MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-350I21
Chromosome	4 (Build37)
Map Location	47,146,330 - 47,313,978
singlet/doublet	doublet
Overlap gene	Col15a1
Upstream gene	BC057893, AU014645, Xpa, LOC624430, LOC666379, LOC666389, Foxe1, 5830415F09Rik, Hemgn, LOC100040643, Anp32b, Nans, Trim14, Coro2a, Tbc1d2, Gabbr2, Anks6, LOC435781, Galnt12
Downstream gene	Tgfbr1, LOC666236, LOC666473, Alg2, Sec61b, LOC100040788, Nr4a3, Stx17, Txndc4, Invs
Link	Open Mouse BAC browser

Click to get alignment info.

name	BC057893 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272027 MGI:3039624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AU014645 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433702 MGI:2140419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22590 MGI:99135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624430 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624430
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 264 ESTs, 6 Proteins pseudo : _no_value

name	LOC666379 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666379
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC666389 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666389
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 2 Proteins pseudo : _no_value

name	Foxe1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110805 MGI:1353500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830415F09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74753 MGI:1922003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hemgn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93966 MGI:2136910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040643 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040643
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Anp32b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67628 MGI:1914878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nans (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94181 MGI:2149820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74735 MGI:1921985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coro2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107684 MGI:1345966
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381605 MGI:2652885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gabbr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242425 MGI:2386030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anks6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75691 MGI:1922941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435781 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Galnt12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230145 MGI:2444664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col15a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12819 MGI:88449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tgfbr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21812 MGI:98728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666236 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	LOC666473 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666473
definition	note : microfibrillar-associated protein 1 pseudogene pseudo : _no_value

name	Alg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56737 MGI:1914731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sec61b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66212 MGI:1913462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040788 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Nr4a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18124 MGI:1352457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stx17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67727 MGI:1914977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txndc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76299 MGI:1923549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Invs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16348 MGI:1335082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC057893 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922727 GeneID:272027 MGI:3039624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC057893 transcript_id : NM_173033.3

name	AU014645 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922626 GeneID:433702 MGI:2140419
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU014645 transcript_id : NM_001033201.3

name	Xpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106448 GeneID:22590 MGI:99135
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : xeroderma pigmentosum, complementation group A transcript_id : NM_011728.1

name	Foxe1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34304110 GeneID:110805 MGI:1353500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box E1 (thyroid transcription factor 2) transcript_id : NM_183298.1

name	5830415F09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347462 GeneID:74753 MGI:1922003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830415F09 gene transcript_id : NM_029086.2

name	Hemgn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131169 GeneID:93966 MGI:2136910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemogen transcript_id : NM_053149.2

name	Anp32b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363533 GeneID:67628 MGI:1914878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acidic nuclear phosphoprotein 32 family, member B transcript_id : NM_130889.2

name	Nans (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802602 GeneID:94181 MGI:2149820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetylneuraminic acid synthase (sialic acid synthase) transcript_id : NM_053179.3

name	Trim14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349730 GeneID:74735 MGI:1921985
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 14 transcript_id : NM_029077.2

name	Coro2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802181 GeneID:107684 MGI:1345966
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coronin, actin binding protein 2A transcript_id : NM_178893.3

name	Tbc1d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111038125 GeneID:381605 MGI:2652885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 2 transcript_id : NM_198664.3

name	Gabbr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487262 GeneID:242425 MGI:2386030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-aminobutyric acid (GABA) B receptor 2 transcript_id : NM_001081141.1

name	Anks6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67906180 GeneID:75691 MGI:1922941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and sterile alpha motif domain containing 6 transcript_id : NM_001024136.1

name	Galnt12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802625 GeneID:230145 MGI:2444664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 transcript_id : NM_172693.3

name	Col15a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134288881 GeneID:12819 MGI:88449
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type XV transcript_id : NM_009928.3

name	Tgfbr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254607 GeneID:21812 MGI:98728
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming growth factor, beta receptor I transcript_id : NM_009370.2

name	LOC666236 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94371752 GeneID:666236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC666236, transcript variant 1 transcript_id : XM_988573.1

name	LOC666236 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94371754 GeneID:666236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical LOC666236, transcript variant 2 transcript_id : XM_988612.1

name	Alg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560365 GeneID:56737 MGI:1914731
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : asparagine-linked glycosylation 2 homolog (yeast, alpha-1,3-mannosyltransferase) transcript_id : NM_019998.2

