MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-048G22
Chromosome	4 (Build37)
Map Location	101,985,484 - 101,986,029
singlet/doublet	singlet
Overlap gene	Pde4b
Upstream gene	E130102H24Rik, Ak3l1, LOC669460, Dnajc6, Leprot, Lepr, B020004J07Rik, LOC665362, C130073F10Rik, LOC384033, LOC381535, LOC332923, LOC100039834, LOC381536, LOC433739
Downstream gene	Sgip1, Tctex1d1, Insl5, Wdr78, Mier1, Slc35d1, 4921539E11Rik, 4930456L15Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	E130102H24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77866 MGI:1925116
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs

name	Ak3l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11639 MGI:87979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669460 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669460
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Dnajc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72685 MGI:1919935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Leprot (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230514 MGI:2687005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lepr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16847 MGI:104993
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	B020004J07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545662 MGI:3588238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665362 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665362
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 34 ESTs, 11 Proteins pseudo : _no_value

name	C130073F10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242574 MGI:3045359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs, 1 Protein

name	LOC384033 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	LOC381535 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:381535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 43 Proteins

name	LOC332923 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:332923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 36 Proteins

name	LOC100039834 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039834
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC381536 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:381536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs

name	LOC433739 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 195 ESTs, 14 Proteins pseudo : _no_value

name	Pde4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18578 MGI:99557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sgip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73094 MGI:1920344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tctex1d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67344 MGI:1914594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Insl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23919 MGI:1346085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr78 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242584 MGI:2385328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mier1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71148 MGI:1918398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Slc35d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242585 MGI:2140361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921539E11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70941 MGI:1918191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 7 ESTs, 2 Proteins

name	4930456L15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71650 MGI:1918900
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	E130102H24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252800 GeneID:77866 MGI:1925116
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs product : RIKEN cDNA E130102H24 gene transcript_id : XM_001472210.1

name	Ak3l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364376 GeneID:11639 MGI:87979
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenylate kinase 3 alpha-like 1 transcript_id : NM_009647.3

name	LOC669460 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252802 GeneID:669460
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical LOC669460 transcript_id : XM_001472355.1

name	Dnajc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38259193 GeneID:72685 MGI:1919935
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 6 transcript_id : NM_198412.1

name	Leprot (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367936 GeneID:230514 MGI:2687005
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leptin receptor overlapping transcript transcript_id : NM_175036.3

name	Lepr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8567369 GeneID:16847 MGI:104993
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leptin receptor transcript_id : NM_010704.1

name	Lepr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28077100 GeneID:16847 MGI:104993
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leptin receptor transcript_id : NM_146146.1

name	B020004J07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356022 GeneID:545662 MGI:3588238
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B020004J07 gene transcript_id : NM_001033790.2

name	LOC381535 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252817 GeneID:381535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 43 Proteins product : novel protein similar to Prame proteins transcript_id : XM_355503.6

name	LOC332923 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252805 GeneID:332923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 36 Proteins product : novel protein similar to Prame proteins transcript_id : XM_285828.6

name	LOC100039834 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252818 GeneID:100039834
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : hypothetical protein LOC100039834 transcript_id : XM_001473634.1

name	LOC381536 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372159 GeneID:381536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs product : novel protein similar to Prame proteins transcript_id : XM_355504.4

name	Pde4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181197 GeneID:18578 MGI:99557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 4B, cAMP specific transcript_id : NM_019840.2

name	Sgip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21536263 GeneID:73094 MGI:1920344
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3-domain GRB2-like (endophilin) interacting protein 1 transcript_id : NM_144906.1

name	Tctex1d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371576 GeneID:67344 MGI:1914594
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tctex1 domain containing 1 transcript_id : NM_026100.2

name	Insl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803022 GeneID:23919 MGI:1346085
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like 5 transcript_id : NM_011831.2

name	Wdr78 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922612 GeneID:242584 MGI:2385328
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 78 transcript_id : NM_146254.2

