MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-137I15
Chromosome	4 (Build37)
Map Location	130,339,072 - 130,339,306
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Kpna6, Tmem39b, Khdrbs1, LOC100040532, Ptp4a2, LOC622469, LOC622480, 1700003M07Rik, Bai2, Col16a1, Pef1, Hcrtr1, Tinagl, Gm853, Serinc2, Fabp3, Zcchc17, Wdr57, 2610200G18Rik, Pum1, LOC622577
Downstream gene	Sdc3, Laptm5, Matn1, LOC622681, LOC100041575, Gm831, EG664832, LOC100039799, Ptpru
Link	Open Mouse BAC browser

Click to get alignment info.

name	Kpna6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16650 MGI:1100836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem39b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230770 MGI:2682939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Khdrbs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20218 MGI:893579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040532 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 4 Proteins pseudo : _no_value

name	Ptp4a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19244 MGI:1277117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622469 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622469
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 631 ESTs, 15 Proteins

name	LOC622480 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	1700003M07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72225 MGI:1919475
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Bai2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230775 MGI:2451244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col16a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107581 MGI:1095396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pef1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67898 MGI:1915148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hcrtr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230777 MGI:2385650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tinagl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94242 MGI:2137617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm853 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:332942 MGI:2685699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serinc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230779 MGI:1919132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fabp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14077 MGI:95476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zcchc17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619605 MGI:1919955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr57 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66585 MGI:1913835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610200G18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67149 MGI:1914399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pum1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80912 MGI:1931749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622577 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Sdc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20970 MGI:1349163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Laptm5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16792 MGI:108046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Matn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17180 MGI:106591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622681 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100041575 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Gm831 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329950 MGI:2685677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG664832 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664832 MGI:3643258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100039799 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ptpru (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19273 MGI:1321151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Kpna6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364978 GeneID:16650 MGI:1100836
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : karyopherin (importin) alpha 6 transcript_id : NM_008468.3

name	Tmem39b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40556283 GeneID:230770 MGI:2682939
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 39b transcript_id : NM_199305.1

name	Khdrbs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626030 GeneID:20218 MGI:893579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : KH domain containing, RNA binding, signal transduction associated 1 transcript_id : NM_011317.3

name	Ptp4a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56711341 GeneID:19244 MGI:1277117
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase 4a2 transcript_id : NM_008974.3

name	LOC622469 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253123 GeneID:622469
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 631 ESTs, 15 Proteins product : similar to SRp40-1 transcript_id : XM_886902.3

name	LOC622480 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253111 GeneID:622480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : similar to SPOC domain containing 1 transcript_id : XM_886912.3

name	1700003M07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253113 GeneID:72225 MGI:1919475
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 1700003M07 gene transcript_id : XM_001473353.1

name	Bai2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27414502 GeneID:230775 MGI:2451244
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain-specific angiogenesis inhibitor 2 transcript_id : NM_173071.1

name	Col16a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372516 GeneID:107581 MGI:1095396
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type XVI, alpha 1 transcript_id : NM_028266.4

name	Pef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801848 GeneID:67898 MGI:1915148
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : penta-EF hand domain containing 1 transcript_id : NM_026441.3

name	Hcrtr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930592 GeneID:230777 MGI:2385650
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypocretin (orexin) receptor 1 transcript_id : NM_198959.1

name	Tinagl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892626 GeneID:94242 MGI:2137617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulointerstitial nephritis antigen-like transcript_id : NM_023476.2

name	Gm853 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371383 GeneID:332942 MGI:2685699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 853, (NCBI) transcript_id : NM_001034872.2

name	Serinc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802736 GeneID:230779 MGI:1919132
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine incorporator 2 transcript_id : NM_172702.2

name	Fabp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753809 GeneID:14077 MGI:95476
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fatty acid binding protein 3, muscle and heart transcript_id : NM_010174.1