name	Sec61b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378097 GeneID:66212 MGI:1913462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sec61 beta subunit transcript_id : NM_024171.2

name	LOC100040788 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252384 GeneID:100040788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100040788 transcript_id : XM_001475260.1

name	Nr4a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131008 GeneID:18124 MGI:1352457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 4, group A, member 3 transcript_id : NM_015743.2

name	Stx17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579892 GeneID:67727 MGI:1914977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 17 transcript_id : NM_026343.2

name	Txndc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88900513 GeneID:76299 MGI:1923549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin domain containing 4 (endoplasmic reticulum) transcript_id : NM_029572.2

name	Invs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111120341 GeneID:16348 MGI:1335082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inversin transcript_id : NM_010569.3

name	BC057893 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922728 GeneID:272027 MGI:3039624
definition	codon_start : 1 product : hypothetical protein LOC272027 protein_id : NP_766621.3

name	AU014645 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922627 CCDS:CCDS18145.1 GeneID:433702 MGI:2140419
definition	GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] codon_start : 1 note : nuclear cap binding protein subunit 1 product : nuclear cap binding protein subunit 1, 80kDa protein_id : NP_001028373.2

name	Xpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106449 CCDS:CCDS18146.1 GeneID:22590 MGI:99135
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003684 - damaged DNA binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IMP]; GO:0006289 - nucleotide-excision repair [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006979 - response to oxidative stress [Evidence IMP] codon_start : 1 exception : mismatches in translation product : xeroderma pigmentosum, complementation group A protein_id : NP_035858.1

name	Foxe1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304111 CCDS:CCDS18147.1 GeneID:110805 MGI:1353500
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0031069 - hair follicle morphogenesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : forkhead box E1 (thyroid transcription factor 2) protein_id : NP_899121.1

name	5830415F09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626025 CCDS:CCDS18148.1 GeneID:74753 MGI:1922003
definition	GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74753 protein_id : NP_083362.1

name	Hemgn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716441 CCDS:CCDS18150.1 GeneID:93966 MGI:2136910
definition	GO_component : GO:0005654 - nucleoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 note : nuclear protein; negative differentiation regulator product : hemogen protein_id : NP_444379.1

name	Anp32b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18700032 CCDS:CCDS18151.1 GeneID:67628 MGI:1914878
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0000084 - S phase of mitotic cell cycle [Evidence ISS] codon_start : 1 note : acidic protein rich in leucines; proliferation related acidic leucine rich protein PAL31 product : acidic nuclear phosphoprotein 32 family, member B protein_id : NP_570959.1

name	Nans (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716467 CCDS:CCDS18152.1 GeneID:94181 MGI:2149820
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0019007 - N-acetylneuraminic acid phosphate synthase activity [Evidence IDA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0016051 - carbohydrate biosynthesis [Evidence IEA] codon_start : 1 note : N-acetylneuraminic acid 9-phosphate synthetase; N-acetylneuraminic acid phosphate synthase; sialic acid synthase product : N-acetylneuraminic acid synthase (sialic acid synthase) protein_id : NP_444409.1

name	Trim14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39540508 CCDS:CCDS18153.1 GeneID:74735 MGI:1921985
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : PU.1 binding protein Pub protein_id : NP_083353.1

name	Coro2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794278 CCDS:CCDS18154.1 GeneID:107684 MGI:1345966
definition	GO_function : GO:0003779 - actin binding [Evidence ISS] [Evidence IEA]; GO:0004356 - glutamate-ammonia ligase activity [Evidence IEA] GO_process : GO:0006542 - glutamine biosynthesis [Evidence IEA]; GO:0006807 - nitrogen compound metabolism [Evidence IEA] codon_start : 1 note : coronin 4 product : coronin, actin binding protein 2A protein_id : NP_849224.1

name	Tbc1d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111038126 CCDS:CCDS18155.1 GeneID:381605 MGI:2652885
definition	codon_start : 1 note : likely ortholog of H. sapiens TBC1 domain family, member 2 (TBC1D2) product : TBC1 domain family, member 2 protein_id : NP_941066.3

name	Gabbr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487263 GeneID:242425 MGI:2386030
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0043005 - neuron projection [Evidence IDA] GO_function : GO:0004965 - GABA-B receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : GABA-B receptor 2; gamma-aminobutyric acid type B receptor, subunit 2; G protein-coupled receptor 51; ortholog of human G protein-coupled receptor 51 GPR51 product : gamma-aminobutyric acid (GABA) B receptor 2 protein_id : NP_001074610.1

