MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-118J03
Chromosome	4 (Build37)
Map Location	131,811,678 - 131,811,885
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Gm831, EG664832, LOC100039799, Ptpru, Mecr, Sfrs4, EG664865, EG623230, Epb4.1, LOC666480, LOC100039835, Oprd1, LOC664894, Ythdf2, LOC664903, Gmeb1
Downstream gene	Rnu11, Taf12, 9530096D07Rik, LOC100039864, Trspap1, Rcc1, Snhg3, Phactr4, Med18, Sesn2, Atpif1, Dnajc8, Ptafr, Eya3, Xkr8, Smpdl3b, Rpa2, BC013712, LOC100039917, Ppp1r8, Stx12, OTTMUSG00000010099, BC008163, Fgr, Ahdc1, LOC100041932, Wasf2, Gpr3, Cd164l2, Fcnc-ps, Map3k6, Sytl1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gm831 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329950 MGI:2685677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG664832 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664832 MGI:3643258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100039799 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ptpru (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19273 MGI:1321151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mecr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26922 MGI:1349441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfrs4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57317 MGI:1890577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG664865 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664865 MGI:3646623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG623230 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623230 MGI:3646343
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 216 ESTs, 1 Protein

name	Epb4.1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269587 MGI:95401
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666480 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100039835 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039835
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Oprd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18386 MGI:97438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 626 ESTs, 6 Proteins

name	Ythdf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213541 MGI:2444233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664903 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 804 ESTs, 1 Protein

name	Gmeb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56809 MGI:2135604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353373 MGI:2148804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66464 MGI:1913714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9530096D07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242681 MGI:2441753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039864 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039864
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs

name	Trspap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71787 MGI:1919037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rcc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100088 MGI:1913989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snhg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399101 MGI:2684817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phactr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100169 MGI:2140327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Med18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67219 MGI:1914469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sesn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230784 MGI:2651874
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atpif1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11983 MGI:1196457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68598 MGI:1915848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptafr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19204 MGI:106066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eya3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14050 MGI:109339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Xkr8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381560 MGI:2685877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smpdl3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100340 MGI:1916022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpa2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19891 MGI:1339939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC013712 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230787 MGI:2446213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039917 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039917
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Ppp1r8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100336 MGI:2140494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stx12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100226 MGI:1931027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000010099 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100038703 MGI:3649305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein pseudo : _no_value

name	BC008163 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230789 MGI:2385211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14191 MGI:95527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ahdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230793 MGI:2444218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041932 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 276 ESTs

name	Wasf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242687 MGI:1098641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14748 MGI:101908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd164l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69655 MGI:1916905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcnc-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:493918 MGI:3510254
definition	gene_synonym : H-Fcn note : ficolin C pseudogene pseudo : _no_value

name	Map3k6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53608 MGI:1855691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sytl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269589 MGI:1933365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm831 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253158 GeneID:329950 MGI:2685677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : gene model 831, (NCBI) transcript_id : XM_001477145.1

name	LOC100039799 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253139 GeneID:100039799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039799 transcript_id : XM_001473535.1

name	Ptpru (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031954 GeneID:19273 MGI:1321151
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, U transcript_id : NM_011214.2

name	Ptpru (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031996 GeneID:19273 MGI:1321151
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, U transcript_id : NM_001083119.2

name	Mecr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13384651 GeneID:26922 MGI:1349441
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial trans-2-enoyl-CoA reductase transcript_id : NM_025297.1

name	Sfrs4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10181125 GeneID:57317 MGI:1890577
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine-rich 4 (SRp75) transcript_id : NM_020587.1

name	EG664865 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372548 GeneID:664865 MGI:3646623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG664865 transcript_id : XM_973121.1

name	EG623230 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253160 GeneID:623230 MGI:3646343
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 216 ESTs, 1 Protein product : predicted gene, EG623230 transcript_id : XM_887671.3

name	Epb4.1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38570128 GeneID:269587 MGI:95401
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : erythrocyte protein band 4.1 transcript_id : NM_183428.2

name	LOC666480 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372617 GeneID:666480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC666480 transcript_id : XM_990133.1

name	Oprd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244063 GeneID:18386 MGI:97438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : opioid receptor, delta 1 transcript_id : NM_013622.3

