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTGGAGTTTGTGGGACAGCCGCACGTATTCATTTTGTATTTTGTCTGT  891

seq1  GGCTACTGTCACACACTACAGCAAAGTCACACAGCTCTGAAACTCAGGGC  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTACTGTCACACACTACAGCAAAGTCACACAGCTCTGAAACTCAGGGC  941

seq1  CTGGAAAGCCTCCACACTCACTGCCAATCTCTGCAGTGGATGACGGCAGA  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGAAAGCCTCCACACTCACTGCCAATCTCTGCAGTGGATGACGGCAGA  991

seq1  CCTGTCCATGTGACTCATTTCCTTTCCTGGCCATTCGCTTCCTTATCTTC  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTCCATGTGACTCATTTCCTTTCCTGGCCATTCGCTTCCTTATCTTC  1041

seq1  ATCCCTTCCCCACGCACCTACAGCTGTCTACACGATGGCCCTTGGCTTCA  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCCTTCCCCACGCACCTACAGCTGTCTACACGATGGCCCTTGGCTTCA  1091

seq1  CTTGGAATGAATTC  1110
      ||||||||||||||
seq2  CTTGGAATGAATTC  1105

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information