name	Anks6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906181 CCDS:CCDS18157.1 GeneID:75691 MGI:1922941
definition	codon_start : 1 note : ankyrin repeat domain 14 product : sterile alpha motif domain containing 6 protein_id : NP_001019307.1

name	Galnt12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370010 CCDS:CCDS18158.1 GeneID:230145 MGI:2444664
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0004653 - polypeptide N-acetylgalactosaminyltransferase activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : mpp-GalNAc-T12 product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 protein_id : NP_766281.1

name	Col15a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134288882 CCDS:CCDS18159.1 GeneID:12819 MGI:88449
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0031012 - extracellular matrix [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 note : type XV collagen; procollagen type XV product : procollagen, type XV protein_id : NP_034058.2

name	Tgfbr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678323 CCDS:CCDS18160.1 GeneID:21812 MGI:98728
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004702 - receptor signaling protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0005024 - transforming growth factor beta receptor activity [Evidence IDA]; GO:0004675 - transmembrane receptor protein serine/threonine kinase activity [Evidence IEA] GO_process : GO:0030199 - collagen fibril organization [Evidence IMP]; GO:0009790 - embryonic development [Evidence IMP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0008354 - germ cell migration [Evidence IMP]; GO:0048663 - neuron fate commitment [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007179 - transforming growth factor beta receptor signaling pathway [Evidence IDA]; GO:0007178 - transmembrane receptor protein serine/threonine kinase signaling pathway [Evidence IEA] codon_start : 1 product : transforming growth factor, beta receptor I protein_id : NP_033396.1

name	LOC666236 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94371755 GeneID:666236
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_993706.1

name	LOC666236 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94371753 GeneID:666236
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_993667.1

name	Alg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560366 CCDS:CCDS18161.1 GeneID:56737 MGI:1914731
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : alpha-1,3-mannosyltransferase ALG2 protein_id : NP_064382.2

name	Sec61b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13324684 GeneID:66212 MGI:1913462
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : Sec61 beta subunit protein_id : NP_077133.1

name	LOC100040788 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252385 GeneID:100040788
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475310.1

name	Nr4a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657397 CCDS:CCDS18163.1 GeneID:18124 MGI:1352457
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0001707 - mesoderm formation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : neural orphan receptor 1 product : nuclear receptor subfamily 4, group A, member 3 protein_id : NP_056558.1

name	Stx17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84579893 CCDS:CCDS18164.1 GeneID:67727 MGI:1914977
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0030868 - smooth endoplasmic reticulum membrane [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : syntaxin 17 protein_id : NP_080619.2

name	Txndc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19072792 CCDS:CCDS18165.1 GeneID:76299 MGI:1923549
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005788 - endoplasmic reticulum lumen [Evidence ISS]; GO:0005789 - endoplasmic reticulum membrane [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0003756 - protein disulfide isomerase activity [Evidence ISS]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] GO_process : GO:0009100 - glycoprotein metabolism [Evidence ISS]; GO:0006457 - protein folding [Evidence ISS] [Evidence IEA]; GO:0030503 - regulation of cell redox homeostasis [Evidence ISS]; GO:0006986 - response to unfolded protein [Evidence ISS]; GO:0045045 - secretory pathway [Evidence ISS] codon_start : 1 note : endoplasmic reticulum resident protein 44kDa product : thioredoxin domain containing 4 protein_id : NP_083848.1

name	Invs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111120342 CCDS:CCDS18166.1 GeneID:16348 MGI:1335082
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : inversion of embryonic turning product : inversin protein_id : NP_034699.3

name	LOC666379 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666379
definition	number : 3 pseudo : _no_value

name	LOC666379 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666379
definition	number : 2 pseudo : _no_value

name	LOC666379 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666379
definition	number : 1 pseudo : _no_value

name	LOC100040643 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040643
definition	number : 2 pseudo : _no_value

name	LOC100040643 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040643
definition	number : 1 pseudo : _no_value

name	LOC435781 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435781
definition	number : 2 pseudo : _no_value

name	LOC435781 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435781
definition	number : 1 pseudo : _no_value

name	LOC624430 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252370 GeneID:624430
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 264 ESTs, 6 Proteins product : similar to OTU domain containing 6B pseudo : _no_value transcript_id : XR_031787.1

name	LOC666389 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252371 GeneID:666389
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 2 Proteins product : similar to ribosomal protein pseudo : _no_value transcript_id : XR_031797.1