name	Mier1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872226 GeneID:71148 MGI:1918398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mesoderm induction early response 1 homolog (Xenopus laevis transcript_id : NM_027696.2

name	Mier1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872224 GeneID:71148 MGI:1918398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mesoderm induction early response 1 homolog (Xenopus laevis transcript_id : NM_001039081.1

name	Slc35d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387362 GeneID:242585 MGI:2140361
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1 transcript_id : NM_177732.3

name	4921539E11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252807 GeneID:70941 MGI:1918191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : RIKEN cDNA 4921539E11 gene transcript_id : XM_001473197.1

name	4921539E11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372182 GeneID:70941 MGI:1918191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 2 Proteins product : RIKEN cDNA 4921539E11 gene, transcript variant 1 transcript_id : XM_131605.5

name	4921539E11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372183 GeneID:70941 MGI:1918191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA 4921539E11 gene, transcript variant 2 transcript_id : XM_896041.2

name	E130102H24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252801 GeneID:77866 MGI:1925116
definition	codon_start : 1 product : hypothetical protein LOC77866 protein_id : XP_001472260.1

name	Ak3l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753022 CCDS:CCDS18394.1 GeneID:11639 MGI:87979
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004017 - adenylate kinase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0019201 - nucleotide kinase activity [Evidence IEA]; GO:0016776 - phosphotransferase activity, phosphate group as acceptor [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence IEA] codon_start : 1 product : adenylate kinase 4 protein_id : NP_033777.1

name	LOC669460 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252803 GeneID:669460
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472405.1

name	Dnajc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38259194 CCDS:CCDS18395.1 GeneID:72685 MGI:1919935
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : auxilin; DnaJ (Hsp40) homolog, subfamily B, member 6 product : DnaJ (Hsp40) homolog, subfamily C, member 6 protein_id : NP_940804.1

name	Leprot (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077089 CCDS:CCDS18396.1 GeneID:230514 MGI:2687005
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : leptin receptor gene-related protein product : leptin receptor overlapping transcript protein_id : NP_778201.1

name	Lepr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077101 GeneID:16847 MGI:104993
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence TAS] GO_process : GO:0019222 - regulation of metabolism [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1; OB receptor; leptin receptor gene-related protein product : leptin receptor isoform 1 protein_id : NP_666258.1

name	Lepr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567370 CCDS:CCDS18397.1 GeneID:16847 MGI:104993
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence TAS] GO_process : GO:0019222 - regulation of metabolism [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; OB receptor; leptin receptor gene-related protein product : leptin receptor isoform 2 protein_id : NP_034834.1

name	B020004J07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702111 GeneID:545662 MGI:3588238
definition	codon_start : 1 note : novel protein similar to Prame proteins product : hypothetical protein LOC545662 protein_id : NP_001028962.1

name	LOC381535 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82894393 GeneID:381535
definition	codon_start : 1 product : hypothetical protein protein_id : XP_355503.3

name	LOC332923 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:38078613 GeneID:332923
definition	codon_start : 1 product : hypothetical protein protein_id : XP_285828.2

name	LOC100039834 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252819 GeneID:100039834
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473684.1

name	LOC381536 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51709355 GeneID:381536
definition	codon_start : 1 product : hypothetical protein protein_id : XP_355504.2

name	Pde4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181198 CCDS:CCDS18403.1 GeneID:18578 MGI:99557
definition	GO_function : GO:0004115 - 3',5'-cyclic-AMP phosphodiesterase activity [Evidence ISS]; GO:0004114 - 3',5'-cyclic-nucleotide phosphodiesterase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA]; GO:0006939 - smooth muscle contraction [Evidence IMP] codon_start : 1 note : T-cell receptor beta chain Vb2-Jb1.4 product : phosphodiesterase 4B, cAMP specific protein_id : NP_062814.2