name	Zcchc17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981968 GeneID:619605 MGI:1919955
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCHC domain containing 17 transcript_id : NM_153160.2

name	Wdr57 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115298669 GeneID:66585 MGI:1913835
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 57 (U5 snRNP specific) transcript_id : NM_025645.2

name	2610200G18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367659 GeneID:67149 MGI:1914399
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610200G18 gene transcript_id : NM_025998.2

name	Pum1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507675 GeneID:80912 MGI:1931749
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pumilio 1 (Drosophila) transcript_id : NM_030722.1

name	LOC622577 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372540 GeneID:622577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical LOC622577 transcript_id : XM_897188.2

name	Sdc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110349994 GeneID:20970 MGI:1349163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syndecan 3 transcript_id : NM_011520.3

name	Laptm5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543110 GeneID:16792 MGI:108046
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysosomal-associated protein transmembrane 5 transcript_id : NM_010686.2

name	Matn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6857809 GeneID:17180 MGI:106591
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrilin 1, cartilage matrix protein 1 transcript_id : NM_010769.1

name	LOC622681 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372541 GeneID:622681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC622681 transcript_id : XM_897250.2

name	LOC100041575 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253156 GeneID:100041575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041575 transcript_id : XM_001477132.1

name	Gm831 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253158 GeneID:329950 MGI:2685677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : gene model 831, (NCBI) transcript_id : XM_001477145.1

name	LOC100039799 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253139 GeneID:100039799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039799 transcript_id : XM_001473535.1

name	Ptpru (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031954 GeneID:19273 MGI:1321151
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, U transcript_id : NM_011214.2

name	Ptpru (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031996 GeneID:19273 MGI:1321151
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, U transcript_id : NM_001083119.2

name	Kpna6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370260 CCDS:CCDS18701.1 GeneID:16650 MGI:1100836
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence IDA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006606 - protein import into nucleus [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : karyopherin (importin) alpha 5 product : karyopherin (importin) alpha 6 protein_id : NP_032494.2

name	Tmem39b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556284 CCDS:CCDS18702.1 GeneID:230770 MGI:2682939
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 39b protein_id : NP_955009.1

name	Khdrbs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626031 CCDS:CCDS18703.1 GeneID:20218 MGI:893579
definition	GO_component : GO:0016020 - membrane [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence ISS] [Evidence IEA] [Evidence IDA]; GO:0005070 - SH3/SH2 adaptor activity [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0046831 - regulation of RNA export from nucleus [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : src associated in mitosis, 68 kDa product : KH domain containing, RNA binding, signal transduction associated 1 protein_id : NP_035447.3

name	Ptp4a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679545 CCDS:CCDS18704.1 GeneID:19244 MGI:1277117
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] codon_start : 1 product : protein tyrosine phosphatase 4a2 protein_id : NP_033000.1

name	LOC622469 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895195 GeneID:622469
definition	codon_start : 1 product : similar to SRp40-1 protein_id : XP_891995.1

name	LOC622480 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253112 GeneID:622480
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892005.3

name	1700003M07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253114 GeneID:72225 MGI:1919475
definition	codon_start : 1 product : hypothetical protein LOC72225 protein_id : XP_001473403.1

name	Bai2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27414503 GeneID:230775 MGI:2451244
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016527 - brain-specific angiogenesis inhibitor activity [Evidence IDA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA]; GO:0007422 - peripheral nervous system development [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : G protein-coupled receptor; G protein-coupled receptor brain-specific angiogenesis inhibitor 1 product : brain-specific angiogenesis inhibitor 2 protein_id : NP_775094.1

name	Col16a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410760 GeneID:107581 MGI:1095396
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : [a]1 (XVI) collagen product : procollagen, type XVI, alpha 1 protein_id : NP_082542.2

name	Pef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980937 CCDS:CCDS18706.1 GeneID:67898 MGI:1915148
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : PEF protein with a long N-terminal hydrophobic domain protein_id : NP_080717.2