clone name	MSMg01-455N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122E10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-547N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181K07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-128N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293L19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-295J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128E19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-350I21.b	B6Ng01-350I21.g
ACC	GA131190	GA131191
length	1,100	1,105
definition	B6Ng01-350I21.b	B6Ng01-350I21.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(47,146,330 - 47,147,447)	(47,312,873 - 47,313,978)
sequence	gaattccaaatgtcacacagtcgcagaaacgatctgctgctgggaaaaat cacgcccctgctagagcaggaggcacagcatagtcagctgccgtggacca cctgaagcaacagcctcatctctcacacctgggattacgatgaaaacagg ttcctataacatttctgtgtctttcaaaggaaccaaccaaaatgccaaaa ttgtcactgcaaaggtgggtgtttatcggtcctcagctgtcttccttcat tttatacaacccagattgccctgcccagggagtgactccacccacactta agatgggtgcctacatcagggaacttaagatcatcccccagaggcaaggt cctgtagaggcctagttcctgggtggggtagactgagtcatgttggtgat aaacaccagccattgcagatggggagactagtcctagtgtaaagagccac actgctgttgacctgaagcctgactgaccctagagctgagtgaaacactc ccatctccaccgtgccacctgagctcctaggacctccgtgaccccatcct tgggcctcacaccctagaactgtcctcctgggttcctgttcagggtgtct gttctctcttgcaaggacacagggagcaggcttggcagggataaggacac ctgcttgctctgaatctctgataggaatagattttggcttgggagcttca gaactaaacccacacccacagtctcatacaaggctggcttcctgaggtgt gtgccgctgtgtttaacactttattcccttcatatgattacaaaaaaata agccaattctaacatttcataatttcattaagttgcataatctttgattt gcttaattttagtgcgtgtttttatttacttccaattttttttaaataac aaagtaaaaaataataagagcaaaaaacgtaagctcattgtcaaaattta gaaactacaaaacatattatcagagccactcactctgtgtcagagacagc acactggagcatccctctagcttctgtcactttcatttcctgcctcattt gttttggtgcatgtggaggagcacagctaagcattccacttatgtgtgtg	gaattccataccaagagtgaccattcatactggtcctttaggccactgtg ctgagtagttttgtgtcaacctgacagttaaagtcatctgagagaaggga acctcaatcaagaaaattcttccatgagaccagacaaattcttaaggcat tgacaaaacagccaggaaggttctagaatatgtggaaagatgcccaacac aattactcactaggcaaactgagaaaccacagtgagctagcacctcacag ccatcaggactgagccagtgtaaccacaagtgctggcgaagatgactgtg agtaccttcaacattactggattgtacacttgaagtaggtgcatgttata atatctgaactgtatccattttaaagaagatgggaggctccatccggccc tctatcaaacaaatagactgacatgtcacccaatgtgctaccctgagccc aaaggcagaggcagcaggaatgagacatcattcagtactaacctgcaccc agaatggcaggaggtcctggtggcccagggggtcctggtggtccaggaac accaggtctcccaaagccaggtggcccaggcaggcctggaattcctgggg gtccctgaggccccacaacagcctctcctttctgtccctgttgaggcaag cacatagttatggagaaatctctcctcttagcatgtttgtgaaaatctag taatgccaggtggtgtcagttccagcaagcatcagcccaggtttggagtc caaagataccagcaagcctaggcatccagagggccctggagatttagagt ggccttctcactccacacaaggaggaactgagtcctcagaatggagaggg cttgcctcaagccaagttaggttagaaaagtggggcaaccttgatcttct ctcatggctgcctgaccctcctcccatctataaagaccagacctgtagaa taatctttacaggcttagccttcagtcaaacatcaggagaatcaagaatc ctctaaagacattaccagaactttcccttcatcctctagataccccctca ctattgacagctctggtacagagtgacatggccacagtatgttatggcct ggtgc
quality values	Open. Hide. 47 31 33 33 62 62 38 15 49 62 54 47 47 38 42 62 42 62 47 62 62 62 62 62 47 62 62 62 51 59 51 38 28 38 46 46 56 59 62 62 62 62 62 62 59 62 62 62 62 59 62 62 59 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 59 59 62 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 56 56 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 62 47 62 62 62 54 47 62 62 62 62 43 62 52 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 52 46 52 54 43 54 52 41 42 54 52 52 54 54 48 58 58 54 58 54 58 58 54 54 39 54 54 54 58 54 54 54 45 40 41 41 54 52 54 52 54 54 54 58 54 46 44 52 54 52 54 54 54 54 41 41 51 58 46 58 58 50 58 58 49 50 50 49 48 48 49 54 58 58 53 58 50 58 51 58 48 42 52 50 38 58 58 53 58 53 52 58 58 49 49 46 58 51 53 53 