name	Sgip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536264 CCDS:CCDS18404.1 GeneID:73094 MGI:1920344
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0008907 - integrase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0015074 - DNA integration [Evidence IEA] codon_start : 1 product : SH3-domain GRB2-like (endophilin) interacting protein 1 protein_id : NP_659155.1

name	Tctex1d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385604 CCDS:CCDS18405.1 GeneID:67344 MGI:1914594
definition	codon_start : 1 product : Tctex1 domain containing 1 protein_id : NP_080376.1

name	Insl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754358 CCDS:CCDS18406.1 GeneID:23919 MGI:1346085
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] GO_process : GO:0007582 - physiological process [Evidence IEA] codon_start : 1 note : relaxin/insulin-like factor 2 product : insulin-like 5 protein_id : NP_035961.1

name	Wdr78 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922613 GeneID:242584 MGI:2385328
definition	codon_start : 1 product : WD repeat domain 78 protein_id : NP_666366.2

name	Mier1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872227 CCDS:CCDS18408.1 GeneID:71148 MGI:1918398
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : mesoderm induction early response 1 isoform a protein_id : NP_081972.2

name	Mier1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872225 GeneID:71148 MGI:1918398
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : mesoderm induction early response 1 isoform b protein_id : NP_001034170.1

name	Slc35d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244214 CCDS:CCDS18409.1 GeneID:242585 MGI:2140361
definition	codon_start : 1 product : solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1 protein_id : NP_808400.1

name	4921539E11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20840671 GeneID:70941 MGI:1918191
definition	codon_start : 1 product : hypothetical protein LOC70941 isoform 1 protein_id : XP_131605.1

name	4921539E11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252808 GeneID:70941 MGI:1918191
definition	codon_start : 1 product : hypothetical protein LOC70941 protein_id : XP_001473247.1

name	4921539E11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82894321 GeneID:70941 MGI:1918191
definition	codon_start : 1 product : hypothetical protein LOC70941 isoform 2 protein_id : XP_901134.1

name	LOC384033 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384033
definition	number : 3 pseudo : _no_value

name	LOC384033 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384033
definition	number : 2 pseudo : _no_value

name	LOC384033 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384033
definition	number : 1 pseudo : _no_value

name	LOC665362 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252804 GeneID:665362
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 34 ESTs, 11 Proteins product : similar to growth factor receptor bound protein 2 pseudo : _no_value transcript_id : XR_030790.1

name	C130073F10Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149252816 GeneID:242574 MGI:3045359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs, 1 Protein product : RIKEN cDNA C130073F10 gene transcript_id : XR_035215.1

name	LOC433739 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252806 GeneID:433739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 195 ESTs, 14 Proteins product : similar to RNA binding motif protein 10 pseudo : _no_value transcript_id : XR_030819.1

name	4930456L15Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94372160 GeneID:71650 MGI:1918900
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930456L15 gene transcript_id : XR_002342.1