name	Hcrtr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930593 CCDS:CCDS18707.1 GeneID:230777 MGI:2385650
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016499 - orexin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : orexin receptor type 1 product : hypocretin (orexin) receptor 1 protein_id : NP_945197.1

name	Tinagl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963691 CCDS:CCDS18708.1 GeneID:94242 MGI:2137617
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 note : lipocalin 7, AZ-1; adrenocortical zonation factor 1; androgen-regulated gene 1 product : tubulointerstitial nephritis antigen-like protein_id : NP_075965.1

name	Gm853 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702213 GeneID:332942 MGI:2685699
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA] GO_process : GO:0006596 - polyamine biosynthesis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC332942 protein_id : NP_001030044.1

name	Serinc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370016 GeneID:230779 MGI:1919132
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006658 - phosphatidylserine metabolism [Evidence ISS]; GO:0051347 - positive regulation of transferase activity [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy product : tumor differentially expressed 2-like protein_id : NP_766290.1

name	Fabp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753810 CCDS:CCDS18709.1 GeneID:14077 MGI:95476
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006656 - phosphatidylcholine biosynthesis [Evidence IGI]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : fatty acid binding protein heart 4; fatty acid binding protein heart 1 product : fatty acid binding protein 3, muscle and heart protein_id : NP_034304.1

name	Zcchc17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346607 GeneID:619605 MGI:1919955
definition	GO_component : GO:0005842 - cytosolic large ribosomal subunit (sensu Eukaryota) [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : putative S1 RNA binding domain protein protein_id : NP_694800.1

name	Wdr57 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115298670 GeneID:66585 MGI:1913835
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : U5 snRNP-specific protein (Prp8-binding) protein_id : NP_079921.2

name	2610200G18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385502 GeneID:67149 MGI:1914399
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67149 protein_id : NP_080274.1

name	LOC622577 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895205 GeneID:622577
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902281.1

name	Pum1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507676 CCDS:CCDS18710.1 GeneID:80912 MGI:1931749
definition	GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : pumilio 1 protein_id : NP_109647.1

name	Sdc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42476310 GeneID:20970 MGI:1349163
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008092 - cytoskeletal protein binding [Evidence IEA] codon_start : 1 product : syndecan 3 protein_id : NP_035650.2

name	Laptm5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754504 CCDS:CCDS18712.1 GeneID:16792 MGI:108046
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005764 - lysosome [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : lysosomal-associated protein transmembrane 5 protein_id : NP_034816.1

name	Matn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857810 CCDS:CCDS18713.1 GeneID:17180 MGI:106591
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA] GO_function : GO:0005518 - collagen binding [Evidence IEA]; GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030198 - extracellular matrix organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : matrilin 1, cartilage matrix protein 1 protein_id : NP_034899.1

name	LOC622681 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895207 GeneID:622681
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902343.1

name	LOC100041575 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253157 GeneID:100041575
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477182.1

name	Gm831 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253159 GeneID:329950 MGI:2685677
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477195.1

name	LOC100039799 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253140 GeneID:100039799
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473585.1

name	Ptpru (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134031955 CCDS:CCDS18714.1 GeneID:19273 MGI:1321151
definition	GO_component : GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0007185 - transmembrane receptor protein tyrosine phosphatase signaling pathway [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; protein tyrosine phosphatase, receptor type, L product : protein tyrosine phosphatase, receptor type, U isoform 1 protein_id : NP_035344.2

name	Ptpru (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778922 GeneID:19273 MGI:1321151
definition	GO_component : GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0007185 - transmembrane receptor protein tyrosine phosphatase signaling pathway [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; protein tyrosine phosphatase, receptor type, L product : protein tyrosine phosphatase, receptor type, U isoform 2 protein_id : NP_001076588.1

name	EG664832 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664832
definition	number : 6 pseudo : _no_value

name	EG664832 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664832
definition	number : 5 pseudo : _no_value

name	EG664832 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664832
definition	number : 4 pseudo : _no_value