53 51 58 50 50 53 53 58 39 41 53 53 52 41 58 54 32 40 43 50 34 58 44 50 49 51 41 42 50 30 58 49 32 39 50 58 30 58 49 28 37 37 43 41 58 58 54 49 49 40 58 43 51 49 51 49 52 45 52 52 54 51 51 31 51 31 42 38 47 38 45 42 39 29 54 54 53 51 42 34 54 49 39 54 51 54 32 39 32 44 39 42 33 49 46 38 45 42 49 40 42 26 42 40 44 40 46 35 44 40 47 40 53 34 47 39 40 43 53 32 47 32 52 31 52 32 52 52 47 32 34 35 32 53 47 45 53 14 53 32 51 28 52 47 47 30 46 40 52 53 34 42 51 46 51 42 31 45 30 30 32 51 47 31 36 24 40 31 45 29 32 16 31 34 31 43 31 32 51 32 45 30 45 24 51 47 47 48 48 43 34 25 32 37 43 31 31 31 26 43 37 31 31 35 36 31 25 47 27 38 32 38 38 43 26 47 27 31 34 33 31 32 31 36 41 38 36 30 31 31 28 33 22 29 33 47 36 32 41 24 48 32 27 31 31 31 25 33 31 48 48 31 38 31 32 32 32 32 31 44 24 44 48 48 35 38 26 47 21 25 31 17 34 18 33 19 30 18 44 44 48 44 48 48 30 34 48 31 29 21 13 35 27 47 48 23 19 32 48 44 43 43 21 21 17 16 29 22 21 27 33 19 29 37 32 48 39 43 31 21 22 23 16 22 26 33 33 31 20 17 16 26 17 15 30 43 48 28 10 47 34 32 27 30 48 25 19 30 24 11 9 17 32 14 8 11 21 23 22 21 25 28 15 21 6 8 6 3 6 12 18 28 19 20 21 13 19 9 15 13 8 8 27 14 24 30 13 26 15 14 20 27 21 25 4 14 22 11 19 4 7 28 11 11 3 32 6 6 9 13 23 6 3 3 4 21 9 9 3 3 7 6 9 29 17 10 10 24 29 22 6 12 8 23 9 6 24 7 6 22 30 19 20 18 17 28 15 10 14 24 11 14 15 25 8 2 5 4 9 3 4 15 4 15 5 3 2 5 12 12 12 16 5 7 8 9 9 18 10 15 6 17 9 4 1 2 3 6 9 9 7 4	Open. Hide. 62 38 39 47 62 62 47 41 56 50 38 39 24 21 21 28 34 62 62 59 44 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 59 62 54 33 54 54 54 62 59 46 59 59 50 56 59 62 62 62 62 62 62 62 62 62 62 54 49 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 35 35 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 45 58 58 54 42 58 58 54 58 54 58 58 58 54 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 47 54 58 54 54 58 58 54 58 51 58 54 42 58 54 58 58 58 58 58 58 58 54 46 58 58 52 41 58 58 58 58 50 58 58 58 58 45 49 58 51 46 51 41 40 50 58 58 48 50 53 49 58 50 53 58 51 58 58 53 58 54 50 51 58 50 50 58 52 50 58 46 58 46 24 58 37 51 33 58 49 52 49 58 40 49 48 58 44 49 42 40 54 43 50 47 58 58 58 58 58 50 37 58 48 54 58 46 24 58 50 54 39 58 43 50 52 58 44 49 50 51 54 58 53 54 36 50 42 58 58 52 51 51 39 35 50 42 41 53 53 54 50 47 35 49 27 49 38 40 52 30 41 45 54 52 41 37 41 40 40 54 54 51 35 52 54 38 42 52 51 51 50 49 44 46 42 53 37 49 29 41 32 41 54 34 54 54 51 39 38 51 54 54 46 53 53 45 53 37 31 45 33 27 49 37 41 37 47 54 37 53 51 36 49 40 34 38 32 35 33 33 53 32 39 41 37 53 52 38 32 53 45 40 39 45 47 32 32 33 52 32 52 26 34 39 41 21 32 31 45 21 49 47 32 33 27 30 25 32 34 31 41 32 35 31 31 41 52 41 17 41 29 32 45 52 25 19 25 51 14 40 25 20 41 32 31 31 31 32 22 19 13 47 27 28 21 51 31 23 31 45 31 45 42 30 30 31 32 34 31 42 29 26 17 27 27 30 20 31 15 46 39 24 26 41 32 26 31 31 32 15 34 33 34 31 23 20 28 37 18 14 13 30 42 18 42 28 46 41 28 32 24 31 16 31 31 31 32 13 25 32 31 19 29 37 29 23 22 28 21 27 29 36 31 35 46 46 31 22 31 43 48 44 41 15 32 11 12 30 21 18 29 26 30 29 31 38 29 31 28 26 30 26 32 41 31 22 34 33 26 31 31 32 29 11 48 33 31 27 24 33 23 41 14 9 28 25 25 31 31 38 48 24 21 24 11 22 26 22 38 16 25 29 30 10 14 8 10 14 20 16 25 31 32 23 36 24 15 15 22 33 33 19 24 16 10 6 19 21 12 25 11 14 13 32 34 32 39 16 13 7 19 7 5 7 6 15 7 18 14 22 21 18 29 14 32 27 32 15 13 9 4 11 16 39 19 17 29 15 14 21 23 28 13 15 12 16 20 15 18 20 29 22 13 38 26 15 15 15 15 17 18 22 16 10 14 25 7 24 9 8 4 25 28 33 13 14 13 11 12 16 24 24 27 22 11 15 22 10 20 17 15 12 15 5 3 3 12 6 5 22 6 5 5 7 4 1 3 6 8 22 13 10 20 19 12 4 12 20 10 5 5 8 13 25 25 5 7 11 15 16 3 3 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr4_47146330_47147447
seq2: B6Ng01-350I21.b_47_1146