clone name	MSMg01-485L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383N18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-501K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350L22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-175K04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-129P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449A11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-299F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088J02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-499H21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-290A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406H14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-382E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338N15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-048G22.T7 (MSMg01no048_g22.b1)	MSMg01-048G22.TJ (MSMg01no048_g22.g1)
ACC	AG278202	AG278203
length	1,211	1,283
length of high quality (start - end)	682 (39 - 720)	192 (67 - 258)
definition	CHROMAT_FILE: MSMg01no048_g22.b1 PHD_FILE: MSMg01no048_g22.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 12:09:22 2005	CHROMAT_FILE: MSMg01no048_g22.g1 PHD_FILE: MSMg01no048_g22.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 12:09:23 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	NACTTTTTAGNNNNCCATTGGGCGCTAAGACTCCTATGGGAGAGGATCCG CGGAATTCTCTACACGCCAAACTGTCTCTCTCAGTGTTTTTCAAACTAGT GAGCTCTCTAAGATTTTATGGGATGGCCTGACACTCAGGTAAGCATATTA GCTTCTACAGAGTCTGTGATTAGCTCAGTGAATTTCATCTGTGGTGTAGA GAAGTGCATTTTATTTTTTAGAAAAAAAATCTTGATTATCTCCTTTTTAT TTTAATGAAAATTTTATAGTGTTTAGATTTGTGAACTTGGACAAAATGAT CCCTCTTCTATGGGTCAGGGCATAGAATATTAACAATTACCAAATAAAAA TGCCCAAATATTTAACATTTTGTAAAACTAGACAAAAAAAAAAAAAAAAA AAAAACAGCAACCTCCTGCCTCAGCTTCTGTACATATAAAGACCCATTTG GGGAAATGAATGCACCTTGTGTGCCTGTCTCAAACTGGAGCTAATTAGGA ACTTCTCTCTGAGGCAGAGGCTCATAAGCAGCAAAGGCTATTGCCACACT CTCCCTTTTTGCTAAGACCCAGGTCATGCTTTCTGTTCATGTATCAGCTT GGGGAAAATAGTAAGACTCAGATGATAGGAGGTAATACTAGTTTGCACCA GTTCCACACAACATCATAGTGCTTTTCAGCTAAGCCTTGTAAGAAAAGAA AAAAAAAAAAAAAGAACTTANTTCGGGNAAAAAGGTAGAAAACTATGACC CAACTCTCTCCACCTATATCTATCTTTCATGTGGTTTGTCTTTCTGTCTG TCTACAGCCTATTCAACAGGAAACTATATGGGTGCTGAGATTTGAACCTG GGTCTTTTGGAAGATCAGCCAGTGCTCTTATTTGCTGAGCCACTTCTCCA GCCCCAAACTAGAACCGTTTAATATGCTCTTTTTAAAGATTTATTTTAAA GCTGGAGAGATGGCTTCGTTTTTAAAAAATTTTTTATTTTGGATAGAATT TGGGTTCCGGGTCCAATATCTCCCTATGTTTTACAAAAATTTTCAATTCC TTTTTTTAAGAACTTTAGACCCTTTTTTTATTTTTTTTATACATGTTTGT TGTTTTTTTCCTTTTTCCTTTTTATTAAATCTTTTTGAGGTTATTTTCTT TTTTTCTTTTTTTTATTCTTGGTATTTTTTCTTTCTTTATGTTGTTTTAT