name	LOC664894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253161 GeneID:664894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 626 ESTs, 6 Proteins product : similar to fusion protein: ubiquitin (bases 43_513); ribosomal protein S27a (bases 217_532) transcript_id : XM_973311.2

name	Ythdf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353711 GeneID:213541 MGI:2444233
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : YTH domain family 2 transcript_id : NM_145393.3

name	LOC664903 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253141 GeneID:664903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 804 ESTs, 1 Protein product : similar to hCG1994130 transcript_id : XM_973351.2

name	Gmeb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9937989 GeneID:56809 MGI:2135604
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucocorticoid modulatory element binding protein 1 transcript_id : NM_020273.1

name	Taf12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364052 GeneID:66464 MGI:1913714
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_025579.2

name	9530096D07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126116578 GeneID:242681 MGI:2441753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9530096D07 gene transcript_id : NM_001081651.1

name	LOC100039864 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253142 GeneID:100039864
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs product : hypothetical protein LOC100039864 transcript_id : XM_001473681.1

name	Trspap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110835713 GeneID:71787 MGI:1919037
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tRNA selenocysteine associated protein 1 transcript_id : NM_027925.3

name	Rcc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129804 GeneID:100088 MGI:1913989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of chromosome condensation 1 transcript_id : NM_133878.2

name	Phactr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387565 GeneID:100169 MGI:2140327
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatase and actin regulator 4 transcript_id : NM_175306.3

name	Med18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46358371 GeneID:67219 MGI:1914469
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 18 homolog (yeast) transcript_id : NM_026039.2

name	Sesn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450288 GeneID:230784 MGI:2651874
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sestrin 2 transcript_id : NM_144907.1

name	Atpif1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982863 GeneID:11983 MGI:1196457
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase inhibitory factor 1 transcript_id : NM_007512.2

name	Dnajc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349981 GeneID:68598 MGI:1915848
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 8 transcript_id : NM_172400.2

name	Ptafr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487078 GeneID:19204 MGI:106066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : platelet-activating factor receptor transcript_id : NM_001081211.1

name	Eya3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877075 GeneID:14050 MGI:109339
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eyes absent 3 homolog (Drosophila) transcript_id : NM_210071.1

name	Eya3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877079 GeneID:14050 MGI:109339
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eyes absent 3 homolog (Drosophila) transcript_id : NM_211357.1

name	Eya3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877073 GeneID:14050 MGI:109339
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eyes absent 3 homolog (Drosophila) transcript_id : NM_010166.2

name	Xkr8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235769 GeneID:381560 MGI:2685877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X Kell blood group precursor related family member 8 homolog transcript_id : NM_201368.1

name	Smpdl3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130844 GeneID:100340 MGI:1916022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingomyelin phosphodiesterase, acid-like 3B transcript_id : NM_133888.2

name	Rpa2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625960 GeneID:19891 MGI:1339939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : replication protein A2 transcript_id : NM_011284.3

name	BC013712 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385534 GeneID:230787 MGI:2446213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC013712 transcript_id : NM_001033308.2

name	Ppp1r8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122684 GeneID:100336 MGI:2140494
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 8 transcript_id : NM_146154.1

name	Stx12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387432 GeneID:100226 MGI:1931027
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 12 transcript_id : NM_133887.3

name	BC008163 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704089 GeneID:230789 MGI:2385211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC008163 transcript_id : NM_145553.1

name	Fgr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344961 GeneID:14191 MGI:95527
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Gardner-Rasheed feline sarcoma viral (Fgr) oncogene homolog transcript_id : NM_010208.3

name	Ahdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244059 GeneID:230793 MGI:2444218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AT hook, DNA binding motif, containing 1 transcript_id : NM_146155.3

name	LOC100041932 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253162 GeneID:100041932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 276 ESTs product : hypothetical protein LOC100041932 transcript_id : XM_001477842.1

name	Wasf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367233 GeneID:242687 MGI:1098641
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAS protein family, member 2 transcript_id : NM_153423.4

name	Gpr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83627722 GeneID:14748 MGI:101908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein coupled receptor 3 transcript_id : NM_008154.2

name	Cd164l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115511039 GeneID:69655 MGI:1916905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD164 sialomucin-like 2 transcript_id : NM_027152.1