name	EG664832 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664832
definition	number : 3 pseudo : _no_value

name	EG664832 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664832
definition	number : 2 pseudo : _no_value

name	EG664832 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664832
definition	number : 1 pseudo : _no_value

name	LOC100040532 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253122 GeneID:100040532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 4 Proteins product : similar to ribosomal protein L37 pseudo : _no_value transcript_id : XR_032427.1

clone name	MSMg01-384C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528B01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131E15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-137I15.T7 (MSMg01no137_i15.b1)	MSMg01-137I15.TJ (MSMg01no137_i15.g1)
ACC	AG343438	AG343439
length	724	739
length of high quality (start - end)	588 (67 - 654)	228 (72 - 299)
definition	CHROMAT_FILE: MSMg01no137_i15.b1 PHD_FILE: MSMg01no137_i15.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:54:15 2005	CHROMAT_FILE: MSMg01no137_i15.g1 PHD_FILE: MSMg01no137_i15.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:54:15 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	CAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTCGAGAAGAGCGCGGAATT CTTATACTTGCGATTGCCAGTTTGACGAGTACCATTTGCTGAAGATGCTT TCTTTTTGCCACAAAAAGAAAGCTTTCTGGAAAGGTTTTGGCTTCTTTGT CAAAGATCAAGTGTCTATAAGTGTGTGTTTCTTTCTGGGTCTTCAGTTCT ATTCCCTTGATCAACCTACCTGTCTCTGTACCAATACCATGTGGTTTTTA TCACTATTGCTCTGTAGTGCAGCTTGAGGTCAGGAATGGTGGAAATGCAG GGACAAAAGTGGAGAATATACTGAAGGAAATGTCATCCAGTGACCAGCCC AATTTGAGATCCATCCCATGTGCAGGCACCAAACCCTGACACTGCTAGAG ATGCTATGTTGTGGGTGCATACAGAAGTCTAGCATGGCTGTCTTCTGAGA GGCTCTACCAGCAGCTGACTGAGACAGATGCAGATACTTACAGCCAACCA TTGACTGAGGTCAGAGACCCCTATTGTTATAGTTAGGGTTTTACTGCTAT GAACAGACACCATGACTAAGGCAAGTCTTATAAAGGACAGCATATATTTG GGGCTGGCTGCTTACAGGTTCAGAGGTTCAGTCCATTATCATCAAGGCGG GAACATGGCAGCATCCAGGCAGGCATGGTGCAGGCAGAACTGAGAGTTCT ACATCTTCATCTGAAGGCTGCTAG	ATGCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXCTAAACACCTTGTCTCCCAAGTGTTGGGA TTTATAAATATGCGCTGGCTCAGTTGGCTTTGTTTTTCTACTTCTGAGAC ACTCGTGTTACTGTAGCTTAAGGCCAGACCCTCCATCCTCCTGCCTTTGC CTCTCTTAGGGTTGATGACAGGCTTCTGGGTTCTTAAGATAGTTCCTGTT CTGTGTGCGTAGCCACCAAGTGGGTGGGGGGGGGGGAAGAAGAGGCTGCG TATAGACATATAACTATTTTTTTTAATAAGAATTCTCTATACTCTTTTCG TATTTTTTTTTTTCTTTCCTCGCCACACATAGCATCGTTTTTTCTTCATT TTCCATATCCCCATCCTTATTATTCTCCCCAATACTTTCTAATTAATTTT CCTGGTTAATTTCCACTATATAAATAAATGATCCTCTCGCTTTTTCGACT TCTCTTACTCACTTTATATTGAAGTAACTTATCATTATTATTAACTAATA ATAAAGTATTTTTTCATATGAGTATTCACACATATTGTTAACTCCTGTTT ATTGCTTCTTTATTGTGTAATTTTAGCATCTTATTATCATATTTTTTATA CTTTACATTTCTATCTCTATCTATTACTAATCCTTTCTCCTTATTCATAT ATCTCTTGTTTTTATCTCCCTCTTGTTCATTTCAATTTT
quality values	Open. Hide. 10 10 9 10 9 24 19 28 25 19 10 10 14 22 19 33 36 36 29 37 37 37 37 27 20 22 20 15 10 10 10 12 9 9 9 9 9 9 9 9 9 10 17 21 30 33 33 33 33 33 33 50 47 34 22 10 8 6 6 6 6 6 10 17 19 18 21 21 29 29 31 41 53 53 53 53 57 57 57 57 50 50 47 47 47 47 53 50 50 50 53 53 47 48 48 48 48 50 68 68 68 68 68 68 68 51 51 50 50 50 50 50 50 50 50 59 48 48 48 57 57 57 57 68 68 68 57 57 57 57 68 68 51 50 50 50 50 42 57 54 57 57 68 68 68 68 68 68 68 68 68 68 68 51 50 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 57 68 68 68 68 68 68 68 68 