ATTCTCTTCTC	AAGGGAAGAAGTGGNCTGGGGCGCCXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXCCTCTTTATTCCTGGACTAATGGAAAGGAATTAA TATTCTTTTTAAAATGTTTTTTATTATTTGCTTATATTTATTTAATATTT TATATTATTTTTATATTTTAGAGCCAGATTATGGAGAGGGTCGGAGGGAA GGGAGATGTGATTGAGGAAGAACAAAAGTTGGTTAGTACAGAGTATTGGT GGGAAAGTGTTTATTTTTTTTNGTTTTNNTNTNTTTTTTTTTGTTTTTTT TTTTTTTTTTTTTTTTCTTTTNTTTTATTTTTTTTTTTTTCTTTTTTNTT TTTATTTTTTTTTTTTTTTTTTTTTTGTGTTATTTTTATGTATTTTTTTT TTTTTGTTTTTATTTGTTTGTCTCTTTCTCTTTTTTTTTTCCCCCCCCTC TCTTTTTTCTTTTTCTTCTTTCTTTTTCTTTCTTTTTTTCTTTTTTTCTT TTCTTCTCCTTTTTTCTTTTCTTTCTTTCTTTTTTCTTTCCTTCTTTCCT CTTTTTTTTTTCTTTTTCTTTTTTCTTTTTTCTTTTTTTTATTTTTTTCT CTTTTCTTTTTATCTTTTTTTTTATCTTTTTTTCTTTTGCTTTTTCTTTC TTTTTCTTTCTTACTCTTTTTCTTTTCTCCTTTTCTCTTTCTTTTTTCTT TTTTTCTTTCTCTTTTCTTCTTTTTCTTTTCCTTTTCTTTTTTCTCTTCT TTCTTTCTTTTTTTCCTTTCTTTCTCTTTCTTTTTTTTTTTTTCTTTTCT TTTCTTCACCTTTTTTTTTCTTTTTTTCTTTTCTTTTTCTTTTCTCTTTC TTTATTTTTTTCTTTTCTCTTTTATCTTTTTTTCTTTTTCTTTCTTTTTT GTCCTTTTTCCTCTTTTTTTTCTCTCTTCTCTCTATTTTTTCTTTTTCTT TTCTCCTCTTTGTTTTCCTTTTTTTCCCTTTTTTTCCTTTTTCTTTCACT TCTTCTATTCTTTCATTTCTTTTTTCTCTTCCTTCTTTTTTTTTTCCCCC CCTTTTTTTTTTTCTTTTTCCTTTTTTCTCCTTTTTCTCTCTCTTTTCCT CTTCCTTCATATTCTTCCTCTTTTTCCTTCTTTTCTTTTTTCTTTTGCCT TCTTTTCTATTCTTTTAGTTTTTTTTTCCTTTTCTTCGTTCTCTTATTCT TTTTTTCACTCTATTCCATTTCATCTGTTATTTCTTTTTCTCTTTTCTCT TCACTCTTTTNTTATTGTATTTCTTTTCTTCTA
quality values	Open. Hide. 0 3 9 9 10 6 6 6 6 3 0 0 0 0 3 6 6 8 6 7 8 8 8 8 8 8 8 8 8 15 19 9 8 8 8 8 8 8 21 19 29 34 34 32 32 37 37 40 50 48 50 51 50 50 42 42 50 43 42 42 36 18 17 14 33 32 51 51 51 51 27 21 12 10 10 10 12 15 15 29 21 19 15 27 30 46 46 48 51 68 68 68 68 51 51 51 48 48 48 48 50 51 51 51 50 50 48 48 48 48 48 50 59 59 50 50 50 50 42 50 52 57 57 68 57 57 57 57 57 50 57 37 52 52 57 52 57 57 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 68 57 57 57 68 68 57 57 57 57 57 68 68 68 57 68 68 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 68 68 68 68 68 68 68 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 52 52 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 52 52 43 44 39 39 14 39 39 52 52 52 45 62 62 62 62 62 45 45 43 62 43 43 39 43 43 62 52 52 62 62 62 52 45 45 62 62 62 62 62 62 62 62 43 62 43 52 43 44 43 52 62 52 45 43 43 43 43 35 43 43 62 39 43 43 52 43 62 52 62 52 52 52 62 62 62 62 43 43 43 39 43 43 52 52 52 62 62 62 62 52 52 43 43 43 43 43 43 43 52 52 52 52 43 44 43 44 44 62 35 35 35 62 43 45 45 52 52 43 62 62 62 62 62 62 62 62 52 52 62 45 45 43 44 43 52 43 59 57 57 57 39 39 43 43 52 57 57 52 52 59 59 57 57 52 52 43 44 28 28 28 44 44 57 59 59 57 43 43 43 