name	Map3k6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66392594 GeneID:53608 MGI:1855691
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen-activated protein kinase kinase kinase 6 transcript_id : NM_016693.3

name	Sytl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878228 GeneID:269589 MGI:1933365
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin-like 1 transcript_id : NM_031393.1

name	Gm831 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253159 GeneID:329950 MGI:2685677
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477195.1

name	LOC100039799 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253140 GeneID:100039799
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473585.1

name	Ptpru (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134031955 CCDS:CCDS18714.1 GeneID:19273 MGI:1321151
definition	GO_component : GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0007185 - transmembrane receptor protein tyrosine phosphatase signaling pathway [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; protein tyrosine phosphatase, receptor type, L product : protein tyrosine phosphatase, receptor type, U isoform 1 protein_id : NP_035344.2

name	Ptpru (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778922 GeneID:19273 MGI:1321151
definition	GO_component : GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0007185 - transmembrane receptor protein tyrosine phosphatase signaling pathway [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; protein tyrosine phosphatase, receptor type, L product : protein tyrosine phosphatase, receptor type, U isoform 2 protein_id : NP_001076588.1

name	Mecr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384652 CCDS:CCDS18715.1 GeneID:26922 MGI:1349441
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0016922 - ligand-dependent nuclear receptor binding [Evidence ISS]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0019166 - trans-2-enoyl-CoA reductase (NADPH) activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : nuclear receptor binding factor 1 product : trans-2-enoyl-CoA reductase, mitochondrial precursor protein_id : NP_079573.1

name	Sfrs4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181126 GeneID:57317 MGI:1890577
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : splicing factor, arginine/serine-rich 4 (SRp75) protein_id : NP_065612.1

name	EG664865 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94372549 GeneID:664865 MGI:3646623
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978215.1

name	EG623230 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94372551 GeneID:623230 MGI:3646343
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892764.2

name	Epb4.1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38570129 CCDS:CCDS18717.1 GeneID:269587 MGI:95401
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence ISS] [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0008092 - cytoskeletal protein binding [Evidence IEA]; GO:0030507 - spectrin binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS]; GO:0030866 - cortical actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence ISS] codon_start : 1 exception : mismatches in translation product : erythrocyte protein band 4.1 protein_id : NP_906273.2

name	LOC666480 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94372618 GeneID:666480
definition	codon_start : 1 product : hypothetical protein protein_id : XP_995227.1

name	Oprd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244064 CCDS:CCDS18718.1 GeneID:18386 MGI:97438
definition	GO_component : GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0004986 - delta-opioid receptor activity [Evidence IDA] [Evidence IMP]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0008344 - adult locomotory behavior [Evidence IMP]; GO:0007191 - dopamine receptor, adenylate cyclase activating pathway [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007193 - G-protein signaling, adenylate cyclase inhibiting pathway [Evidence IDA]; GO:0007218 - neuropeptide signaling pathway [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : opioid receptor delta 1 product : opioid receptor, delta 1 protein_id : NP_038650.3

name	LOC664894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94372553 GeneID:664894
definition	codon_start : 1 product : similar to fusion protein: ubiquitin (bases 43_513); ribosomal protein S27a (bases 217_532) protein_id : XP_978405.1

name	Ythdf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30841028 CCDS:CCDS18719.1 GeneID:213541 MGI:2444233
definition	codon_start : 1 exception : mismatches in translation product : high glucose-regulated protein 8 protein_id : NP_663368.2

name	LOC664903 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94372555 GeneID:664903
definition	codon_start : 1 product : similar to hCG1994130 protein_id : XP_978445.1

name	Gmeb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9937990 CCDS:CCDS18720.1 GeneID:56809 MGI:2135604
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glucocorticoid modulatory element binding protein 1 protein_id : NP_064669.1

name	Taf12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385026 CCDS:CCDS18721.1 GeneID:66464 MGI:1913714
definition	GO_component : GO:0005669 - transcription factor TFIID complex [Evidence ISS] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20 kDa product : TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_079855.1

name	9530096D07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126116579 GeneID:242681 MGI:2441753
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : RAB42, member RAS oncogene family product : RIKEN cDNA 9530096D07 protein_id : NP_001075120.1