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 62 62 62 68 68 68 68 68 68 68 62 62 62 62 62 62 44 43 23 23 11 11 13 13 17 16 39 39 43 43 52 62 62 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 52 52 57 57 57 57 68 68 59 68 57 57 57 57 52 52 52 57 57 57 57 57 57 59 59 59 57 57 57 59 59 59 59 59 59 57 57 43 43 33 33 33 44 44 68 68 57 57 57 50 38 43 43 57 57 57 57 57 57 54 57 57 57 57 57 54 52 52 57 59 57 57 57 57 52 52 52 57 50 54 54 59 44 43 31 22 32 32 32 43 57 48 57 57 59 59 59 54 57 57 59 57 57 57 57 57 47 47 39 44 39 37 37 44 44 43 43 43 37 37 43 44 48 48 47 36 33 33 32 32 41 44 57 48 48 46 46 46 46 46 59 46 48 57 57 57 57 57 57 57 57 57 59 59 48 48 48 48 39 39 35 35 30 37 37 37 37 37 37 23 23 14 17 17 24 37 47 43 47 36 37 29 33 28 29 29 32 34 33 32 30 30 30 39 28 34 23 20 17 24 28 26 30 35 39 39 43 43 57 47 43 39 39 37 40 39 39 39 28 28 28 32 26 26 14 14 14 30 24 25 18 30 22 22 19 11 12 18 20 34 34 32 25 22 14 16 16 18 15 26 30 32 28 28 18 22 21 26 15 12 11 12 12 15 15 24 30 30 30 22 22 22 31 32 26 10 12 12 8 8 8 21 21 17 16 14 16 21 23 32 25 28 32 22 19 11 11 11 17 12 14 15 16 11 10 12 13 16 18 33 37 37 40 41 41 21 15 10 10 10 14 18 19 10 10 10 10	Open. Hide. 9 12 9 9 9 9 19 19 11 11 10 15 19 28 30 30 37 37 33 33 33 33 33 33 39 27 21 9 9 6 6 6 6 6 6 9 10 8 8 8 8 8 10 21 21 19 10 12 12 26 22 33 33 37 23 23 11 10 10 9 7 6 6 6 6 11 19 37 39 40 40 40 47 43 35 36 36 36 35 35 57 57 48 57 57 57 40 40 40 36 36 42 48 50 50 50 50 42 47 42 50 50 50 68 68 68 68 57 54 54 54 57 57 57 57 57 57 57 47 41 42 42 42 50 57 57 68 68 68 68 68 68 68 57 57 59 59 59 57 57 68 68 68 68 57 57 68 51 57 57 50 50 50 57 57 57 57 68 57 57 57 57 57 57 57 57 57 57 59 59 59 59 59 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 68 57 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 50 50 50 50 50 57 57 57 57 59 57 59 59 59 59 54 57 57 57 59 59 57 57 57 57 57 57 57 57 54 54 57 59 59 57 59 57 54 54 54 54 54 54 54 59 59 59 59 57 68 68 68 57 57 54 54 48 59 48 46 46 43 47 43 43 43 47 43 48 48 48 48 48 59 59 47 47 32 32 25 23 23 19 10 8 8 8 8 8 10 10 10 11 8 8 8 15 13 12 8 8 8 8 8 9 13 19 17 16 17 10 10 9 9 9 9 8 10 8 8 8 8 12 12 8 8 6 6 10 6 6 6 8 12 12 10 10 10 10 10 18 18 22 21 24 18 13 11 8 8 7 7 10 8 8 8 8 12 8 8 6 6 8 8 10 8 8 8 8 8 8 13 13 11 15 13 15 12 10 9 9 8 10 7 7 8 10 10 10 8 8 8 8 10 10 10 10 10 10 10 9 9 11 10 10 10 11 12 12 12 12 15 12 12 11 11 9 9 8 8 6 6 8 8 8 8 8 8 9 10 14 10 12 10 10 10 17 16 10 10 10 10 10 11 11 13 11 11 9 8 8 8 8 10 8 13 10 10 8 8 10 10 8 9 8 8 8 8 10 8 9 10 8 8 8 6 6 8 8 10 8 6 6 6 8 8 10 10 11 11 11 11 10 10 10 10 13 11 14 18 13 13 11 11 8 8 8 8 8 8 8 8 10 10 10 10 11 10 8 8 6 6 8 10 10 8 8 8 8 11 11 11 11 12 10 8 8 8 8 8 8 8 6 6 8 8 10 10 10 15 8 8 8 8 6 8 6 6 8 8 6 6 8 8 10 10 10 11 11 11 12 12 11 8 8 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 9 9 10 8 8 8 8 8 8 8 8 8 8 15 10 10 11 12 11 9 9 9 8 8 8 8 8 8 8 8 8 10 10 10 10 8 15 17 10 10 10 10 10 10 8 8 8 8 8 8 10 8 7 7 7 10 10 10 10 10 10 10 8 8 8 8 8 8 10 10 8 8 6 6 8 8 8 8 8 10 10 8 8 8 8 8 8 8 8 11 12 12 10 8 6 6 8 8 10 10 10 10 10 10 8 8 8 8 8 8 8 8 8 6 8 8 8 8 8 6 6 6 8 10 8 8 8 8 8 10 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no137_i15.g1 MSMg01no137_i15.g1 CHROMAT_FILE:
MSMg01no137_i15.g1 PHD_FILE: MSMg01no137_i15.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 18:54:15 2005
         (228 letters)