43 52 52 52 59 57 57 57 52 57 57 57 37 37 35 44 43 57 50 59 41 39 42 43 33 44 44 54 52 57 57 57 57 57 57 59 57 43 43 43 43 43 43 43 43 33 44 43 37 37 50 50 57 57 57 57 57 57 59 47 47 44 44 57 59 59 48 57 44 44 44 48 57 57 57 57 57 57 48 48 48 48 48 46 59 43 43 44 47 43 37 37 30 30 30 41 41 59 47 57 48 48 48 48 43 43 42 42 30 37 42 34 22 23 23 33 36 43 43 48 48 48 59 59 48 48 57 59 59 59 59 46 40 39 39 36 34 28 20 15 20 14 21 3 0 3 11 23 20 17 3 0 3 12 15 25 37 37 30 30 22 22 25 26 25 23 23 23 30 30 37 32 29 31 27 28 18 20 24 32 34 41 37 37 32 32 36 37 37 39 39 37 39 39 40 40 47 47 47 59 36 32 18 18 11 11 11 17 19 11 21 13 15 15 34 25 25 12 8 8 8 8 12 8 15 15 24 26 28 30 24 24 15 20 19 29 19 17 12 12 14 17 23 25 30 17 14 14 13 18 13 11 11 11 17 11 11 11 11 10 18 11 10 10 16 23 28 39 28 17 17 15 16 11 19 16 11 10 12 17 9 9 9 10 10 10 10 10 14 15 24 25 20 14 22 11 10 10 10 9 12 16 24 18 12 9 10 9 9 9 9 10 10 10 9 9 9 9 9 15 10 8 8 12 17 16 7 7 6 6 6 8 10 10 11 10 8 8 8 8 8 8 23 19 14 9 9 8 8 8 8 8 11 18 34 19 15 6 6 6 8 9 9 20 19 21 21 24 28 26 24 15 14 16 12 12 11 11 12 10 10 9 11 8 8 8 8 8 6 8 8 8 10 10 8 8 8 8 8 10 8 9 10 10 10 15 15 15 8 8 6 6 10 10 8 9 9 9 9 9 9 14 14 14 16 8 8 8 9 9 10 8 8 6 7 7 8 8 8 8 8 10 11 9 8 8 6 6 7 9 10 9 9 11 9 8 6 8 10 10 9 6 8 8 8 8 7 7 8 8 11 8 10 9 9 9 8 9 14 12 10 10 10 8 8 8 6 6 10 10 10 8 7 7 8 8 8 11 11 10 10 8 7 7 7 8 8 20 19 16 8 8 8 8 8 8 9 10 11 10 14 11 9 9 9 9 10 19 12 12 12 8 8 8 8 8 19 23 19 10 8 6 6 8 8 10 12 12 10 10 9 8 8 6 6 8 8 10 10 10 10 10 10 11 12 8 8 6 6 8 8 8 8 10 15 30 17 14 9 7 7 8 8 8 8 10 8 8 6 6 8 8 12 10 9 6 6 7 7 13 10 10 8 8 6 6 10 6 8 8 10 8 6 8 6 6 6 8 8 8 11 8 8 8 10 8 8 8 8 6 6 8 8 8 6	Open. Hide. 6 6 7 7 14 8 7 7 7 6 6 6 6 3 0 3 6 6 6 6 8 10 13 9 7 9 8 10 12 23 23 29 30 33 33 33 31 31 30 30 30 35 30 24 13 12 17 29 24 37 36 42 53 53 53 53 53 50 50 50 50 47 33 27 11 8 8 8 10 13 15 37 37 37 39 37 48 48 48 48 57 36 36 36 37 37 37 50 53 53 57 57 59 59 59 53 68 68 68 68 68 68 68 68 57 57 57 41 42 42 33 42 42 48 57 54 57 57 68 51 51 48 42 37 35 35 35 39 39 57 41 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 51 51 51 51 51 68 68 51 51 51 68 50 50 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 57 57 59 68 68 68 68 68 68 68 68 68 68 68 59 59 59 57 57 59 59 59 59 57 57 57 57 57 48 48 43 44 40 40 43 47 59 43 43 43 43 43 39 32 30 30 28 24 14 24 24 25 23 13 10 8 8 6 6 8 8 13 13 10 10 3 0 3 17 10 10 3 0 0 3 0 3 0 3 8 8 8 10 12 11 12 10 8 8 8 12 13 9 9 8 12 8 8 9 9 8 8 8 8 13 12 14 10 19 12 10 11 8 15 13 3 0 3 9 9 9 10 10 15 23 11 9 11 11 