name	LOC100039864 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253143 GeneID:100039864
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473731.1

name	Trspap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62821783 CCDS:CCDS18722.1 GeneID:71787 MGI:1919037
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0001514 - selenocysteine incorporation [Evidence IDA] codon_start : 1 product : tRNA selenocysteine associated protein 1 protein_id : NP_082201.2

name	Rcc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527092 CCDS:CCDS18723.1 GeneID:100088 MGI:1913989
definition	GO_process : GO:0051301 - cell division [Evidence IEA] codon_start : 1 product : chromosome condensation 1 protein_id : NP_598639.1

name	Phactr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424978 CCDS:CCDS18724.1 GeneID:100169 MGI:2140327
definition	codon_start : 1 exception : mismatches in translation product : phosphatase and actin regulator 4 protein_id : NP_780515.1

name	Med18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313064 CCDS:CCDS18725.1 GeneID:67219 MGI:1914469
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] codon_start : 1 product : mediator of RNA polymerase II transcription, subunit 18 homolog protein_id : NP_080315.1

name	Sesn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450289 CCDS:CCDS18726.1 GeneID:230784 MGI:2651874
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007050 - cell cycle arrest [Evidence IEA] codon_start : 1 product : sestrin 2 protein_id : NP_659156.1

name	Atpif1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982864 CCDS:CCDS18727.1 GeneID:11983 MGI:1196457
definition	GO_component : GO:0009986 - cell surface [Evidence ISS]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IDA] GO_function : GO:0043532 - angiostatin binding [Evidence ISS]; GO:0051117 - ATPase binding [Evidence ISS]; GO:0042030 - ATPase inhibitor activity [Evidence ISS]; GO:0005516 - calmodulin binding [Evidence ISS]; GO:0004857 - enzyme inhibitor activity [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence ISS] GO_process : GO:0001937 - negative regulation of endothelial cell proliferation [Evidence ISS]; GO:0051346 - negative regulation of hydrolase activity [Evidence ISS]; GO:0045980 - negative regulation of nucleotide metabolism [Evidence IEA]; GO:0051289 - protein homotetramerization [Evidence ISS]; GO:0009268 - response to pH [Evidence ISS] codon_start : 1 product : ATPase inhibitory factor 1 protein_id : NP_031538.2

name	Dnajc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369493 GeneID:68598 MGI:1915848
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : DnaJ (Hsp40) homolog, subfamily C, member 8 protein_id : NP_765988.1

name	Ptafr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487079 GeneID:19204 MGI:106066
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004992 - platelet activating factor receptor activity [Evidence ISS] [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019735 - antimicrobial humoral response (sensu Vertebrata) [Evidence ISS]; GO:0006935 - chemotaxis [Evidence IEA] [Evidence ISS]; GO:0001816 - cytokine production [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] [Evidence ISS]; GO:0006954 - inflammatory response [Evidence ISS] [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : PAF receptor product : platelet-activating factor receptor protein_id : NP_001074680.1

name	Eya3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877076 CCDS:CCDS18729.1 GeneID:14050 MGI:109339
definition	EC_number : 3.1.3.48 GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IDA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : eyes absent 3 homolog isoform 1 protein_id : NP_997592.1

name	Eya3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877074 CCDS:CCDS18730.1 GeneID:14050 MGI:109339
definition	EC_number : 3.1.3.48 GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IDA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : eyes absent 3 homolog isoform 2 protein_id : NP_034296.2

name	Eya3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877080 CCDS:CCDS18731.1 GeneID:14050 MGI:109339
definition	EC_number : 3.1.3.48 GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IDA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : eyes absent 3 homolog isoform 3 protein_id : NP_997596.1

name	Xkr8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235770 CCDS:CCDS18732.1 GeneID:381560 MGI:2685877
definition	codon_start : 1 product : X Kell blood group precursor related family member 8 homolog protein_id : NP_958756.1

name	Smpdl3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527104 CCDS:CCDS18733.1 GeneID:100340 MGI:1916022
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : acid sphingomyelinase-like phosphodiesterase product : sphingomyelin phosphodiesterase, acid-like 3B protein_id : NP_598649.1