seq1  GAATTCCAAATGTCACACAGTCGCAGAAACGATCTGCTGCTGGGAAAAAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAAATGTCACACAGTCGCAGAAACGATCTGCTGCTGGGAAAAAT  50

seq1  CACGCCCCTGCTAGAGCAGGAGGCACAGCATAGTCAGCTGCCGTGGACCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACGCCCCTGCTAGAGCAGGAGGCACAGCATAGTCAGCTGCCGTGGACCA  100

seq1  CCTGAAGCAACAGCCTCATCTCTCACACCTGGGATTACGATGAAAACAGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGAAGCAACAGCCTCATCTCTCACACCTGGGATTACGATGAAAACAGG  150

seq1  TTCCTATAACATTTCTGTGTCTTTCAAAGGAACCAACCAAAATGCCAAAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTATAACATTTCTGTGTCTTTCAAAGGAACCAACCAAAATGCCAAAA  200

seq1  TTGTCACTGCAAAGGTGGGTGTTTATCGGTCCTCAGCTGTCTTCCTTCAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTCACTGCAAAGGTGGGTGTTTATCGGTCCTCAGCTGTCTTCCTTCAT  250

seq1  TTTATACAACCCAGATTGCCCTGCCCAGGGAGTGACTCCACCCACACTTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATACAACCCAGATTGCCCTGCCCAGGGAGTGACTCCACCCACACTTA  300

seq1  AGATGGGTGCCTACATCAGGGAACTTAAGATCATCCCCCAGAGGCAAGGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATGGGTGCCTACATCAGGGAACTTAAGATCATCCCCCAGAGGCAAGGT  350

seq1  CCTGTAGAGGCCTAGTTCCTGGGTGGGGTAGACTGAGTCATGTTGGTGAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTAGAGGCCTAGTTCCTGGGTGGGGTAGACTGAGTCATGTTGGTGAT  400

seq1  AAACACCAGCCATTGCAGATGGGGAGACTAGTCCTAGTGTAAAGAGCCAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACACCAGCCATTGCAGATGGGGAGACTAGTCCTAGTGTAAAGAGCCAC  450

seq1  ACTGCTGTTGACCTGAAGCCTGACTGACCCTAGAGCTGAGTGAAACACTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGCTGTTGACCTGAAGCCTGACTGACCCTAGAGCTGAGTGAAACACTC  500

seq1  CCATCTCCACCGTGCCACCTGAGCTCCTAGGACCTCCGTGACCCCATCCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATCTCCACCGTGCCACCTGAGCTCCTAGGACCTCCGTGACCCCATCCT  550