11 9 11 11 17 10 15 17 20 17 15 8 3 0 3 8 8 10 6 6 8 10 8 13 9 10 12 13 14 15 19 13 14 14 16 8 10 8 10 8 9 10 10 8 8 8 8 8 8 10 8 8 8 8 8 13 9 9 10 14 11 9 9 8 17 12 12 17 8 8 6 6 6 8 8 8 8 8 8 8 12 10 10 10 7 6 6 8 10 11 11 18 12 10 10 8 8 10 17 23 11 12 9 10 10 10 13 8 8 8 8 8 8 12 9 9 10 9 9 10 10 10 13 31 16 16 11 11 11 11 11 11 8 8 9 8 10 8 8 8 8 11 10 15 10 13 6 6 6 10 10 12 8 10 8 8 8 12 13 11 9 10 8 8 8 8 8 8 8 13 8 8 10 9 10 9 9 9 10 11 10 8 10 11 10 9 9 8 8 7 7 10 8 7 7 8 9 9 13 10 9 9 10 12 13 13 10 8 8 6 7 8 7 6 8 6 6 8 8 10 18 9 8 8 8 10 13 28 13 14 8 10 6 6 8 6 8 10 8 9 10 11 13 12 9 8 10 8 8 8 15 16 16 10 10 8 8 8 13 13 14 14 9 8 10 10 9 8 10 8 8 8 8 10 12 8 8 8 8 10 10 10 11 13 19 11 10 10 9 10 10 13 15 21 24 31 32 28 31 20 15 13 9 9 9 8 8 8 10 10 8 10 8 9 8 8 8 12 16 8 8 6 6 8 8 9 9 8 8 10 8 10 10 15 17 14 8 8 8 8 11 8 11 18 16 10 11 10 10 9 12 10 10 8 10 9 9 13 15 15 10 10 8 7 6 8 8 13 13 15 14 9 9 8 8 8 6 6 8 10 10 15 10 9 8 10 8 10 9 14 10 9 9 9 10 8 8 7 7 8 8 10 9 9 11 15 10 8 8 8 8 8 9 9 9 8 8 8 8 8 8 8 8 8 8 10 10 9 9 9 10 9 10 11 7 6 8 8 8 8 8 6 6 8 8 19 11 12 12 16 18 17 11 10 10 8 12 12 6 6 8 12 12 9 9 10 11 8 7 7 10 8 9 8 8 8 8 10 10 10 9 12 8 10 7 7 8 8 17 22 20 24 14 14 12 12 10 8 8 8 9 9 9 8 8 8 10 13 8 10 6 6 13 15 10 14 15 17 11 9 9 11 11 12 13 13 10 10 10 10 11 7 7 8 8 9 9 8 8 8 8 8 8 8 15 12 17 12 10 9 9 15 10 11 8 8 8 11 11 19 19 15 11 13 9 6 6 6 6 8 8 10 11 11 9 9 13 11 9 9 11 16 15 11 8 8 8 8 8 6 6 12 12 10 10 8 10 8 8 6 6 8 10 12 21 6 6 6 6 8 8 8 6 6 8 10 8 9 9 10 10 8 8 10 10 15 8 8 8 10 9 11 9 13 13 13 17 27 20 17 12 10 9 10 11 11 15 13 15 11 11 8 8 8 8 8 10 8 13 9 14 11 8 9 7 6 8 6 6 8 8 8 8 8 8 6 6 7 10 10 6 6 10 6 6 8 8 10 8 11 8 8 8 8 10 8 8 8 8 8 6 6 8 8 10 20 18 19 19 15 13 15 16 28 19 24 13 14 14 19 17 23 32 26 17 13 14 11 9 11 12 22 22 17 15 8 8 8 10 11 19 16 10 10 10 15 10 12 12 16 17 10 11 8 8 6 7 10 6 6 8 8 9 8 11 8 8 8 8 9 10 16 10 10 10 10 11 8 8 6 9 12 9 9 9 8 8 8 8 8 8 12 11 10 10 6 6 6 8 8 6 7 10 7 8 8 8 10 10 10 13 9 9 9 9 9 8 9 8 10 10 10 11 9 9 8 8 6 6 10 10 6 6 8 8 19 11 15 10 10 6 6 6 7 10 10 13 8 8 6 6 10 6 6 8 8 8 6 7 10 9 9 11 15 10 10 10 9 9 9 9 10 8 8 8 13 13 10 6 6 7 7 8 6 9 9 10 7 7 8 8 8 8 10 13 10 10 10 9 9 11 10 8 8 8 8 8 10 9 8 8 9 9 9 8 8 7 9 8 8 6 7 7 8 12 3 0 3 6 6 8 8 9 7 8 6 7 7 9 10 10 8 8 8 8 10 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no048_g22.b1 MSMg01no048_g22.b1 CHROMAT_FILE:
MSMg01no048_g22.b1 PHD_FILE: MSMg01no048_g22.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 12:09:22 2005
         (682 letters)