name	Rpa2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625961 CCDS:CCDS18734.1 GeneID:19891 MGI:1339939
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 note : 30-kDa protein product : replication protein A2 protein_id : NP_035414.3

name	BC013712 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701808 CCDS:CCDS18735.1 GeneID:230787 MGI:2446213
definition	codon_start : 1 note : basement membrane-induced product : basement membrane-induced protein protein_id : NP_001028480.1

name	Ppp1r8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122685 CCDS:CCDS18736.1 GeneID:100336 MGI:2140494
definition	GO_component : GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008599 - protein phosphatase type 1 regulator activity [Evidence IDA] GO_process : GO:0008283 - cell proliferation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : protein phosphatase 1, regulatory (inhibitor) subunit 8 protein_id : NP_666266.1

name	Stx12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527102 CCDS:CCDS18737.1 GeneID:100226 MGI:1931027
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : syntaxin 13 product : syntaxin 12 protein_id : NP_598648.1

name	BC008163 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704090 CCDS:CCDS18738.1 GeneID:230789 MGI:2385211
definition	codon_start : 1 product : hypothetical protein LOC230789 protein_id : NP_663528.1

name	Fgr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542816 CCDS:CCDS18739.1 GeneID:14191 MGI:95527
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : proto-oncogene tyrosine-protein kinase Fgr protein_id : NP_034338.2

name	Ahdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244060 GeneID:230793 MGI:2444218
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : AT hook, DNA binding motif, containing 1 protein_id : NP_666267.3

name	LOC100041932 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253163 GeneID:100041932
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477892.1

name	Wasf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510313 CCDS:CCDS18742.1 GeneID:242687 MGI:1098641
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005769 - early endosome [Evidence IDA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005199 - structural constituent of cell wall [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IMP]; GO:0030048 - actin filament-based movement [Evidence IMP]; GO:0001667 - ameboidal cell migration [Evidence IMP]; GO:0001525 - angiogenesis [Evidence IMP]; GO:0006928 - cell motility [Evidence IMP]; GO:0006897 - endocytosis [Evidence IDA]; GO:0030032 - lamellipodium biogenesis [Evidence IMP]; GO:0016601 - Rac protein signal transduction [Evidence IMP] codon_start : 1 product : WAS protein family, member 2 protein_id : NP_700472.1

name	Gpr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680065 CCDS:CCDS18743.1 GeneID:14748 MGI:101908
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G-protein coupled receptor 3 protein_id : NP_032180.1

name	Cd164l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115511040 GeneID:69655 MGI:1916905
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : D164 sialomucin-like 2 product : CD164 sialomucin-like 2 protein_id : NP_081428.1

name	Map3k6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66392595 CCDS:CCDS18744.1 GeneID:53608 MGI:1855691
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : apoptosis signal-regulating kinase 2 product : mitogen-activated protein kinase kinase kinase 6 protein_id : NP_057902.3

name	Sytl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878229 GeneID:269589 MGI:1933365
definition	GO_component : GO:0019897 - extrinsic to plasma membrane [Evidence IDA]; GO:0042470 - melanosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA]; GO:0008021 - synaptic vesicle [Evidence IEA] GO_function : GO:0042043 - neurexin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence IPI] codon_start : 1 exception : unclassified translation discrepancy product : synaptotagmin-like 1 protein_id : NP_113570.1

name	EG664832 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664832
definition	number : 6 pseudo : _no_value

name	EG664832 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664832
definition	number : 5 pseudo : _no_value

name	EG664832 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664832
definition	number : 4 pseudo : _no_value

name	EG664832 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664832
definition	number : 3 pseudo : _no_value

name	EG664832 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664832
definition	number : 2 pseudo : _no_value

name	EG664832 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664832
definition	number : 1 pseudo : _no_value

name	LOC100039835 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039835
definition	number : 1 pseudo : _no_value

name	LOC100039917 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039917
definition	number : 2 pseudo : _no_value

name	LOC100039917 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039917
definition	number : 1 pseudo : _no_value

name	OTTMUSG00000010099 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038703
definition	number : 1 pseudo : _no_value

name	Rnu11 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872156 GeneID:353373 MGI:2148804
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : U11 small nuclear RNA transcript_id : NR_002865.1