seq1  TGGGCCTCACACCCTAGAACTGTCCTCCTGGGTTCCTGTTCAGGGTGTCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCCTCACACCCTAGAACTGTCCTCCTGGGTTCCTGTTCAGGGTGTCT  600

seq1  GTTCTCTCTTGCAAGGACACAGGGAGCAGGCTTGGCAGGGATAAGGACAC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTCTCTTGCAAGGACACAGGGAGCAGGCTTGGCAGGGATAAGGACAC  650

seq1  CTGCTTGCTCTGAATCTCTGATAGGAATAGATTTTGGCTTGGGAGCTTCA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTTGCTCTGAATCTCTGATAGGAATAGATTTTGGCTTGGGAGCTTCA  700

seq1  GAACTAAACCCACACCCACAGTCTCATACAAGGCTGGCTTCCTGAGGTGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTAAACCCACACCCACAGTCTCATACAAGGCTGGCTTCCTGAGGTGT  750

seq1  GTGCCGCTGTGTTTAACACTTTATTCCCTTCATATGATTACAAAAAAATA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCCGCTGTGTTTAACACTTTATTCCCTTCATATGATTACAAAAAAATA  800

seq1  AGCCAATTCTAACATTTCATAATTTCATTAAGTTGCATAATCTTTGATTT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCAATTCTAACATTTCATAATTTCATTAAGTTGCATAATCTTTGATTT  850

seq1  GCTTAATTTTAGTGCGTGTTTTTATTTACTTCCAA-TTTTTTTAAATAAC  899
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  GCTTAATTTTAGTGCGTGTTTTTATTTACTTCCAATTTTTTTTAAATAAC  900

seq1  AAAGTAAAAAATAATAAGAGCAAAAAACGTAAGCTCATTGTCAAAAATTT  949
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  AAAGTAAAAAATAATAAGAGCAAAAAACGTAAGCTCATTGTC-AAAATTT  949

seq1  AGAAACTACAAAAACATATTATCAAGAAGCCACTCACTCTGTGTCCAGAG  999
      ||||||||| ||||||||||||||   ||||||||||||||||| |||||
seq2  AGAAACTAC-AAAACATATTATCA--GAGCCACTCACTCTGTGT-CAGAG  995

seq1  ACAGCACCACTGGAGCATTCCCTCTAGCCTTCTGTTCACTTTCATTTTCT  1049
      |||||| |||||||||| ||||||||| |||||| |||||||||||| ||
seq2  ACAGCA-CACTGGAGCA-TCCCTCTAG-CTTCTG-TCACTTTCATTTCCT  1041

seq1  GCTTCATTTTGTTTTTGTTGCATTGTTGAAGGAGCCACCAAGCTAAAGCC  1099
      || ||||||   ||||| |||||   || ||||| |||  ||||||   |
seq2  GCCTCATTT--GTTTTGGTGCAT--GTGGAGGAG-CAC--AGCTAA--GC  1082

seq1  ATTCCACTTAGTGTGTGTG  1118
      |||||||||| ||||||||
seq2  ATTCCACTTA-TGTGTGTG  1100

seq1: chr4_47312873_47313978
seq2: B6Ng01-350I21.g_67_1171 (reverse)

seq1  GCACCA-GCCAT-ACATACTGTGGCAAGGTCACTCTGTAACCAGAGCTGT  48
      |||||| ||||| |||||||||||| | |||||||||| |||||||||||
seq2  GCACCAGGCCATAACATACTGTGGCCATGTCACTCTGT-ACCAGAGCTGT  49

seq1  CAATAGTGAGGGGTTATCTTAGAGGATGAAGGGAAAGTTCTGGTAATGTC  98
      ||||||||||||| |||| |||||||||||||||||||||||||||||||
seq2  CAATAGTGAGGGGGTATC-TAGAGGATGAAGGGAAAGTTCTGGTAATGTC  98

seq1  TTTAGAAGGATTCTTGATTCTTCTGATGTTTGACTGAAGGCTAAGCCTGT  148
      ||||| ||||||||||||||| ||||||||||||||||||||||||||||
seq2  TTTAG-AGGATTCTTGATTCTCCTGATGTTTGACTGAAGGCTAAGCCTGT  147

seq1  AAAGATTA-TCTACAGGTCTGGTCTTTATAGATGGGAGGAGGGTCAGGCA  197
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  AAAGATTATTCTACAGGTCTGGTCTTTATAGATGGGAGGAGGGTCAGGCA  197