>mm_chr4_101985484_101986566
          Length = 1083

 Score = 1011 bits (523), Expect = 0.0
 Identities = 543/555 (97%), Gaps = 10/555 (1%)
 Strand = Plus / Minus

                                                                       
Query: 15  gaattctctac-acgccaaactgtctctctcagtgtttttcaaactagtgagctctctaa 73
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 546 gaattctctacaacgccaaactgtctctctcagtgtttttcaaactagtgagctctctaa 487

                                                                       
Query: 74  gattttatgggatggcctgacactcaggtaagcatattagcttctacagagtctgtgatt 133
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 486 gattttatgggatggcctgacactcaggtaagcatattagcttctacagagtctgtgatt 427

                                                                       
Query: 134 agctcagtgaatttcatctgtggtgtagagaagtgcattttattttttagaaaaaaaatc 193
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 426 agctcaatgaatttcatctgtggtgtagagaagtgcattttattttttagaaaaaaaatc 367

                                                                       
Query: 194 ttgattatctcctttttattttaatgaaaattttatagtgtttagatttgtgaacttgga 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 366 ttgattatctcctttttattttaatgaaaattttatagtgtttagatttgtgaacttgga 307

                                                                       
Query: 254 caaaatgatccctcttctatgggtcagggcatagaatattaacaattaccaaataaaaat 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 306 caaaatgatccctcttctatgggtcagggcatagaatattaacaattaccaaataaaaat 247

                                                                       
Query: 314 gcccaaatatttaacattttgtaaaactagacaaaaaaaaaaaaaaaaaaaaaacagcaa 373
           ||||||||||||||||||||| |||||||||||||||||||||||||         ||||
Sbjct: 246 gcccaaatatttaacattttgcaaaactagacaaaaaaaaaaaaaaa---------gcaa 196

                                                                       
Query: 374 cctcctgcctcagcttctgtacatataaagacccatttggggaaatgaatgcaccttgtg 433
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 195 cctcctgcctcagcttctgtacatataaagacccatttggggaaatgaatgcaccttgtg 136

                                                                       
Query: 434 tgcctgtctcaaactggagctaattaggaacttctctctgaggcagaggctcataagcag 493
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 135 tgcctgtctcaaactggagctaattaggaacttctctctgaggcagaggctcataagcag 76

                                                                       
Query: 494 caaaggctattgccacactctccctttttgctaagacccaggtcatgctttctgttcatg 553
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 75  caaaggctattgccacactctccctttttgctaagacccaggtcatgctttctgttcatg 16

                          
Query: 554 tatcagcttggggaa 568
           |||||||||||||||
Sbjct: 15  tatcagcttggggaa 1


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 30
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 682
Length of database: 1083
Length adjustment: 10
Effective length of query: 672
Effective length of database: 1073
Effective search space:   721056
Effective search space used:   721056
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information