name	Snhg3 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:118442851 GeneID:399101 MGI:2684817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA host gene (non-protein coding) 3 transcript_id : NR_003270.1

clone name	MSMg01-388L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-097L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247A11
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-118J03.T7 (MSMg01no118_j03.b1)	MSMg01-118J03.TJ (MSMg01no118_j03.g1)
ACC	AG329408	AG329409
length	738	709
length of high quality (start - end)	---	210 (77 - 286)
definition	CHROMAT_FILE: MSMg01no118_j03.b1 PHD_FILE: MSMg01no118_j03.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:25:28 2005	CHROMAT_FILE: MSMg01no118_j03.g1 PHD_FILE: MSMg01no118_j03.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:25:28 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	CCAGCGGGGGGTGGATCAAAATTTGCGGCGCTAAANGAGTCACAATCGNA ACCAGCNNGNGGANNNNNGNTATTCCCAAAAAAAGGGNGNNNNGNGNGAG GGGNNGAGNNNAGGGGGGNNGGGNGGTTTGCCTCGCGTTTGTGGGGTGGG TTAGAGAAAGAATGGTAGGTTAAAGGAAGAGTTATGTAAATGATAAGATG GTGAAGAGTTGGNTTATATGGGTATTATGGTGGGAGATGGTTGTTGATAG ATGATAATATTTTTTTGGATTAATAGTAAGGNAGAGGTTAGGAGAGATGG TTCAGTATGTAAGATAAGGGAATGTTTAATCATTTTNCCNGCGCCCACCC CCCAGCAACCACATTTTTTTTTTCCCCCCCCCACCCTGAGATTTGACACT CTCTTCCGGCGGGCCCGACTTCTTCCATAAAGAAATAAAGTACCTTCGTC GGCCCTTTTTCCTTCTTTTCCCCCTTTCTTCGCGTGTCTTTTTTGTTTCA TCCTACGGCTATCCCATGCTTGTGCGCTCATTTCTTTCCCCTGTTTTTAT GCCTCCATCCCATTAGCTTTTCCTCCCGTTTCCCCCCCCTCCCTCCCGTT TCCCCGCCTTTTTCGCCCTTTTTGTCCTCTTTTCCCTCCCCTCCCCCGTT TATTCCCCCTTCCTTCCGCCTTTCCTATGCTCTTTTTTTTTTTTTTCNCA TTGGCCGTTCACCCTCTCCCCGACTTTTTCCCCCCCCT	NTCGATGATAGTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXACTTGTCATGTATATGTCACCTGG TCAAATTCCTTCATATCTGGCTTTTTAACTCCATTCAAGTTTGTTTGTTT GTTGGTTTGTTTTAACGGACACTACATCTTTGTATTTATTCGACCTTTAC TACATCAAACTGAACCATATTCTTCTTAAACCTGCTCCTAGATTTCCTGT TTCCCTAAGTGGTGCTAGTCTCCACCTGTTTTCAAAAGAAGGGAGCTCAA GAATTATTTTTGCCTCCTCTTTCTATATCCAATCAACCACTACAACCCCC ATGCTAATCTCCTCCAGTGTTTCGTGCCCGATGTGTGTGCCACTGTGCTC TTGCTTCCTTTTCCCTTTTCTTACCTTCCCACCCTTTTCTCTCTTCTTCC TTTTTTTCATTTCCCCTTTTCATTTCCCCCGCTTTCTCCTCTTTCCCCCT TTTCCTTTCTTTCTCACATCCTTCCTTCTTCCCCTTTCACTCCCCCTCCT TTTTCTCTTTCACACTTCCTCCACTTTTCCACCTCTTTCCCTCTCTCTCC TTATATTTTTCACCCCTTTTTTTTCTTCCTTTTTTTCCCCCCATTTTTTC TCCCCTTTCCTTTTTTCCTCCAATTCTTCCCTTTTCTTTCCTCTTTTCCC CCCCTTTCC
quality values	Open. Hide. 6 6 6 6 6 6 8 8 10 10 10 9 8 8 8 8 10 8 8 10 11 12 14 24 13 10 8 8 7 7 8 11 9 12 3 0 3 8 8 8 8 8 3 3 6 6 6 3 0 3 6 6 6 6 6 3 0 0 3 0 3 23 3 0 0 0 0 0 3 0 3 6 6 10 11 12 9 9 9 14 19 14 11 10 10 10 3 0 3 0 0 0 0 3 0 3 0 3 6 9 15 19 3 0 0 3 18 3 0 0 0 3 18 9 6 6 6 3 0 0 3 7 3 0 3 6 6 7 9 9 9 9 8 8 8 6 6 7 7 6 6 6 6 6 10 11 12 18 28 24 23 23 15 21 23 32 21 15 10 7 7 11 7 7 9 6 10 8 6 6 6 8 11 12 15 17 7 6 6 6 6 8 15 9 8 8 8 8 8 9 15 16 12 10 8 8 10 10 12 11 12 11 17 19 19 14 18 14 28 12 16 3 0 3 11 11 11 11 15 23 11 9 9 8 8 8 8 8 8 9 9 12 17 17 18 19 19 23 23 20 18 24 12 12 8 12 15 20 13 14 13 14 14 18 16 16 12 9 11 11 13 15 9 8 8 8 9 12 17 12 12 9 9 9 11 16 10 10 10 13 3 0 3 9 9 9 12 11 15 10 8 6 6 6 8 8 13 15 12 11 11 11 20 11 9 9 10 10 10 10 11 11 8 8 8 10 6 6 6 6 6 6 9 9 9 16 12 10 9 9 9 9 8 8 7 3 0 3 3 0 3 8 8 