seq1  GCCATGAGAGAAGATCAAGGTTTGCCCCACTTTTCTAACCTAACTTGGCT  247
      |||||||||||||||||||| |||||||||||||||||||||||||||||
seq2  GCCATGAGAGAAGATCAAGG-TTGCCCCACTTTTCTAACCTAACTTGGCT  246

seq1  TGAGGCAAGCCCTCTCCATTCTGAGGACTCAGTTCCTCCTTGTGTGGAGT  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGCAAGCCCTCTCCATTCTGAGGACTCAGTTCCTCCTTGTGTGGAGT  296

seq1  GAGAAGGCCACTCTAAATCTCCAGGGCCCTCTGGATGCCTAGGCTTGCTG  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAAGGCCACTCTAAATCTCCAGGGCCCTCTGGATGCCTAGGCTTGCTG  346

seq1  GTATCTTTGGACTCCAAACCTGGGCTGATGCTTGCTGGAACTGACACCAC  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATCTTTGGACTCCAAACCTGGGCTGATGCTTGCTGGAACTGACACCAC  396

seq1  CTGGCATTACTAGATTTTCACAAACATGCTAAGAGGAGAGATTTCTCCAT  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCATTACTAGATTTTCACAAACATGCTAAGAGGAGAGATTTCTCCAT  446

seq1  AACTATGTGCTTGCCTCAACAGGGACAGAAAGGAGAGGCTGTTGTGGGGC  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTATGTGCTTGCCTCAACAGGGACAGAAAGGAGAGGCTGTTGTGGGGC  496

seq1  CTCAGGGACCCCCAGGAATTCCAGGCCTGCCTGGGCCACCTGGCTTTGGG  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGGGACCCCCAGGAATTCCAGGCCTGCCTGGGCCACCTGGCTTTGGG  546

seq1  AGACCTGGTGTTCCTGGACCACCAGGACCCCCTGGGCCACCAGGACCTCC  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCTGGTGTTCCTGGACCACCAGGACCCCCTGGGCCACCAGGACCTCC  596

seq1  TGCCATTCTGGGTGCAGGTTAGTACTGAATGATGTCTCATTCCTGCTGCC  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCATTCTGGGTGCAGGTTAGTACTGAATGATGTCTCATTCCTGCTGCC  646

seq1  TCTGCCTTTGGGCTCAGGGTAGCACATTGGGTGACATGTCAGTCTATTTG  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGCCTTTGGGCTCAGGGTAGCACATTGGGTGACATGTCAGTCTATTTG  696

seq1  TTTGATAGAGGGCCGGATGGAGCCTCCCATCTTCTTTAAAATGGATACAG  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGATAGAGGGCCGGATGGAGCCTCCCATCTTCTTTAAAATGGATACAG  746

seq1  TTCAGATATTATAACATGCACCTACTTCAAGTGTACAATCCAGTAATGTT  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGATATTATAACATGCACCTACTTCAAGTGTACAATCCAGTAATGTT  796

seq1  GAAGGTACTCACAGTCATCTTCGCCAGCACTTGTGGTTACACTGGCTCAG  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGTACTCACAGTCATCTTCGCCAGCACTTGTGGTTACACTGGCTCAG  846

seq1  TCCTGATGGCTGTGAGGTGCTAGCTCACTGTGGTTTCTCAGTTTGCCTAG  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGATGGCTGTGAGGTGCTAGCTCACTGTGGTTTCTCAGTTTGCCTAG  896

seq1  TGAGTAATTGTGTTGGGCATCTTTCCACATATTCTAGAACCTTCCTGGCT  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGTAATTGTGTTGGGCATCTTTCCACATATTCTAGAACCTTCCTGGCT  946

seq1  GTTTTGTCAATGCCTTAAGAATTTGTCTGGTCTCATGGAAGAATTTTCTT  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTGTCAATGCCTTAAGAATTTGTCTGGTCTCATGGAAGAATTTTCTT  996

seq1  GATTGAGGTTCCCTTCTCTCAGATGACTTTAACTGTCAGGTTGACACAAA  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTGAGGTTCCCTTCTCTCAGATGACTTTAACTGTCAGGTTGACACAAA  1046

seq1  ACTACTCAGCACAGTGGCCTAAAGGACCAGTATGAATGGTCACTCTTGGT  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTACTCAGCACAGTGGCCTAAAGGACCAGTATGAATGGTCACTCTTGGT  1096

seq1  ATGGAATTC  1106
      |||||||||
seq2  ATGGAATTC  1105

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information