>mm_chr4_130338890_130339519
          Length = 630

 Score =  397 bits (205), Expect = e-115
 Identities = 224/235 (95%), Gaps = 8/235 (3%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctaaacaccttgtctcccaagtgttgggatttataaatatgcgctggctcagttggcttt 60
           ||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 417 ctaaacatcttgtctcccaagtgttgggatttataaatatgcactggctcagttggcttt 358

                                                                       
Query: 61  gtttttctacttctgagacactcgtgttactgtagcttaaggccagaccctccatcctcc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 357 gtttttctacttctgagacactcgtgttactgtagcttaaggccagaccctccatcctcc 298

                                                                       
Query: 121 tgcctttgcctctcttagggttgatgacaggcttctgggttcttaagatagttcctgttc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 297 tgcctttgcctctcttagggttgatgacaggcttctgggttcttaagatagttcctgttc 238

                                                                  
Query: 181 tgtgtgcgtagccaccaagtgggtggg--------ggggggggaagaagaggctg 227
           |||||||||||||||||||||||||||        |||||||| |||||||||||
Sbjct: 237 tgtgtgcgtagccaccaagtgggtgggtgggtggggggggggggagaagaggctg 183


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 10
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 228
Length of database: 630
Length adjustment: 9
Effective length of query: 219
Effective length of database: 621
Effective search space:   135999
Effective search space used:   135999
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information