12 13 8 8 8 9 9 14 14 15 11 11 9 8 8 8 10 10 17 16 9 12 12 13 10 9 9 10 8 9 10 10 11 16 19 17 12 17 9 10 10 11 8 8 10 22 11 15 12 15 15 21 16 10 10 10 11 11 11 12 8 10 8 8 8 8 8 9 9 9 8 8 8 10 8 11 11 11 9 14 14 7 7 6 6 8 8 10 11 11 14 11 11 12 12 12 11 12 12 11 15 18 18 8 6 6 6 8 8 12 15 15 21 22 24 13 14 13 13 12 13 13 15 15 10 9 9 9 14 15 12 11 11 13 18 12 8 8 8 10 8 8 7 10 10 12 10 10 10 11 11 11 11 13 8 8 6 6 8 8 8 10 8 6 6 6 8 8 15 10 8 10 8 8 8 8 8 8 6 6 6 6 6 6 8 9 9 9 9 9 14 12 22 10 10 8 8 8 6 6 6 10 8 10 10 10 10 10 10 15 15 8 8 8 10 8 8 8 8 8 8 9 9 9 9 9 9 11 12 10 9 9 10 8 11 9 15 10 12 9 10 9 10 12 12 12 12 8 12 12 12 16 19 19 19 12 11 11 10 9 8 8 8 8 15 11 11 12 10 10 6 6 6 6 11 13 10 10 8 8 8 8 10 10 8 8 8 10 10 12 12 19 18 15 15 10 12 9 8 10 12 18 16 13 13 12 13 9 9 9 13 12 8 8 8 12 15 8 9 11 17 10 11 6 7 6 6 8 12 14 17 10 7 6 6 6 6 8 11 8 10 12 20 28 24 29 39 37 39 34 27 25 12 3 0 3 6 8 8 8 8 8 8 9 9 9 9 8 8 9 8 10 10 8 8 8 10 8 8 8 8 11 11 8 12 12 14 15 13 21 12 10 10 12 9	Open. Hide. 0 3 7 7 7 13 6 6 6 6 10 10 16 10 10 10 15 20 22 29 29 31 37 22 22 22 22 28 30 23 25 15 14 9 9 9 9 9 9 9 9 10 19 14 18 11 11 21 26 31 36 36 48 33 33 34 34 28 17 13 8 6 6 8 8 8 9 10 18 13 14 16 27 32 33 33 33 36 36 57 33 34 34 34 34 34 41 43 43 37 40 37 37 36 42 42 36 43 42 42 28 30 37 44 48 46 47 48 57 41 41 41 41 37 40 48 48 48 47 39 42 37 39 39 47 47 43 41 41 41 41 41 41 41 41 40 30 29 29 39 37 37 33 33 28 33 30 30 24 29 28 28 28 22 28 28 33 33 33 33 33 37 47 41 32 32 15 10 8 8 8 15 19 37 30 30 37 37 37 30 31 16 19 12 21 21 34 23 24 16 22 21 33 33 43 43 43 43 43 43 34 43 39 39 36 36 30 30 30 33 33 39 37 36 36 39 39 39 41 47 34 23 16 9 9 15 19 33 41 46 39 39 43 37 37 35 39 24 30 21 20 20 26 25 37 28 23 23 23 37 28 37 33 47 41 26 18 15 13 17 14 15 14 18 23 28 28 28 21 21 15 15 12 27 27 28 32 32 30 28 23 23 20 23 17 20 17 23 24 12 12 11 18 18 28 24 25 25 18 17 17 20 24 28 37 37 39 36 35 28 32 23 23 28 37 37 36 35 35 30 33 18 13 8 8 8 8 9 18 21 17 17 18 18 18 19 11 13 14 10 8 8 7 7 11 11 13 19 9 9 10 8 7 7 13 15 15 18 23 28 15 15 8 8 8 8 8 19 22 13 11 11 10 10 10 10 10 10 8 6 6 8 8 12 12 11 8 8 8 8 8 8 8 8 9 9 8 8 8 8 9 9 8 8 8 8 8 8 8 10 11 11 11 10 10 8 10 10 11 9 9 9 9 9 10 13 13 15 15 10 9 9 10 9 10 10 10 8 8 8 10 8 8 8 10 17 16 18 18 22 21 19 11 15 8 10 8 8 8 8 8 10 10 12 12 10 8 8 12 8 8 8 8 12 22 19 11 11 8 6 6 6 6 7 6 10 10 21 14 12 12 12 12 16 14 11 16 10 10 10 16 12 14 13 13 15 18 19 17 11 11 11 11 8 8 6 6 8 8 8 8 10 8 8 16 12 10 10 10 10 10 10 10 10 11 23 13 8 8 8 10 10 10 11 11 11 11 11 11 13 19 25 23 18 15 13 10 10 8 10 8 8 6 7 8 10 9 8 10 10 10 6 6 8 12 16 16 8 8 6 6 6 10 13 13 10 12 10 10 8 8 10 9 10 12 10 10 10 11 11 12 10 8 8 10 8 9 10 15 12 9 9 9 10 11 11 9 9 9 9 22 17 26 18 19 10 10 8 8 8 8 10 21 11 15 11 10 10 8 10 16 11 11 11 18 18 15 13 8 8 8 10 10 10 14 12 25 10 10 10 10 10 18 23 21 11 8 8 8 8 8 8 10 10 10 10 10 10 13 10 10 12 9 8 11 8 8 8 8 8 8 8 8 8 13 13 12 11 10 10 13 10 8 8 8 8 8 10 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no118_j03.g1 MSMg01no118_j03.g1 CHROMAT_FILE:
MSMg01no118_j03.g1 PHD_FILE: MSMg01no118_j03.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 18:25:28 2005
         (210 letters)



>mm_chr4_131811478_131812085
          Length = 608

 Score =  375 bits (194), Expect = e-109
 Identities = 206/210 (98%), Gaps = 2/210 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   acttgtcatgtatatgtcacctggtcaaattccttcatatctggctttttaactccattc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 acttgtcatgtatatgtcacctggtcaaattccttcatatctggctttttaactccattc 260

                                                                       
Query: 61  aagtttgtttgtttgttggtttgttttaacggacactacatctttgtatttattcgacct 120
           ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 261 aagtttgtttgtttgttggtttgttttaacggatactacatctttgtatttatt-gacct 319

                                                                       
Query: 121 ttactacatcaaactgaaccatattcttcttaaacctgctcctagatttcctgtttccct 180
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 320 ttactacatcaaactgaaccatattct-cttaaacctgctcctagatttcctgtttccct 378

                                         
Query: 181 aagtggtgctagtctccacctgttttcaaa 210
           |||||||||||| |||||||||||||||||
Sbjct: 379 aagtggtgctagcctccacctgttttcaaa 408


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 11
Number of extensions: 3
Number of successful extensions: 3
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 210
Length of database: 608
Length adjustment: 9
Effective length of query: 201
Effective length of database: 599
Effective search space:   120399
Effective search space used:   120399
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information